Printer Friendly

Rapid detection of deletion mutations in inherited metabolic diseases by melting curve analysis with LightCycler.

Recently, non-gel electrophoresis-requiring, fluorophore probe-based rapid techniques have been introduced to detect known single-point mutations using the LightCycler[TM] (Roche Molecular Biochemicals) (1-4). This technique provides very rapid analytical time, real-time detection, and visualized images. Many inherited metabolic diseases are caused not only by single-point mutations but also by small deletion mutations. However, no studies have been reported on the detection of such deletion mutations using the LightCycler. Using melting curve analysis with the LightCycler, we have succeeded in rapidly detecting a 2-bp deletion mutation in genomic DNA of a patient with Fabry disease and a 9-bp deletion mutation in cDNA of a patient with carbamoyl-phosphate synthase I (CPS1; EC 6.3.4.16) deficiency.

Fabry disease is an X-linked recessive disorder caused by the deficient activity of [alpha]-galactosidase ([alpha]-Gal; EC 3.2.1.22). A 15-year-old boy with classical Fabry disease who had suffered from angiokeratoma, acroparesthesias, and attacks of pain in his legs was referred to us. We extracted total RNA from his peripheral blood lymphocytes and analyzed the [alpha]-GAL gene (GLA; GenBank accession no. X14448) by reverse transcription-PCR (5). We sequenced a 1.3-kb PCR product covering the entire coding region and found a 2-bp deletion mutation at nucleotides 11 008-11 009. This change caused a frame-shift mutation that had been described previously in another case of the disease (6).

With written informed consent, we examined the patient's relatives, including his mother, his unaffected brother, and his maternal grandmother, to determine whether they carry this mutation. Genomic DNAs were obtained from their peripheral blood lymphocytes, using QIAamp Blood Kit[R] (Qiagen) according to the manufacturer's instructions.

For fluorescence PCR analysis, we prepared two PCR primers (2Del-S and 2Del-AS) and two fluorescence probes (2Del-F and 2Del-LC; Table 1). A 25mer oligonucleotide probe, 2Del-LC, synthesized by standard phosphoramidite chemistry, was labeled at the 5' end with LC Red 640 (Roche Molecular Biochemicals) fluorophore and modified at the 3' end by phosphorylation to avoid extension. Another 20mer oligonucleotide probe, 2Del-F, was synthesized to anneal the region that contained the 2-bp deletion mutation inside, and was labeled at the 3' end with fluorescein. The distance between the two probes was 1 oligonucleotide. When both the probes hybridize in close proximity, fluorescence resonance energy transfer occurs, producing a specific fluorescence emission of LC-Red at 640 nm (Fig. 1A).

The PCR reaction was performed in a 20-[micro]L mixture containing 2 [micro]L of LightCycler DNA Master Hybridization Probes (Taq DNA polymerase, reaction buffer, dNTP mixture, and 10 mmol/L Mg[Cl.sub.2]; Roche Molecular Biochemicals), 2.4 [micro]L of 25 mmol/L Mg[Cl.sub.2], 0.2 [micro]mol/L each of the probes (2Del-F and 2Del-LC), 0.5 [micro]mol/L each of the primers (2Del-S and 2Del-AS), and 50 ng of DNA. The amplified products were 186 bp in the wild type and 184 bp in the mutated type.

The thermal cycling was carried out as follows: initial denaturation at 95[degrees]C for 30 s, followed by 50 cycles of denaturation at 95[degrees]C for 0 s, annealing at 56[degrees]C for 0 s, and extension at 72[degrees]C for 4 s. The ramp rate was set at 20[degrees]C/s. After amplification was complete, a melting curve in which fluorescence (F) was plotted against temperature (T), was obtained by holding at 95[degrees]C for 30 s and then at 45[degrees]C for 20 s, followed by heating slowly at 0.2[degrees]C/s to 85[degrees]C with continuous collection of fluorescence at 640 nm. It took ~30 min for this thermal cycling. The negative derivative of the fluorescence with respect to temperature (2dF/dT) was plotted against temperature.

Derivative melting curves demonstrated a clear difference between their genotypes (Fig. 1B). The curves of the unaffected brother and maternal grandmother showed a wild-type pattern with peaks at 65.5 and 64.7[degrees]C, respectively. On the other hand, because the 2-bp internal deletion decreased the melting temperature ([T.sub.m]), the patient with Fabry disease showed a single peak at 60.3[degrees]C, which is ~5[degrees]C lower than the peaks in the wild type, demonstrating that he had the hemizygous mutation of the [alpha]-GAL gene. His mother showed a heterozygous pattern with two peaks at 59.9 and 65.7[degrees]C, demonstrating that she was a carrier of the disease.

CPS1 deficiency is an autosomal recessive disorder caused by the deficient activity of CPS1, affecting the first enzyme step in the urea cycle. We investigated a boy with the neonatal type of the disease, who showed a low activity of CPS1 in the liver and died at age 28 because of severe hyperammonemia. After extracting total RNA from the liver at autopsy, we analyzed the CPS1 gene (GenBank accession no. Y15793) by reverse transcription-PCR. We synthesized 10 pairs of primer sets to cover the entire coding region (4.5 kb) and performed heteroduplex analysis with MDE[TM] gel (FMC). The aberrant bands were subcloned into pGEM-T easy plasmid (Promega) and sequenced. Because a 9-bp in-frame deletion from nucleotide 832 to nucleotide 840 was identified in the cDNA, we amplified a genomic DNA fragment and found a G-to-C transition at nucleotide 840. Thus, we showed that this splicing abnormality was attributable to a point mutation located at the end of an exon-intron boundary at the donor site; the same mutation had been reported previously (7). Because we also detected a novel nucleotide substitution on the other allele (Aoshima et al., in preparation), he was shown to be a compound heterozygote with two point mutations.

SYBR[TM] Green I dye is a DNA double-strand-specific dye, and its fluorescence emission at 530 nm is greatly enhanced by its binding to double-stranded DNA (Fig. 1C). Using this dye, we tested whether products that differ in [T.sub.m] caused by a deletion can be identified. For fluorescence PCR analysis of the 9-bp deletion, we prepared two PCR primers (9Del-AS and 9Del-AS; Table 1), and three templates; two were the reverse transcription products of the total RNA isolated from the liver of a patient with CPS1 deficiency and a patient with ornithine transcarbamoylase deficiency (as a control); a plasmid containing the homozygous 9-bp deletion mutation was used. The PCR was performed in a 20-[micro]L mixture containing 2 [micro]L of LightCycler DNA Master SYBR Green (Taq DNA polymerase, reaction buffer, dNTP mixture, SYBR Green I dye, and 10 mmol/L Mg[Cl.sub.2]; Roche Molecular Biochemicals), 2.4 [micro]L of 25 mmol/L Mg[Cl.sub.2], 0.5 [micro]mol/L each of the primers (9Del-AS and 9Del-AS), and 50 ng of the templates. The amplified products were 55 bp in the wild type and 46 bp in the mutated type. The thermal cycling was carried out under the above conditions except that the extension was at 72[degrees]C for 1 s and the fluorescence was monitored at 530 nm.

Derivative melting curves demonstrated a clear difference between the genotypes (Fig. 1D). The curve of the control showed a wild-type pattern with a single peak at 76.6[degrees]C. On the other hand, because the 9-bp internal deletion decreased its [T.sub.m], the plasmid containing the homozygous mutation showed a single peak at 74.9[degrees]C, 1.8[degrees]C lower than the wild type. The patient with CPS1 deficiency showed a heterozygous pattern with two peaks at 74.9 and 76.6[degrees]C.

In this study, we first demonstrated that deletions of small nucleotides can be detected rapidly and easily by fluorophore techniques. We could distinguish the genotypes in a family of Fabry disease. The probe, 2Del-F, which contains the deletion site, hybridized to the mutation template, probably forming a loop with the surplus nucleotides. Therefore, it melted off from the mutation template at a lower temperature than from the wild-type template. This technique can be applied to cases with deletion mutations of larger numbers of nucleotides. The [T.sub.m] of a PCR product depends on the length itself and GC content. If the difference between the [T.sub.m]s of the PCR products are large, they can be distinguished from each other using only SYBR Green I dye, as shown in the detection of the 9-bp deletion in CPS1 deficiency. This is a very simple procedure that does not require the designing of specific hybridization probes. However, the deletion must be enough large compared with the whole fragment or contain a high GC content to influence the [T.sub.m]. For example, in the case of this 9-bp deletion, if the PCR products are 100 bp, the difference of [T.sub.m] between the mutation and the wild type will be 0.6[degrees]C, which is not detectable. Although the two mutations in this study are not common, we believe that this technique can be widely utilized for rapid and facile screening of the other diseases that have common deletion mutations.

[FIGURE 1 OMITTED]

References

(1.) Lay MJ, Wittwer CT. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem 1997;43:2262-7.

(2.) Bernard PS, Lay MJ, Wittwer CT. Integrated amplification and detection of the C677T point mutation in the methylenetetrahydrofolate reductase gene by fluorescence resonance energy transfer and probe melting curves. Anal Biochem 1998;255:101-7.

(3.) Kyger EM, Krevolin MD, Powell MJ. Detection of the hereditary hemochromatosis gene mutation by real-time fluorescence polymerase chain reaction and peptide nucleic acid clamping. Anal Biochem 1988;260:142-8.

(4.) von Ahsen N, Schutz E, Armstrong VW, Oellerich M. Rapid detection of prothrombotic mutations of prothrombin (G20210A), factor V (G1691A), and methylenetetrahydrofolate reductase (C677T) by real-time fluorescence PCR with the LightCycler. Clin Chem 1999;45:694-6.

(5.) Miyazaki T, Kajita M, Ohmori S, Mizutani N, Niwa T, Murata Y, et al. A novel mutation (E358K) in the [alpha]-galactosidase A gene detected in a Japanese family with Fabry disease. Hum Mutat 1998;Suppl 1:S139-40.

(6.) Germain D, Biasotto M, Tosi M, Meo T, Kahn A, Poenaru L. Fluorescence-assisted mismatch analysis (FAMA) for exhaustive screening of the [alpha]-galactosidase A gene and detection of carriers in Fabry disease. Hum Genet 1996;98:719-26.

(7.) Hoshide R, Matsuura T, Haraguchi Y, Endo F, Yoshinaga M, Matsuda I. Carbamyl phosphate synthase I deficiency. One base substitution in an exon of the CPSI gene causes a 9-basepair deletion due to aberrant splicing. J Clin Investig 1993;91:1884-7.

Tsutomu Aoshima, [1] * Yoshitaka Sekido, [2] Takashi Miyazaki, [2] Mitsuharu Kajita, [1] Shunji Mimura, [1] Kazuyoshi Watanabe, [1] Kaoru Shimokata, [2] and Toshimitsu Niwa [2] ([1] Department of Pediatrics, Nagoya University School of Medicine, 65 Tsuruma-Cho, Showa-ku, Nagoya 466-8550, Japan; [2] Department of Clinical Preventive Medicine, Nagoya University Daiko Medical Center, 1-1-20 Daikominami, Higashi-ku, Nagoya 461-0047, Japan; * author for correspondence: fax 81-52-719-1132, e-mail taoshima@med. nagoya-u.ac.jp)
Table 1. Oligonucleotides as PCR primers and hybridization probes.

Name Role Position

[alpha]-GAL
 2Del-S PCR primer 10 928 (a)
 2Del-AS PCR primer 11 114
 2Del-F Probe 10 995
 2Del-LC Probe 11 016

CPS1
 9Del-S PCR primer 811 (b)
 9Del-AS PCR primer 865

Name Sequence (5' [right arrow] 3') Modification

[alpha]-GAL
 2Del-S GGGCCACTTATCACTAGTTGC None
 2Del-AS TGATGAAGCAGGCAGGAT None
 2Del-F GTGGGAACGACCTCTCTCAG 3'-Fluorescein
 2Del-LC CTTAGCCTGGGCTGTAGCTATGATA 5'-LC Red 640
 3'-Phosphorylation
CPS1
 9Del-S GCAGAACCACTAATTCAG None
 9Del-AS GCTCCTTGCGATCACTCT None

(a,b) Positions of primers and probes at the 5' termini, according
to GenBank accession number: (a) X14448 for [alpha]-GAL and
(b) Y15793 for CPS1.
COPYRIGHT 2000 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2000 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Aoshima, Tsutomu; Sekido, Yoshitaka; Miyazaki, Takashi; Kajita, Mitsuharu; Mimura, Shunji; Watanabe,
Publication:Clinical Chemistry
Date:Jan 1, 2000
Words:1926
Previous Article:Allelic discrimination for single nucleotide polymorphisms in the human scavenger receptor class B type 1 gene locus using fluorescent probes.
Next Article:Rapid determination of total homocysteine in blood spots by liquid chromatography-electrospray ionization-tandem mass spectrometry.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters