Printer Friendly

Rapid detection of Clostridium perfringens in seafood.

INTRODUCTION

C. perfringens being responsible for food poisoning; it also causes a number of human diseases ranging from necrotic enteritis to wound infection and life threatening gas gangrene. Such pathogenicity is associated with the lethal extracellular toxin which has defined as enzyme activity as collagenas, hyalauronidase and deoxyribonuclease [1].

PCR-based techniques are used increasingly in food-microbiology research as they are well developed and when applied as culture confirmation tests, they are reliable, fast and sensitive. PCR methods offer a sensitive and specific detection of C. perfringens and its enterotoxins in food samples [2,3].Many authors have proposed the use of PCR for the detection of food-borne pathogens to replace the time consuming culture based classical techniques [4, 5].Both of which are time consuming and laborious. However, products of PCR can also be detected by using a DNA binding dye, such as SYBR Green Real-time PCR assays can be automated and are sensitive and rapid. They can also quantify PCR products with greater reproducibility while eliminating the need for post-PCR processing, thus preventing carryover contamination [6].This study was aimed to rapid diagnosis of C. perfringens from seafood samples using of multiplex PCR for typing C. perfringens through detection of their toxins gens and using uniplex PCR and real time SYBR Green to directly detect cpegene in DNA extracted from seafood samples and comparison between them according results.

MATERIAL AND METHODS

Sampling:

One hundred and fifty seafood samples including Finfish (Salmon and Tilapia), Crustaceans (Shrimp and Crab) and Molluscs (Calm), 30 each, were collected randomly from supermarkets in El-dakahlya Governorates, Egypt. The collected samples were prepared according to previously published protocol [7, 8] under aseptic condition.

Isolation and identification of C. perfringens:

Each sample was inoculated onto a tube of sterile freshly prepared cooked meat medium (CMM) then the tube was incubated anaerobically at 37[degrees]C for 24-48 hours after that a loopful from the previously incubated tube was streaked onto the surface of 10% sheep blood agar with neomycin sulphate (200 [micro]g/ml) and the plate was incubated anaerobically at 37[degrees]C for 24-48 hrs. [9].Bacterial colonies were purified individually based on the size, shape, color, hemolysis pattern. The suspected colonies of C. perfringens were picked up and examined for their morphological and culture characters microscopical examination of stained films with Gram's stain and biochemical tests such as gelatinase, fermentation of sugars, gelatin liquefaction, litmus milk, catalase, indole tests were identified [10].

C. perfringens enumeration [9]:

Appropriate 1 ml of dilution was spread over the surface of duplicate TSC agar plates. Plates were overlaid with TSC agar and incubated at 37[degrees]C for 24 hours in an anaerobic jar. Black CFU was counted as presumptive C. perfringens/g of sample. Black colony confirmed by lactose sulphid.

Nagler's Test by Half Antitoxin Plate [11]:

Detection of lecithinase activity of C. perfringens alpha toxin on lecithin of an enriched egg yolk agar medium.

Typing of C. perfringens toxins by dermonecrotic test in albino guinea pigs:

It was applied by preparation of the toxins and their treatment [11], application of dermonecrotic test I/D of an albino guinea pig [12, 13] and interpretation of the results according to colour degree of the dermonecrotic reaction and its neutralization [14].

Toxin antitoxin neutralization test:

It was performed by injection of the toxin antitoxin mixture intraperitoneally in mice or intradermally in an albino guinea pig [15].

Molecular Assay for identification of C. perfringens:

Extraction of DNA according to QIAamp DNA mini kit instructions using 200 [micro]l of seafood sample for using in Conventional and Syber green real time PCR.

Conventional PCR:

Preparation of PCR Master Mix for preparation of four Clostridium toxins and preparation of uniplex PCR Master Mix for cpe gene and Cycling conditions of the primers during cPCR temperature and time conditions of the primers during PCR according to Emerald Amp GT PCR mastermix (Takara) Code No. RR310A kit: multiplex and uniplex PCR-based protocol is described with 5 primer sets to simultaneously identify the toxins together with all primers used in the study,

The oligonucleotide primers used in this study and their amplicon sizes are listed in Table 1 (16, 17). Uniplex PCR was performed in 25 [micro]l of reaction volume consisting of 12.5 [micro]l of Emerald Amp GT PCR mastermix (2X premix) (Takara) Code No. RR310A kit, 1 [micro]l of 20 pmole of each primer (Sigma, USA), 6 [micro]l of template DNA and water nuclease free up to 25 [micro]l. PCR cycling program was performed in PTC-100 TM programmable thermal cycler (Peltier-Effect cycling, MJ, Research, INC., UK) for detection of Alpha, Beta, Iota and Epsilon genes as following: initial denaturing step at 95[degrees]C for 10 min; followed by 35 cycles of 94[degrees]C for 5 min, 94 for 1 min, 55[degrees]C for 1 min, and 72[degrees]C for 1 min; and a final extension step at 72[degrees]C for 10 min [16] and for detection of cpe gene as following: initial denaturing step at 95[degrees]C for 10 min; followed by 35 cycles of 94[degrees]C for 30 sec., 94 for 30 sec, 55[degrees]C for 30 sec, and 72[degrees]C for 30 sec; and a final extension step at 72[degrees]C for 7 min [17]. Aliquot of each amplicon, along with a 100-600 bp molecular weight DNA ladder (QiAgEN, USA) were subsequently separated by electrophoresis on 1.5% molecular biology grade agarose gel (Sigma, USA) stained with 0.5 [micro]g/ml ethidium bromide (Sigma, USA) on a mini slab horizontal electrophoresis unit (Bio-Rad, USA) at 100 V for 30 min. DNA bands were visualized under UV transilluminator (Spectroline, USA) and photographed [18].

Real time PCR Amplification and cycling protocol (MX3005P QPCR system) it was applied in the following steps:

QPCR reaction setup:

DNA samples were amplified in a total of 25 [micro]l of the following reaction mixture: 12.5 [micro]l QuantiTect SYPR Green (2X), 0.5 [micro]l of each primer (50 pmol), 7 [micro]l template DNA and 4.5 [micro]l water, nuclease-free. The samples were transferred to each well of a PCR plate.

Running of the QPCR:

It was applied in 40 cycles according to the following program: enzyme activation at 94[degrees]C for 5 minutes, denaturation at 94[degrees]C for 30 seconds then annealing 50[degrees]C for 30 seconds, extension at 72[degrees]C for 30 seconds. PCR results were given as the increase in the fluorescence signal of the reporter dye detected and visualized by The MX3005P QPCR system. Ct values (threshold cycle) represent the PCR cycle in which an increase in fluorescence, over a defined threshold, first occurred, for each amplification plot.

Analysis of the results using the standard curve method [19]:

The standard curve method is based on using a DNA sample of known concentration to construct a standard curve. Once the standard curve has been generated, it can then be used as a reference standard for the extrapolation of quantitative information regarding the unknown concentration.

RESULTS AND DISCUSSION

In this study C. perfringens was detected in seafood samples 20 (13%) out of 150 collected samples. The prevalence of C. perfringens in Tilapia and (Shrimp, Crab and calm) was 10% and 18% (36.6, 13.3 and 6.6)%, respectively. 100% of Salmon fish samples were free from C. perfringens (Table 2).

Salmon fish samples were free from C. perfringens [20, 21, 22]and C. perfringens was highly detected with a percentage of 84% [23].C. perfringens was detected from tilapia with a percentage of 1%, 4%, 6%, 16%, 16.92%, 18.35%, 18.36%, 27.24%, 84%, 30% and 62.5% [20, 24, 25, 26, 27, 28, 29, 30, 23, 31, 21]C. perfringens was isolated from seafood (shrimp, crab and clam) with percentage of 17%, 9%, 7%, 6% and 4.7%, 0% [31, 24, 22, 26, 32, 20]

The obtained results revealed that the average C. perfringens counts of seafood samples (tilapia, shrimp, crab and clam) were 6.5 x [10.sup.2], 1.7 x [10.sup.3], 1.3 x [10.sup.3] and 2.2 x [10.sup.3] CFU/g (Table 2). The average count value of C. perfringens results were 1.82 - 4.26 x 10 and 3.5 x 10 CFU/g obtained by [23, 27].

Seafood might have come from contaminated water bodies, which in turn get infected due to excretion of the organism in feces of various carrier animals or man or the water used for washing seafood might be contaminated [25].

Poor hygiene from fishing to marketing is main purpose of prevalence of and multiplication of C. perfringens and poor conditions of storage such as the environments attracted flies and insects and prolonged preservation facilitate the reproduction of C. perfringens spores which might also have contributed to the higher bacterial counts and hence poor quality of fish are presented to costumers [33].

Regarding to conventional methods for identification of C. perfringens recovered from seafood the present results revealed that C. perfringens was Gram positive short plumb rarely sporulated and non-motile bacilli. It was apparent that sheep blood agar with neomycin sulphate (200 [micro]g/ml) was a perfect medium for isolation of C. perfringens rather than other Clostridiumspp and gave double zones of haemolysis. All the recovered strains in this work were fermentative to different sugars as glucose, maltose, lactose, sucrose and mannitol with production of acid and gases, gelatin liquefiers, litmus milk positive, catalase, oxidase and indole tests negative [34,35, 36].

Nagler's test represented the action of C. perfringens alpha toxin (lecithinase) on lecithin of egg yolk onto enriched egg yolk agar medium which appeared as pearly opalescence zone surround the colonies while this reaction was inhibited by C. perfringens alpha toxin antiserum [15].

Biotyping of C. perfringens isolates was applied by dermonecrotic reaction in albino gunia pigs [14]. AllC. perfringens isolates recovered from seafood (Tilapia, Shrimp, Crab and Calm) were identified into toxigenic strains type A100% [28, 30,31,37].

Rapid identification of pathogens may prevent foodborne diseases through better control of foods. Pathogenic bacteria that were previously isolated and identified by conventional testing procedures can be easily detected quickly and reliably by rapid testing methodologies, including molecular biological assays. However, DNA based techniques can be adversely affected by interfering substances in the sample or lack the sensitivity needed to detect bacteria in very low levels [37]. Therefore, in this study, we first developed sensitive and specific representative molecular assays. However, even though molecular methods are often touted as being highly sensitive (detection limit of 1 to 10 gene targets), they are generally not of value if employed directly for the detection of organisms in food or environmental samples [38].

In this study, Conventional PCR for Detection of the presence of C. perfringens toxins in seafood samples by using Multiplex PCR results. All the examined seafood samples were identified as C. perfringens type "A" (alphatoxin) and gavecharacteristic bands at 402 bp.Figures (1,2).

[FIGURES 1-2 OMITTED]

Multiplex PCR was used as a sensitive technique and time saver than traditional methods to detect C. perfringens in seafood. All seafood samples were examined were identified as C. perfringens type "A" (alpha toxin) [30, 31].

The genotyping by PCR suggested that alpha toxin is linked to C. perfringens type A in fish and seafood. Type A was the most predominant one which was responsible for potential food poisoning and gastroenteritis. [28]

UniplexPCR results showed that 3 out of 20 samples (15%) positive for C. perfringens enterotoxin gene and gave characteristic bands at 233 bp [31] Table (3) and Figures(3, 4).

Real Time PCR technique based SYBR Green dye for detection of cpewere show 4/20seafood samples (20%) gave a positive result by amplification of cpe gene Table (3) and Figures (5, 6) [28].

SYBR Green real time PCR, with its combination of speed, sensitivity, specificity qualitative and quantitative technique detection of C. perfringens strains (1-10) gene targets in a wide range of food homogenate samples harbouring the enterotoxin gene cluster in seafood [37, 38, 39]positive results was showed as curve.

The presence of cpe gene in C. perfringens type A is very uncommon, and <5% of global C. perfringens type A isolates are cpe positive [28].

Isolates carrying the C. perfringens enterotoxin gene (cpe) are the most important food borne pathogens. Previous surveys indicated that cpe positive C. perfringens isolates are present in only 5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. [38]

[FIGURES 3-4 OMITTED]

[FIGURE 5 OMITTED]

[FIGURE 6 OMITTED]

Conclusion:

This work revealed the presence of C. perfringensin seafood. Seafooda probable health risk for consumers of raw seafood. Improvement of the effective sanitary conditions inhandling and processing operations from fishing to marketing is needed to minimize therisk of infections associated with consumption of these products. SYBR Green real time PCR more sensitive, qualitative and quantitative than Conventional PCR to detect food microorganism and their toxins directly from seafood for rapidly diagnosis of food poisoning outbreak.

REFERENCES

[1] Ammar, A.M., S. Basma, A. Ahlam and S.A. Walaa, 2011. Study on the effect of some spices and organic salts on Clostridium perfringens during cooling of raw and cooked ground beef. Zagazig Veterinary Journal, 39(5): 138-151.

[2] Anbudhasan., P., A. Uma and G. Rebecca, 2012. Assessment of bacteriological quality in selected commercially important processed seafood (PCR). International Journal of Food, Agriculture and Veterinary Sciences, 2(3): 20-25.

[3] EI Jakee, J., S.A. Marouf, S.A. Nagwa, H. Eman, I. Sherein, A.A. Samy and E.E. Walaa, 2013. Rapid Method for Detection of Staphylococcus aureus Enterotoxins in Food. Global Vet., 11(3): 335-341.

[4] Gravet, A., M. Rondeau, C.H.F. Monteil, H. Grunenberger, Monteil, J.M. Scheftel and G. Prevost, 1999. Predominant Staphylococcus aureus isolated from antibiotic-associated diarrhea is clinically relevant and produces enterotoxin Aand the bicomponent toxin LukE-LukD. J. Clin. Microbiol., 37: 4012-4019.

[5] Miethke, T.C., H.K. Wahl, B. Echtenacher, P.H. Krammer and H. Wagner, 1992. T cell-mediated lethal shock triggered in mice by the superantigen staphylococcal enterotoxin B: critical role of tumor necrosis factor. J. Exp. Med., 175: 91-98.

[6] Jothikumard, N. and M.W. Griffiths, 2002. Rapid detection of E.coli O157:H7 with multiplex real-time PCR assays. Appl. Environ. Microbiol., 68: 3169-3171.

[7] ISO/DIS 6887-3:2013:Microbiology of food and animal feeding stuffs Preparation of test samples, initial suspension and decimal dilutions for microbiological examination--Part 3: Specific rules for the preparation of fish and fishery products. International standard, ISO 6887-3, 2E, 1-11.

[8] Wallace, H.A. and S.H. Thomas, 2003. Bacteriological Analytical Manual 8th Edition, Revision A, Food Sampling and Preparation of Sample Homogenate, Chapter 1.

[9] Rhodehamel, E.J. and M.H. Stanley, 2001. Bacteriological Analytical Manual 8th Edition, Revision A, Clostridium perfringens, Chapter 16.

[10] Koneman, E.W., S.D. Allen, V.R. Dowell and H.W. Summers, 1992. Colour atlas and text book of diagnostic microbiology. 4th Ed., Philadelphia, J.B. LippinCott. Co., New York, London.

[11] Bullen, J.J., 1952. C. perfringens in the alimentary tract of normal sheep. J. Path. Bact., 64: 201-210.

[12] Oakley, C.L. and G.H. Warrack, 1953. Routine typing of C. welchii. J. Hyg. Gamb., 51: 102-107.

[13] Quinn, P.J., B.K. Markey, M.E Carter, W.J. Donnelly, F.C. Leonard and D. Maguire, 2002. Veterinary microbiology and microbial disease. 2nd Ed., Blackwell Sci., pp: 84-96.

[14] Stern, M. and I. Batty, 1975. Pathogenic Clostridia. Butter Worth, London, Boston.

[15] Smith, L.D.S. and Holdeman, 1968. The pathoigenic anaerobic bacteria. 1st Ed.; Charles Thomas Publisher, USA., pp: 201-255.

[16] Yoo, H.s., S.U. Lee, K.Y. Park and Y.H. Park, 1997. Molecular Typing and Epidemiological Survey of Prevalence of Clostridium perfringens Types by Multiplex PCR. J. Clin. Microbiol., 35(1): 228-232.

[17] Heikinheimo, A. and H, Korkeala, 2005. Multiplex PCR assay for toxino typing Clostridium perfringens isolates obtained from Finnish broiler chickens. Lett. Appl. Microbiol., 40: 407-411.

[18] Sambrook, J., E.F. Fritscgh and Mentiates, 1989. Molecular coloning.A laboratory manual. Cold spring Harbor Laboratory press, New York.

[19] Adams, P.S., 2007. Data analysis and reporting, In, Dorak, M. T. (Ed.): Real-time PCR, Taylor & Francis Group, New York: pp: 39-62.

[20] Papadopoulou, C., E. Economou, G. Zakas, C. Salamoura, C. Dontorou and J. Apostolou, 2007. Microbiological and pathogenic contaminants of seafood in Greece. J. Food Quality, 30(1): 28-42.

[21] ElShorbagy, M.M., M.R. Lamyaaand, H. Mona, 2012. Prevalence of Clostridium perfringens Alpha toxin in processed and unprocessed fish.Int. J. of Microbiol. Res., 3(3): 195-199.

[22] Rokibul, M.D.H., A. Mrityunjoy, D. Eshita, K.D. Kamal, A. Tasnia, A.A. Muhammad, K.F. Kazi and N. Rashed, 2013. Microbiological study of sea fish samples collected from local markets in Dhaka city. Int. Food Res. J. 20(3): 1491-1495.

[23] Herrera, F.C., J.A. Santos, A. Otero and M.L.Garc, 2006. Occurrence of foodborne pathogenic bacteria in retail prepackaged portions of marine fish in Spain. J. Appl. Microbiol., 100: 527-536.

[24] Martha, I., A .Tracy, E.M. Barbara and L.S. David, 2010. American Society for Microbiology. All Rights Reserved. Epidemiology of Seafood-Associated Infections in the United States. Clin. Microbiol. reviews 23(2): 399-411.

[25] Endale, B.G., A.H. Razzbuddin, B. Probodh and B. Acinto, 2013. Presence of enterotoxigenic C. perfringens in foods of animal origin, Guwahati, India J. Environ.Occup. Sci., 2(1): 45-50.

[26] Dalton, C.B.,J. Gregory, M.D. Kirk, R.J. Stafford, R. Givney, E. Kraa and D. Gould, 2004. Foodborne disease outbreaks in Australia, 1995 to 2000. Commun. Dis. Intell. Q Rep., 28(2): 211-224.

[27] Gamal, E.D. and M.R. El-Shamery, 2010.Studies on contamination and quality of fresh fish meats during storage Egypt.Acad. J. biolog. Sci., 2(2): 65-74.

[28] Arunava, D. and J. Adarsh, 2012a. Clostridium Perfringens type A from fresh water fishes. Int. J. Adv. Biotech. Res., 3(3): 680-687.

[29] Cai, Y., J. Gao, X. Wang, T. Chai, X. Zhang, H. Duan, S. Jiang, B.A. Zucker and G. Schlenker, 2008. Clostridium perfringens toxin types from freshwater fishes in one water reservoir of Shandong Province of China, determined by PCR. DtschTierarzt Wochenschr. 115(8): 292-297.

[30] Arunava, D. and J. Adarsh, 2012b. Genotyping of C. perfringens from fresh water fish and fish pickles. J. Microbiol., Biotech. Food Sci., 2(1): 162-174.

[31] Qiyi, W. and A.M. Bruce, 2004. Detection of Enterotoxigenic Clostridium perfringens Type A Isolates in American Retail Foods. Appl. Environ. Microbiol., 70(5): 2685-2691.

[32] Rahmati, T. and R. Labbe, 2008. Levels and Toxigenicity of Bacillus cereus and Clostridium perfringens from Retail Seafood, J. Food Protect., 71(6): 1178-1185.

[33] Maysoon, S.A., 2014. Isolation of bacteria from fish, Int. J. Adv. Res., 2(3): 274-279.

[34] Peter, H.A., S. Nicholas, S. Elisabeth and G. John, 1986. Bergey's Manual Systemic Bacteriology. 2, Williams and Wilkins.

[35] Vaikosen, E.S. and W. Muller, 2001. Evaluating biochemical tests for isolation and identification of Clostridium perfringens in faecal samples of small ruminants in Nigeria. Bull. Anim. Health and Prod. in Africa, 49 (4): 244-248.

[36] Liang, L., H. Li, E. Xian and B. Li, 2004. Isolation and identification of Clostridium perfringens from bovine. Chinese J. of Vet.Sci. Technol., 34(5): 58-60.

[37] Ismail, H.T. and O. Haydar, 2015. Evaluation of a Real-Time PCR Multiplex Assay For Detecting Foodborne Pathogenic Bacteria. Inter. J. Food Engin. Res., 1(1):7-16.

[38] Ikuko, K., M. Kazuaki, M. Kanako, Y. Natsuko, U. Hirotoshi, A. Shigeru and A.M. Bruce, 2011. Detection of Enterotoxigenic Clostridiumperfringensin Meat Samples by Using Molecular Methods. American Society for Microbiol. Appl. Environ. microbial., 21(77): 7526-7532.

[39] Xihong, Z., W.L. Chii, W. Jun and H.O. Deog, 2014. Advances in Rapid Detection Methods for Foodborne Pathogens, J. Microbiol. Biotechnol., 24(3): 297-312.

(1) Nashwa A. Ezzeldeen, (2) Ahmed M. Ammar, (3) Basma shalaby, (1) El. Haririr, M and (4) Walaa S. Omar

(1) Department of microbiology, Faculty of Veterinary Medicine, Cairo University, Cairo, Egypt; Department of Biology, Faculty of science, Taif University, KSA.

(2) Department of microbiology, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt.

(3) Bacteriology Department Animal Health Research Institute, Dokki, Giza, Egypt.

(4) Department of abattoir and meat inspection, Veterinary Directorate, EL Dakahlya, Egypt.

Address For Correspondence:

Walaa S. Omar, Department of abattoir and meat inspection, Veterinary Directorate, EL-dakahlya, Egypt.

E-mail: salahomar48@gmail.com

Received 12 February 2016; Accepted 28 April 2016; Available online 15 May 2016
Table 1: Oligonucleotide primers sequences Source: Midland Certified
Reagent Company oilgos (USA).

M.O.             Toxin         Primer                     Amplified
                                                          product(bp)

C. perfringens   Alpha         GTTGATAGCGCAGGACATGTTAAG   402
                               CATGTAGTCATCTGTTCCAGCATC

                 Beta          ACTATACAGACAGATCATTCAACC   236
                               TTAGGAGCAGTTAGAACTACAGAC

                 Epsilon       ACTGCAACTACTACTCATACTGTG   541
                               CTGGTGCCTTAATAGAAAGACTCC

                 Iota          GCGATGAAAAGCCTACACCACTAC   317
                               GGTATATCCTCCACGCATATAGTC

                 Enterotoxin   GGAGATGGTTGGATATTAGG       233
                 (cpe gene)    GGACCAGCAGTTGTAGATA

M.O.             Toxin         Annealing      Ref
                               temp.
                               ([degrees]C)

C. perfringens   Alpha

                 Beta
                               55             16

                 Epsilon       1 min.

                 Iota

                 Enterotoxin   50             17
                 (cpe gene)    30 sec.

Table 2: Prevalence of C. perfringens in seafood samples

Seafood                        C. perfringens     Count of C.
Samples (No.)                  type A NO. (%)     perfringens

                                                    Minimum
                                                  count (CFU)

Finfish         Salmon (30)    0(0) *             0
                Tilapia (30)   3(10) *            10

Crustaceans     Shrimp (30)    11 (36.6) *        2 x 10
                Crab (30)      4(13.3) *          7 x 10

Molluscs        Calm (30)      2(6.6) *           4 x 10
Total           150            20(13) **

Seafood                                Count of C. perfringens
Samples (No.)

                                   Maximum            Average
                                 count (CFU)           (CFU)

Finfish         Salmon (30)    0                  0
                Tilapia (30)   1.3 x [10.sup.3]   6.5 x [10.sup.2]

Crustaceans     Shrimp (30)    3.4 x [10.sup.3]   1.7 x [10.sup.3]
                Crab (30)      2.5 x [10.sup.3]   1.3 x [10.sup.3]

Molluscs        Calm (30)      4.3 x [10.sup.3]   2.2 x [10.sup.3]
Total           150

* % of positive samples of C. perfringens according to total No. of
each type of samples.

** % of positive samples of C. perfringens according to total No. of
samples.

Table 3: Detection of C. perfringens enterotoxin genes in seafood
samples using uniplex PCR and SYBR Green real time PCR:

                                   C.perfringens enterotoxin genes

Samples (NO.)   Code number        Uniplex PCR      SYBR Green
                                                      RT PCR

                                                 Result   Ct *

Shrimp (8)      1, 4, 7, 9,        -             -        -
                  11, 15, 17, 18                          -
Tilapia (3)     2, 6, 8            -             -        -
Clam (2)        3, 10              -             -        -
Crab (3)        5, 19, 20          -             -        -
Shrimp (1)      12                 +             +        24.34
Shrimp (1)      13                 -             +        26.17
Shrimp (1)      14                 +             +        24.57
Crab (1)        16                 +             +        23.56

* Ct:Cycle thresholder
COPYRIGHT 2016 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Ezzeldeen, Nashwa A.; Ammar, Ahmed M.; Shalaby, Basma; Haririr, M. El.; Omar, Walaa S.
Publication:Advances in Environmental Biology
Article Type:Report
Date:Apr 1, 2016
Words:3763
Previous Article:Evaluation the quality of the oil waste histological changes in the ovaries of the whipfin fish, Gerres filamentosus (Cuvier, 1829) during the...
Next Article:Horticultural and viral studies for improving local potato seeds production.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters