Printer Friendly

Rapid detection of K-ras mutations in bile by peptide nucleic acid-mediated PCR clamping and melting curve analysis: comparison with restriction fragment length polymorphism analysis.

It is well documented that malignant transformations are a result of the accumulation of carcinogenic steps corresponding to activation of oncogenes and inactivation of tumor suppressor genes (1). Among the available candidates, the K-ras protooncogene is the most well-studied cellular gene whose alterations seem to have an important role in the pathogenesis of human cancer. The gene, which encodes 21-kDa GTP-binding protein, controls the mechanisms of cell growth and differentiation. Point mutations in the K-ras gene lead to uncontrolled stimulation of ras-related functions by the altering p21 ras protein-related pathway, locking it in the "on" position for signal transduction (2).

The presence of K-ras gene mutations in bile, duodenal juice, and pancreatic juice has been used to distinguish benign from malignant biliary strictures (3-8). Although K-ras mutations have been detected in some patients with benign biliary strictures, such as chronic pancreatitis and gallstones (3, 6), the detection of such mutations appears to be specific and is considered to be of help in differentiating benign from malignant strictures (3-5). Caldas et al. (9) noted that activating point mutations in codon 12 of the K-ras gene occur in approximately one-half of nonpapillary duct lesions but were present in the majority of papillary, more advanced pancreatic cancers. Cholangiocarcinoma also carries K-ras mutations, but the reported frequencies, as assessed in tissue DNA, vary considerably, from 20-100% in cases in Western countries (10-12) to 5-58% in Japanese cases (13). In general, the frequencies of K-ras mutations in biliary duct carcinoma were reported to be 8-100% in tissue DNA, 5-30% in bile DNA (3, 4,10), and 42% in brushing fluids (14). The point mutations reside mainly in the first two nucleotides of codon 12. Sequencing analysis has revealed that the single-nucleotide substitutions of K-ras codon 12 are mainly GAT, GTT, and CGT, compared with the wild-type codon GGT (10) for patients with pancreatic cancer and GAT, GTT, and TGT/AGT/GCT for patients with cholangiocarcinoma (15).

In addition to differences in the geographic etiologies and carcinogenesis of cholangiocarcinoma, variations in the sensitivities of the methods used for detection of the K-ras mutation might explain some of the differences in K-ras mutation frequencies among studies. K-ras mutations are detected mainly by mutation-specific oligonucleotide hybridization, PCR with restriction fragment length polymorphism (RFLP) analysis, single-strand conformation polymorphism analysis, mutant allelic-specific amplification, or direct sequencing. These procedures involve multiple steps and are time-consuming; they therefore are impractical for routine clinical use. With recent innovations in molecular technology, a new high-speed thermal cycler with online detection has been developed to detect N-ras gene mutations in leukemia (16). Such real-time systems offer many advantages, including speed, reduced risk of contamination, and higher accuracy (17). To detect a minimal amount of mutant in clinical samples, peptide nucleic acid (PNA) oligomes have been used to improve the allele-specific PCR by suppressing the amplification of the background wild type (18). This PNA-mediated PCR clamping technique, followed by ethidium bromide staining (19), a PCR-RFLP step (20), or mass spectrophotometry (21), has been applied to K-ras mutations in tumor samples. Combining PNA-mediated PCR clamping and use of a real-time thermal cycler, Sotlar et al. (22) detected the c-kit point mutation D816V in skin biopsy samples from patients with urticaria pigmentosa.

We conducted this study to establish a one-step real-time PCR method that combines a competing PNA oligomer (clamped probe assay) with fluorescent hybridization probes and melting curve analysis for the detection of K-ras gene codon 12 mutations in bile and to validate their clinical use in the differential diagnosis of biliary obstruction.

Materials and Methods

COLLECTION OF BILE

Fasting bile was obtained from patients with biliary obstruction via an endoscopic nasal biliary drainage catheter or a percutaneous transhepatic biliary drainage catheter on the day of biliary drainage. The bile was centrifuged at 62908 for 10 min, and the pellets and supernatants were stored at -80 oC. The causes of biliary obstruction included hepatolithiasis (n = 17), choledocholithasis (n = 47), benign biliary stricture (n = 6), pancreatic cancer (n = 20), and cholangiocarcinoma (n = 26). Patients were either diagnosed based on pathology as having biliary or pancreatic cancer after surgery or biopsy, or by imaging studies and a long-term follow-up that showed the progress of index lesions.

RFLP ANALYSIS OF K-ras CODON 12 MUTATIONS

DNA was extracted from the pellet by proteinase K treatment followed by the Qiagen DNA Isolation Kit (Qiagen). An enriched PCR-RFLP was performed for the detection of K-ras codon 12 mutations as described previously (10, 23) with minor modifications. In brief, the PCR was conducted in a GeneAmp 9700 thermocycler (Applied Biosystems) using KlA (5'-ACTGAATATAAACTTGTGGTAGTTGGACCT-3') and K1B (5'-TCAAAGAATGGTCCTGGACC-3') as primers (23). The primers contained a mismatch near the 3' ends (underlined base) to generate a BstNI site right upstream of codon 12 in cases of wild type, but not in K-ras mutants. The PCR mixture contained 100 ng of DNA template, 1 [micro]M each of the primers, 200 [micro]M deoxynucleotide triphosphates, 1.5 mM Mg[Cl.sub.2], and 2 U of Taq polymerase in a total volume of 50 [micro]L. The conditions for the PCR were 94[degrees]C for 5 min, followed by 94[degrees]C for 1 min, 55[degrees]C for 90 s, and 72[degrees]C for 90 s in each cycle for 20 cycles. After PCR, 5 [micro]L of the first PCR product was digested with 2 U of BstNI (Biolabs) at 60[degrees]C for 8 h. We used 1/1000 of the first digest as a template for the second PCR with 30 cycles using KlA and K1C (5'-GCATATTAAAACAAGATTTAC-3') as primers. The second PCR product was digested with BstNI again. After digestion, the DNA products were separated by electrophoresis on 3% agarose gels at 100 V for 1 h and stained with ethidium bromide (Sigma). To rule out PCR- and/or incomplete digestion-generated artifacts, all cases with K-ras mutations or equivocal results were confirmed by repeating PCR-RFLP analysis with different dilutions of the first digest.

CLAMPED PROBE ASSAY FOR ANALYSIS OF K-ras MUTATIONS

A set of primers was chosen to amplify a specific 164-bp genomic fragment from K-ras exon 1. Hybridization probes were designed complementary to specific mutant types in K-ras codon 12; the anchor probe was 3'-labeled with fluorescein, and the sensor probe 5'-labeled with LC-Red dye and 3'-phosphorylated. Two different sensor probes were selected to cover the mutation region: (a) 5'-LC-Red 640-labeled oligonucleotide probe to bind the K-ras GAT (G12D) mutation (i.e., the 12Asp sensor probe), and (b) 5'-LC-Red 705-labeled probe to bind the TGT (G12C) mutation of K-ras gene (12Cys sensor probe). The different dyes labeled on the probes allowed us to perform these two assays in the same run. The competing wild-type PNA oligomer covered codons 10-14. The antisense strand was chosen for the PNA oligomer and the detection probes because of its lower purine content and, therefore, more precise hybridization results (24). The primers, probes, and the PNA oligomer were from TIB MOLBIOL. The sequences of the primers, probes, and the PNA oligomer are listed in Table 1.

For amplification with the 12-Asp sensor probe, we mixed the LightCycler DNA Master Hybridization Mixture (Taq polymerase, PCR buffer, and deoxynucleotide triphosphate mixture; Roche Diagnostics), 5 mM Mg[Cl.sup.2], 0.3 [micro]M anchor probe, 0.15 [micro]M sensor probe, 0.15 [micro]M PNA oligomer, and 0.5 [micro]M each of primers K-ras F and K-ras R with 10 ng of genomic DNA and added water to a final volume of 20 [micro]L/capillary. PCR was performed with the Roche LightCycler System (Roche Diagnostics). The conditions for the 12Cys sensor probe were the same as for the 12Asp sensor probe, except that we used 50 ng of genomic DNA, 1.5 [micro]M PNA oligomer, and 3 mM Mg[Cl.sup.2]. The PCR protocol consisted of 95[degrees]C for 10 min for initial denaturation, 50 cycles of 2 s at 95[degrees]C for denaturation, 10 s at 70[degrees]C for PNA oligomer binding, 7 s at 60[degrees]C for primer annealing and probe binding, and 15 s at 72[degrees]C for extension.

CONTROLS

DNA from the colon cancer cell line SW480, which harbors a homozygous GGT-to-GTT mutation at codon 12 of K-ras, was used as positive control in each run. One negative control (DNA from colon cancer cell line HT29 with wild-type K-ras) and a water negative control (as control for contamination) were processed in parallel with each batch of samples. Mutation analysis for each bile sample was performed at least twice to confirm reproducibility.

DILUTION EXPERIMENTS

We evaluated the sensitivities of the methods for K-ras mutation detection by diluting SW480 cell line DNA, which carries a homozygous G12V mutation, or a bile DNA sample carrying a heterozygous G12C mutation (confirmed by sequencing) in wild-type human bile DNA. The 1:10 mixture contained 1 ng of mutant DNA and 10 ng of wild-type DNA.

MELTING CURVE ANALYSIS

After amplification, melting analysis was performed by holding the denaturation reaction at 95[degrees]C for 20 s and hybridization at 40[degrees]C for 20 s, followed by heating from 40[degrees]C to 85[degrees]C at 0.3[degrees]C/s with continuous monitoring of fluorescence at 640 run (for LC-Red 640 in channel 2) or 705 run (for LC-Red 705 in channel 3). The change of fluorescence was converted to a melting peak ([T.sub.m]) by plotting the negative derivative of the fluorescent signal corresponding to the temperature (-dF/dT) with the software. The K-ras gene mutation was identified by comparing the [T.sub.m] of each patient's result with that of the DNA positive control.

To optimize the PCR condition, we adjusted the [Mg.sup.2+], PNA oligomer, and DNA concentrations. [Mg.sup.2+] titration experiments were done with a patient sample harboring the K-ras codon 12 TGT (G12C) mutant as determined by the clamped probe assay and direct sequencing. The clamped probe assay and melting curve analysis were performed as described above except that the Mg[Cl.sub.2] concentration used was varied from 1 to 7 mM (total of seven concentrations).

DNA SEQUENCING

The DNA from those samples that gave positive results either by RFLP analysis or the clamped probe assay was further analyzed by direct sequencing. The second PCR product, visualized as a 129-bp band on the electrophoresis gel, was purified by use of a QIAquick Gel Extraction Kit (Qiagen), and concentrated (from 250 [micro]L to 15 [micro]L) in a vacuum centrifuge dryer (Hetovac; VR-1). Bidirectional DNA sequencing of PCR products was carried out on an ABI PRISM 377 sequencer (Applied Biosystems) with a Big Dye Terminator Cycle Sequencing Ready Reaction Kit.

STATISTICAL ANALYSIS

All data are expressed as the mean (SD). The statistical analysis was performed with SPSS 8.0 for Windows software (SPSS).

Results

DEMOGRAPHIC DATA FOR PATIENTS

We had bile from 116 patients for analysis of K-ras codon 12 mutations (Table 2). The diagnosis of cholangiocarcinoma (n = 26) or pancreatic cancer (n = 20) was confirmed pathologically in 34 patients (74%). Patients without a pathology diagnosis were diagnosed based on the severe and lethal course of the disease, which accounts for the shorter follow-up period in these patients than for patients with benign biliary obstruction. The patients who were diagnosed with benign biliary stricture included those with chronic pancreatitis (n = 2), pancreatic tuberculosis (n = 1), papillary stenosis (n = 2), and serous adenoma of the pancreas (n = 1). None of the patients with gallstones or benign biliary obstructions developed biliary malignancies during a follow-up period of 15.2 (14.6) months.

ANALYSIS OF MUTANT AND WILD-TYPE K-ras BY CLAMPED PROBE ASSAY

Real-time PCR with the clamped probe assay accurately identified the K-ras mutation from the wild-type genome. In the absence of PNA oligomer, we observed a melting peak at 66.3[degrees]C for the wild type with the 12Cys sensor probe. The addition of PNA oligomer successfully suppressed the amplification of the wild type. For the 12Cys sensor probe, [Mg.sup.2+] titration experiments showed that the reaction with 3 mM Mg[Cl.sub.2] provided the highest melting peak for bile DNA with the K-ras codon 12TGT mutant (Fig. 1 in the Data Supplement that accompanies the online version of this article at http://www.clinchem. org/content/vol50/issue3/). The effects of various amounts of PNA oligomer, [Mg.sup.2+], and DNA template on the melting curves obtained with the 12Cys probe are shown in Fig. 2 in the online Data Supplement. In the presence of 1.5 [micro]M PNA oligomer, 3 MM [Mg.sup.2+], and 50 ng of DNA, the clamped probe assay showed the least wild-type background and best mutant signal and was applied to the rest of the reactions. Table 3 and Figs. 3 and 4 provide the results of testing for K-ras codon 12 mutations. The melting curve analysis showed that the 12Cys sensor probe can detect four kinds of K-ras codon 12 mutations--GAT, GTT, AGT, and TGT mutants--with mean (SD) melting temperatures of 65.1 (0.18), 66.5 (0.29), 67.8 (0.17), and 70.6 (0.22)[degrees]C, respectively (Fig. 1 and Table 3). With the 12Asp sensor probe, we observed a melting peak at 62.5[degrees]C for the wild type in the absence of PNA oligomer. The 12Asp sensor probe can detect only two kinds of point mutation, however: the GTT and GAT mutations with melting temperatures of 61.9 (0.45) and 67.1 (0.40)[degrees]C, respectively (Fig. 2).

RFLP ANALYSIS OF MUTANT AND WILD-TYPE K-ras

Typical RFLP results are shown in Fig. 3. PCR with primers K1A and K1B gave rise to a 157-bp fragment containing two BstNI restriction sites if codon 12 was wild type and one BstNI site if codon 12 contained a mutation in either of its first two bases. Hence, BstNI cut the amplified wild-type fragment twice to yield 29-,114-, and 14-bp fragments, but cut K-ras codon 12 mutant once to generate 143- and 14-bp fragments. When a second PCR was performed with primers KlA and K1C, the mutant K-ras fragment after amplification was 129 bp, which was no longer cut by BstNI, whereas the wild-type fragment was further cleaved by BstNI to a 100-bp fragment. If we counted those with a single band of 129 by or heterozygous bands of 129 and 100 by as mutants, the frequency of K-ras mutations in bile would be 40% (28 of 70) and 59% (27 of 46) in benign and malignant cases, respectively. To avoid possible errors from PCR or incomplete digestion, mutations were counted only in those with a single band of 129 by or a predominant band of 129 by (signal of 129-bp band greater than that of 100-bp band) on the second PCR product after digestion.

COMPARISON OF DIFFERENT METHODS FOR DETECTING K-ras MUTATIONS

The clamped probe assay detected K-ras codon 12 mutants within 1 h, whereas the RFLP analysis took 3 days to complete. Overall, 15 of 116 cases tested positive for a mutation in codon 12 of K-ras with the RFLP method, whereas 16 had mutations with the clamped probe assay using a 12Cys sensor probe and 12 had mutations with the 12Asp sensor probe (Table 4). The positive samples detected by RFLP analysis or clamped probe assay were subjected to direct sequencing. In 17 cases, sequence results showed 15 mutations. In malignant cases, there was one K-ras mutation detected by the clamped probe assay (using a 12Cys or 12Asp probe) but not by RFLP analysis or sequencing, one detected by the clamped probe assay and sequencing but not by RFLP analysis, one detected by the clamped probe assay and RFLP analysis but not by sequencing, and one detected by RFLP analysis and sequencing but not by the clamped probe assay.

We assessed the sensitivities of these methods for detection of K-ras mutations by dilution experiments using various amounts of homozygous G12V mutant SW480 DNA or heterozygous G12C mutant bile DNA in wild-type bile DNA. In RFLP analysis, the mutation was detectable in the 1:100 mixture of SW480 and wild-type DNA and the 1:10 mixture of G12C mutant and wild-type bile DNA (Figs. 3, B and C). In direct sequencing of concentrated PCR products, the mutation was detectable in the 1:20 mixture of SW480 and wild-type DNA and the 1:10 mixture of G12C mutant and wild-type bile DNA. The clamped probe assay detected SW480 K-ras DNA mutations in a 3000-fold excess of wild-type bile DNA when we used the 12Cys sensor probe and 1000-fold when we used the 12Asp sensor probe. However, for detection of G12C mutant bile DNA, the mutation-specific melting peak was detected only down to a 20-fold excess of wild-type bile DNA (Fig. 4)

[FIGURE 1 OMITTED]

CLINICAL PERFORMANCE OF DIFFERENT METHODS FOR THE DIAGNOSIS OF PANCREATICOBILIARY MALIGNANCIES

In bile, K-ras codon 12 mutations were detected in 16 of 46 (35%) patients with malignancy by the clamped probe assay using the 12Cys sensor probe, 12 (26%) by the assay using the 12Asp sensor probe, and 15 (33%) by RFLP analysis. All benign cases were wild type by these methods.

Discussion

Mutations in the ras oncogene are frequent in malignant pancreatic disease (10, 25,26) and variable in cholangiocarcinoma (3, 27-29). K-ras codon 12 mutations have been detected in 80-95% of infiltrating pancreatic ductal carcinoma cases (30) and in 67% of cases with perihilar and 50% of cases with intrahepatic cholangiocarcinoma (29). However, lower frequencies of K-ras gene mutations assessed from bile samples were found. In this study, we developed a one-step real-time PCR and detected K-ras mutations in approximately one-third of patients with a malignant etiology for the biliary stenosis, whereas mutations were not present in any bile from patients with benign obstructions. The mutation frequency in bile was comparable to the frequencies reported in previous studies (3, 4, 8, 31). This low frequency may be explained by the scirrhous nature of cholangiocarcinoma; the extraductal growth of pancreatic cancer, which makes it difficult for the cancer cells to be exfoliated into the bile; and/or the PCR inhibitors present in bile. Nevertheless, the high specificity of K-ras gene analysis in diagnosing biliary malignancies remains valuable for clinical use.

[FIGURE 2 OMITTED]

The ideal method for K-ras gene analysis in clinical practice would be rapid and accurate enough to allow for high-throughput screening. The results of the present study indicate that real-time PCR using fluorescence hybridization probes with a PNA clamping reaction and melting curve analysis may offer a promising method to accurately identify K-ras gene mutations in patients with biliary obstruction. The absence of post-PCR manipulation reduces the risk of carryover contamination and false-positive results. This detection procedure also eliminates the need for the restriction enzyme digestion, electrophoresis, and staining steps required in the RFLP and single-strand conformation polymorphism methods. Because rapid temperature changes are possible in the closed glass capillary, PCR occurs under rapid cycling conditions and the entire process can be completed within 1 h. Together, these advantages make this assay feasible and promising for screening larger numbers of clinical samples.

In this study, we found a high frequency of G-to-A transitions (n = 9) and G-to-T transversions (n = 7) within codon 12, which is in agreement with the literature (3,13,15). Using a mutant-specific sensor probe and melting curve analysis, we were able to identify different K-ras mutations. The different affinities between the mutant-specific sensor probe and K-ras mutations lead to changes in DNA thermal stability, which in turn lead to different melting temperatures. The technique has also been applied successfully in the point mutation of c-kit (22) and the genotyping of hepatitis C virus (32). The present study demonstrates that the 12Cys sensor probe plus melting curve analysis can be used to identify at least four types of K-ras mutations, including the frequently encountered GAT and GTT mutants, with high specificity. This assay therefore possesses another advantage: that of eliminating the need for expensive direct DNA sequencing.

[FIGURE 3 OMITTED]

The positive rate for K-ras mutations in bile from patients with pancreaticobiliary malignancies was 35% (16 of 46) by clamped probe assay with 12Cys sensor probe and 33% (15 of 46) by RFLP analysis. The positive samples were confirmed by sequencing, which showed mutations in 14 of 16 cases identified by the clamped probe assay. Because we concentrated the PCR product ~17-fold before sequencing, the sensitivity of direct sequencing was then comparable to that of the clamped probe assay, indicating the superior sensitivity of the clamped probe assay. Our study also demonstrated that the 12Cys sensor probe detected more kinds of K-ras codon 12 mutations with higher sensitivities than the 12Asp sensor probe. Because most of the K-ras codon 12 mutations in our study were G-to-A transitions (GAT) and G-to-T transversions (GTT), both of which were readily detected by both sensor probes, the negative predictive value was similar regardless of whether the 12Cys or the 12Asp sensor probe was used. The advantage of the 12Cys sensor probe, however, may be demonstrated in other clinical settings when larger numbers of mutants other than GAT and GTT are present.

The PNA oligomer used to suppress the amplification of the wild-type DNA was designed to bind complementary sequences with higher thermal stability than DNA or RNA and cannot be extended by DNA polymerase (18). Use of the PNA oligomer molecule, which allowed sensitive detection of a mutation in a minor fraction of tumor cells in bile, was therefore key to our method. Our results showed that the addition of 1.5 [micro]M PNA oligomer completely suppressed the wild-type melting signal in 50 ng of bile DNA and allowed detection of the mutation in a 3000-fold excess of wild-type bile DNA. The ratio of PNA oligomer and target DNA we used was different from that used by Sotlar et al. (22); they used 0.75 [micro]M PNA oligomer in 100 ng of template DNA to detect c-kit mutations with a detection limit of 1:2000 (22). This may be attributable to the different types of samples and target genes used in their study and the present study. Furthermore, the specific melting peak for wild type in our study was similar to that for the G12V mutation; therefore, a high PNA oligomer concentration is needed to completely suppress the amplification of wild-type DNA and thus to prevent false positives. However, increases in the PNA oligomer concentration may lower the amplification of the mutant alleles, reducing the sensitivity of the method. Thus, the ratio of PNA oligomer to template DNA is critical for the detection of mutations with good specificity and sensitivity. When Sun et al. (21) used PNA oligomer and matrix-assisted laser-desorption/ionization time-of-light mass spectrometry for enrichment of K-ras and p53 mutants in the presence of excess amounts of wild-type DNA, the detection limit was reported to be as few as 3 mutant alleles in the presence of 10 000-fold excess of wild-type alleles. These results indicate the potential of this technique in high-throughput screening applications.

[FIGURE 4 OMITTED]

The clamped probe assay, however, had a diagnostic sensitivity similar to that of RFLP analysis. It could only detect the mutation in a 1:20 mixture of heterozygous mutant bile DNA and wild-type bile DNA. This may be attributable to the presence of PCR inhibitors in bile samples. Iron-containing proteins and their breakdown products, such as bilirubin, and bile salts have been identified as major inhibitors in PCR of blood samples, including real-time DNA amplification with the LightCycler Instrument (33, 34). The underlying mechanisms may involve the inactivation of thermostable DNA polymerase and/or degradation of the nucleic acids. Because bile contains higher concentrations of bile salts and bilirubin than blood samples, the different extents of inhibitory effects of these substances in RFLP analysis and the clamped probe assay may explain the different detection limits for the SW480 cell line and mutant bile DNA. Although bovine serum albumin was reported to be the most efficient amplification facilitator (34), we found no improvement in the sensitivity with the addition of 4 g/L bovine serum albumin in the clamped probe assay. Further studies are needed to determine ways to minimize the inhibitory effects of bile components in PCR and thus improve the detection sensitivity of the clamped probe assay.

In conclusion, we present a practical method for rapid analysis of K-ras mutations in bile. Because K-ras gene mutations are frequently detected in other gastrointestinal malignancies, such as colon cancer, this method may be promising for the analysis of other body fluids (such as stool) as a mass-screening tool for gastrointestinal cancers.

We thank Hsiu-Chen Chiu and Ping-Hong Chen for excellent technical assistance. This work was supported by National Science Council Grants NSC90-2320-B006056, NSC91-2323-B006-011, and NSC92-2314-B006-044.

References

(1.) Bishop JM. Molecular themes in oncogenesis. Cell 1991;64:235-48.

(2.) Tahey M, McCormick F. A cytoplasmic protein stimulates normal N-ras p21 GTPase, but does not affect oncogenic mutants. Science 1987;238:542-5.

(3.) Muller P, Ostwald C, Puschel K, Brinkmann B, Plath F, Kroger J, et al. Low frequency of p53 and ras mutations in bile of patients with hepato-biliary disease: a prospective study in more than 100 patients. Eur J Clin Invest 2001;31:240-7.

(4.) Saurin JC, Joly-Pharaboz MO, Pernas P, Henry L, Ponchon T, Madjar JJ. Detection of K-ras point mutations in bile specimens for the differential diagnosis of malignant and benign biliary strictures. Gut 2000;47:357-61.

(5.) Lee JG, Leung JW, Cotton PB, Layfield U, Mannon PJ. Diagnostic ultility of K-ras mutational analysis on bile obtained by endoscopic retrograde cholangiopancreatography. Gastrointest Endosc 1995; 42:317-20.

(6.) Uehara H, Nakaizumi A, Tatsuta M, Baba M, Takenaka A, Uedo N, et al. Diagnosis of pancreatic cancer by detecting telomerase activity in pancreatic juice: comparison with K-ras mutations. Am J Gastroenterol 1999;94:2513-8.

(7.) Berthelemy P, Bouisson M, Escourrou J, Vaysse N, Rumeau JL, Pradayrol L. Identification of K-ras mutations in pancreatic juice in the early diagnosis of pancreatic cancer. Ann Intern Med 1995; 123:188-91.

(8.) Iguchi H, Sugano K, Fukayama N, Ohkura H, Sadamoto K, Ohkoshi K, et al. Analysis of Ki-ras codon 12 mutations in the duodenal juice of patients with pancreatic cancer. Gastroenterology 1996; 110:221-6.

(9.) Caldas C, Hahn SA, Hruban RH, Redston MS, Yeo CJ, Kern SE. Detection of K-ras mutations in the stool of patients with pancreatic adenocarcinoma and pancreatic ductal hyperplasia. Cancer Res 1994;54:3568-73.

(10.) Hruban RH, van Mansfeld ADM, Offenhaus GJA, van Weering DH, Allison DC, Goodman SN, et al. K-ras oncogene activation in adenocarcinoma of the human pancreas: a study of 82 carcinomas using a combination of mutant enriched polymerase chain reaction analysis and allele specific oligonucleotide hybridization. Am J Pathol 1993;143:545-54.

(11.) Momoi H, Itoh T, Nozaki Y, Arima Y, Okabe H, Satoh S, et al. Microsatellite instability and alternative genetic pathway in intrahepatic cholangiocarcinoma. J Hepatol 2001;35:235-44.

(12.) Hidaka E, Yanagisawa A, Seki M, Takano K, Setoguchi T, Kato Y. High frequency of K-ras mutations in biliary duct carcinomas of cases with a long common channel in the papilla of vater. Cancer Res 2000;60:522-4.

(13.) Kubicka S, Kuhnel F, Flemming P, Hain B, Kezmic N, Rudolph KL, et al. K-ras mutations in the bile of patients with primary sclerosing cholangitis. Gut 2001;48:403-8.

(14.) Sturm PD, Rauws EA, Hruban RH, Caspers E, Ramsorekh TB, Huibregtse K, et al. Clinical value of K-ras codon 12 analysis and endobiliary brush cytology for the diagnosis of malignant extrahepatic bile duct stenosis. Clin Cancer Res 1999;5:629-35.

(15.) Boberg KM, Schrumpf E, Bergquist A, Broome U, Pares A, Remotti H, et al. Cholangiocarcinoma in primary sclerosing cholangitis: K-ras mutations and Tp53 dysfunction are implicated in the neoplastic development. J Hepatol 2000;32:374-80.

(16.) Nakao M, Janssen JWG, Seriu T, Bartram CR. Rapid and reliable detection of N-ras mutations in acute lymphoblastic leukemia by melting curve analysis using LightCycler technology. Leukemia 2000;14:312-5.

(17.) Fox CA, Parkes HC. Emerging homogeneous DNA-based technologies in the clinical laboratories. Clin Chem 2001;47:990-1000.

(18.) Orum H, Nielsen PE, Egholm M, Berg RH, Burchardt O, Stanley C. Single base pair mutation analysis by PNA directed PCR-clamping. Nucleic Acids Res 1993;21:5332-6.

(19.) Thiede C, Bayerdorffer E, Blasczyk R, Wittig B, NeubauerA. Simple and sensitive detection of mutations in the ras proto-oncogenes using PNA-mediated PCR clamping. Nucleic Acids Res 1996;24: 983-4.

(20.) Behn M, Thiede, Neubauer A, Pankow W, Schuermann M. Facilitated detection of oncogene mutations from exfoliated tissue material by a PNA-mediated "enriched PCR" protocol. J Pathol 2000;190:69-75.

(21.) Sun X, Jung K, Wu L, Sidransky D, Guo B. Detection of tumor mutations in the presence of the excess amounts of normal DNA. Nat Biotechnol 2002;20:186-9.

(22.) Sotlar K, Escribano L, Landt 0, Mohrle S, Lass U, Horny HP, et al. One-step detection of c-kit point mutations using peptide nucleic acid-mediated polymerase chain reaction clamping and hybridization probes. Am J Pathol 2003;162:737-46.

(23.) Su WC, Shiesh SC, Liu HS, Chen CY, Chow NH, Lin XZ. Expression of oncogene products HER2/New and Ras and fibrosis-related growth factors bFGF, TGF-R, and PDGF in bile from biliary malignancies and inflammatory disorders. Dig Dis Sci 2001;46:1387-92.

(24.) Li Y, Zon G, Wilson WD. NMR and molecular modeling evidence for a G. A. mismatch base pair in a purine-rich DNA duplex. Proc Natl Acad Sci U S A 1991;88:26-30.

(25.) Tada M, Omata M, Ohto M. Clinical application of ras gene mutation for diagnosis of pancreatic adenocarcinoma. Gastroenterology 1991;100:233-8.

(26.) Scarpa A, Capelli P, Villanueva A, Zamboni G, Lluis F, Accolla R, et al. Pancreatic cancer in Europe: Ki-ras mutation pattern shows geographical differences. Int J Cancer 1994;57:167-71.

(27.) Tada M, Omata M, Ohto M. High incidence of ras gene mutation in intrahepatic cholangiocarcinoma. Cancer 1992;69:1115-8.

(28.) Watanabe M, Asaka M, Tanaka J, Kurosawa M, Kasai M, Miyazaki T. Point mutation of K-ras gene codon 12 in biliary tract tumors. Gastroenterology 1994;107:1147-53.

(29.) Ohashi K, Nakajima Y, Kanehiro H, Tsutsumi M, Taki J, Aomatsu Y, et al. Ki-ras mutations and p53 protein expression in intrahepatic cholangiocarcinomas: relation to gross tumor morphology. Gastroenterology 1995;109:1612-7.

(30.) Inoue S, Tezel E, Nakao A. Molecular diagnosis of pancreatic cancer. Hepatogastroenterology 2001;48:933-8.

(31.) Tannapfel A, Benicke M, Katalinic A, Uhlmann D, Kockerling F, Hauss J, et al. Frequency of p161NK4A alterations and K-ras mutations in intrahepatic cholangiocarcinoma of the liver. Gut 2000;47:721-7.

(32.) Bullock GC, Bruns DE, Haverstick DM. Hepatitis C genotype determination by melting curve analysis with a single set of fluorescence resonance energy transfer probes. Clin Chem 2002; 48:2147-54.

(33.) Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K. Identification of heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J Forensic Sci 1994;39:362-72.

(34.) Abu AI-Soud W, Radstrom P. Purification of characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 2001; 39:485-93.

CHIUNG-YU CHEN, [1] SHU-CHU SHIESH, [2] * and SHEU-JEN WU [3]

Departments of [1] Internal Medicine and [2] Medical Technology, College of Medicine, National Cheng Kung University, Tainan, Taiwan.

[3] Clinical Biochemistry Research Laboratory, Veterans General Hospital, Taipei, Taiwan.

* Address correspondence to this author at: Department of Medical Technology, National Cheng Kung University, 1 University Road, Tainan 701, Taiwan. Fax 886-6-236-3956; e-mail hsieh@mail.ncku.edu.tw.

Received July 16, 2003; accepted December 16, 2003.

Previously published online at DOI: 10.1373/clinchem.2003.024505
Table 1. DNA sequences of primers, PNA oligomer, and probe for
detecting K-ras mutations.

Name DNA (5'-3') or PNA (N[H.sub.2]-CON[H.sub.2])
 sequence (a)

K-ras F (c) AGGCCTGCTGAAAATGACTG
K-ras R GGTCCTGCACCAGTAATATGCA
Anchor CGTCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACT-Flu
12Asp LC-Red 640-CCTACGCCA#T#*C#AGCTCCA-P
12Cys LC-Red 705-TTGCCTACGCCA#C#A#*AGCTCCAA-P
PNA CCTACGCCA#C#C#AGCTCC

Name Position, (b) nt

K-ras F (c) 83-102
K-ras R 246-225
Anchor 186-144
12Asp 139-122
12Cys 142-121
PNA 139-123

(a) LC-Red 640 and LC-Red 705 are fluorophores. The 3' end of the
mutation probe was phosphorylated to prevent probe elongation by Taq
polymerase during PCR. Bold, codon 12; underlined, mutated base.

(b) The base numbering is according to GenBank accession no. L00045.

(c) F, forward; R, reverse; Flu, fluorescein; LC-Red 640,
LightCycler-Red 640; P, phosphorylated; LC-Red 705, LightCycler-Red
705.

Note: Bold, codon 12 are indicated with #; underlined, mutated base
are indicated with *.

Table 2. Demographic data for patients.

 Mean (SD) Mean (SD)
Group M:F age, years follow-up, months

Pancreatic cancer 12:08 64.1 (13.4) 8.9 (13.3)
Cholangiocarcinoma 13:13 67.0 (9.5) 6.2 (7.2)
Hepatolithiasis 7:10 55.8 (15.6) 18.4 (17.6) (a,b)
Choledocholithasis 29:18 67.3 (15.1) 13.3 (13.1) (b)
Benign biliary
 stricture 4:02 57.8 (17.5) 20.6 (15.4) (b)

(a) P <0.05 between this group and pancreatic cancer group.

(b) P <0.05 between this group and the cholangiocarcinoma group by
one-way ANOVA.

Table 3. Melting temperatures of mutants by real-time PCR with PNA and
codon 12 mutation-specific sensor probes.

 Mean (SD) [T.sub.m],[degrees]C

Mutant No. of 12Cys probe 12Asp probe
 cases

G12D (GAT) 8 65.14 (0.18) 67.1 (0.40)
G12C (TGT) 2 70.65 (0.22) -- (a)
G12S (AGT) 1 67.8 (0.17) (b) -- (a)
G12V (GTT) 5 66.5 (0.29) 61.9 (0.45) (c)

(a) No melting peaks detected.

(b) Obtained by repeating the measurement in five different runs.

(c) One case was not detected by 12Asp probe.

Table 4. Frequency of codon 12 K-ras mutations in bile
from patients with biliary obstructions detected by RFLP
analysis and clamped probe assay.

 Clamped probe
 assay

Group Patients, n RFLP 12Asp 12Cys

Pancreatic cancer 20 6 4 6
Cholangiocarcinoma 26 9 8 10
Hepatolithiasis 17 0 0 0
Choledocholithasis 47 0 0 0
Benign biliary stricture 6 0 0 0
Total 116 15 12 16
COPYRIGHT 2004 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Chen, Chiung-Yu; Shiesh, Shu-Chu; Wu, Sheu-Jen
Publication:Clinical Chemistry
Article Type:Report
Date:Mar 1, 2004
Words:5687
Previous Article:Urgent clinical need for accurate and precise bilirubin measurements in the United States to prevent kernicterus.
Next Article:Differential gene expression of Eph receptors and ephrins in benign human tissues and cancers.
Topics:

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters