Printer Friendly

Rapid RHD Zygosity Determination Using Digital PCR.

Of the 36 blood group systems, Rh is the most complex at the genetic level, the major cause of hemolytic disease of the fetus and newborn (HDFN), [3] and a major cause of transfusion reactions during alloimmunization events. The RH genes, namely, RHD and RHCE, are well characterized at the genetic level, with a combination of single-nucleotide polymorphisms (SNPs) in RHCE being responsible for the C/c and E/e polymorphisms; in contrast, gene deletion and hybrid RHD--RHCE genes are responsible for D-negative phenotypes, plus SNPs and hybrid genes are responsible for partial and weak D phenotypes (1, 2). All known mutations have been well catalogued and best described in the Rhesus-Base resource (3).

Paternal RHD zygosity testing is important for prenatal management of alloimmunized women. Where fathers are homozygous D-, there is no risk of HDFN for the current pregnancy or subsequent pregnancies that may follow. Pregnancies to homozygous D+ fathers (with the assumption of paternity) will, by definition, carry RhD-positive fetuses and can be considered for more focused clinical management. For hemizygous D + fathers, noninvasive prenatal testing (NIPT) is required for further analysis.

Previously published methods for RHD zygosity testing have included real-time PCR assessment of RHD gene dosage, assessment of the hybrid Rhesus box found in D- individuals with the RHD gene deletion genotype and allele-specific PCR methods, as well as mass spectrometry-based methods (2, 4-10). Zygosity testing targeting the hybrid Rhesus box found in RHD-deletion type cde haplotypes is complicated because of differences in the hybrid box among individuals of African descent (5, 11).

The incidence of common RH haplotypes in Caucasian, black African, and Asian populations has been serologically defined. In RHD-positive individuals, the DCe haplotype is prevalent in Asian (73%) and Caucasian (42%) populations, but the Dce haplotype is prevalent more in black African populations (59%) (12).

Asian individuals are rarely RHD-negative (<4%), but the dce haplotype is frequently found in Caucasian (39%) and black African (20%) populations (12). Rare haplotypes such DCE, dCe, dcE, and Dce are considerably less prevalent with frequencies of 0.24%, 0.98%, 1.19%, and 2.57%, respectively, in Caucasian populations (12). However, it has been difficult to define the precise population frequencies of the various RH haplotypes because of the inability to differentiate between homo- or hemizygous individuals. For example, an individual with the phenotype DCe would be designated as the most common presumed genotype DCe/DCe rather than DCe/dCe. Presumed genotype, based on probability from phenotypic analysis, is the approach currently applied to label donor and patient red cells. Zygosity determination of the above would define the presumed genotype (DCe/DCe or DCe/dCe) (2 copies of the RHD gene vs 1 copy of the RHD gene) that is being carried by an individual.

Previously, we have applied digital PCR (dPCR) to the analysis of free fetal DNA derived from maternal plasma (13). In this study, we have used dPCR as a more accurate quantitative PCR method than conventional real-time PCR to define RHD zygosity. We found rare haplotypes in a relatively small cohort of samples and identified that for 3 samples (plus 1 weak D sample), their predefined and labeled presumed genotype was indeed incorrect.

Materials and Methods

STUDY PARTICIPANTS

Human whole blood samples (n = 79) were supplied by the National Health Service Blood and Transplant (NHSBT; Bristol, UK; donated with informed consent) and transported to NHS Plymouth Hospitals Trust, Plymouth, UK, for collection.

SAMPLE PROCESSING

Samples were processed in 2 ways. Human whole blood samples (n = 25) were collected in EDTA tubes (5-10 mL total blood volume) and centrifuged at 1600g for 10 min at room temperature. The plasma was carefully removed and transferred to a 15-mL tube. The plasma was then recentrifuged at 16000g for 10 min. All samples were processed within 48-96 h of collection, and plasma aliquots (1 mL) were stored at -80[degrees]C.

Human whole blood samples (n = 54) were collected in EDTA tubes (5-10 mL of total blood volume) and centrifuged at 2500g for 10 min at room temperature. The buffy coat layer was carefully removed and transferred to a 1.5-mL tube for immediate processing to genomic DNA (gDNA). All blood samples were processed within 48-96 h of blood collection.

DNA EXTRACTION FROM PLASMA

Plasma extractions were performed as nonpregnant controls from maternal plasma experiments (13) and were further used in this study. DNA was extracted from 2 aliquots of plasma (1 mL each) by means of the QIAamp Circulating Nucleic Acid (CNA) kit (Qiagen) using the QIAvac 24 Plus (Qiagen). The extraction process was conducted as per the manufacturer's protocol, and each sample was eluted in 60-[micro]L Buffer AVE [RNase-free water containing 0.04% (w/v) sodium azide]. No DNase or RNase treatment was used. Following DNA extraction, samples were quantified on the Qubit[R] 2.0 Fluorometer (Life Technologies) by means of the Qubit double-stranded DNA (dsDNA) HS assay kit (Life Technologies). Samples were stored at -20[degrees]C as 60-[micro]L aliquots for up to 4 weeks.

DNA EXTRACTION FROM BUFFY COAT

For RHD intronic SNP sequencing, gDNA was extracted from buffy coats by use of the QIAamp DNA Blood Mini kit (Qiagen) according to the manufacturer's instructions. DNA was eluted in 200-[micro]L Buffer AE and incubated at room temperature for 5 min before centrifugation at 11 865g for 1 min. For the RHD LR-PCR, gDNA was extracted from buffy coats by use of the Centra[R] Puregene[R] Blood kit (Qiagen) according to the manufacturer's instructions for RNA-free DNA. As the buffy coat contained red blood cells, RBC Lysis Solution was used. Each sample was eluted by adding 300 [micro]L of DNA hydration solution and mixed vigorously for 5 s, followed by incubation at 65[degrees]C for 1 h. The tube was then incubated at room temperature overnight; gentle shaking of the tube was done to mix the gDNA with the DNA hydration solution. Finally, the pure gDNA was transferred into a new 1.5-mL tube and stored at -20[degrees]C. Following DNA extraction, samples were quantified on the Qubit 2.0 Fluorometer (Life Technologies) by use of the Qubit dsDNA HS assay kit (Life Technologies).

PCR PRIMERS AND PROBES FOR DPCR

In total, 2 multiplex reactions were tested on the QX100[TM] droplet digital PCR (ddPCR) platform (BioRad Laboratories) for RH zygosity testing (Table 1), as previously described by Sillence et al. (13). The oligonu-cleotide sequences [HPLC purified; Eurofins Cenomics] and amplicon sizes for all target (FAM-labeled) and reference (HEX-labeled) regions are shown in Table 1. Before zygosity testing, primer annealing temperatures (56[degrees]C to 60[degrees]C) were optimized for both multiplex reactions (see Fig. 1 in the Data Supplement that accompanies the online version of this article at http://www. clinchem.org/content/vol63/issue8). The results in Fig. 1A in the online Data Supplement showed successful droplet separation of the RHD5 (FAM) target at all an nealing temperatures, but the AG01 (HEX) reference showed suboptimal separation at 60[degrees]C. Droplet separation for the RHD7 AM) I AGO 1 (HEX) multiplex reaction (see Fig. IB in the online Data Supplement) showed the same pattern as previously discussed for the RHD5 (FAM)/AG01 (HEX) multiplex reaction. However, the optimal ratio was visible at 58.4[degrees]C (0.995). Therefore, 58[degrees]C was determined to be the optimum annealing temperature for both multiplex reactions.

dPCR

The dPCR reactions were conducted in duplicate and run on the QX100[TM] Droplet Generator (Bio-Rad) following manufacturer's instructions (13)? Plasma-extracted samples were not diluted and a standard volume of template DNA (5 [micro]L) was added. Samples extracted from the buffy coat were diluted; 50 ng of DNA was added to each 20 [micro]L reaction and a nontemplate control (NTC) was included in each assay.

DATA ANALYSIS FOR dPCR

The raw fluorescent data from the ddPCR platform was analyzed using the QuantaSoft v1.2 software (Bio-Rad). Once thresholds for each sample had been set manually by using the ID amplification plot, positive and negative droplets were determined (see Fig. 1 in the online Data Supplement). The concentration was then determined by the software by use of Poisson statistics (95% confidence interval) for each sample. The ratio of the target (RHD5-FAM and RHD7-FAM) over the reference (AGO/-HEX) for each sample was calculated as follows; FAM (copies/[micro],F)/HEX (copies/[micro]T). All statistical analysis was performed using Mann--Whitney /7-test (SigmaPlot Version 12.5) and significance was accepted at P <0.05.

RHD LR-PCR AND NEXT-GENERATION SEQUENCING

gDNA samples from blood donors of different phenotypes were tested by use of FR-PCR. In total, 3 PCR products were designed to cover the entire RHD gene (Table 2). The HPFC-purified primers were from Eurofins Genomics. The PCR reaction contained a final 1 X concentration of PrimeSTAR GXF Buffer, 200 [micro]mol/F dNTP mixture, 0.2 [micro]mol/F of each primer and 1.25 U PrimeSTAR GXF Polymerase per 50 [micro]L, and 500 ng DNA per reaction. A 2-step protocol was performed as 25 cycles of 98[degrees]C for 10 s and 68[degrees]C for 24 min, final hold at 4[degrees]C. The amplicons were purified on 0.5% w/v agarose gel in IX TAE buffer (Fig. 1). The long amplicons were purified by Agencourt[R] AMPure[R] XP beads (Beckman Coulter) to ensure removal of primer dimers, polymerase, and free nucleotides. The samples were eluted in 50-[micro]L nuclease-free water. Purified amplicons were quantified by Qubit dsDNA Broad-Range assay kit (Fife Technologies) to allow the starting concentration of the sequencing libraries to be 100 ng. Following quantification, enzymatic fragmentation was completed using the Ion Xpress[TM] Plus Fragment Library Kit (Life Technologies), resulting in fragments of approximately 200 bp. Next, the fragments were ligated with barcoded adapters, which add about 70 bp to the fragments. PI and Ion Xpress Barcode X adapters from the Ion Xpress Barcode Adapters Kit (Life Technologies) were used to distinguish the samples when pooled before sequencing. The adapter-ligated library was size selected by SPRIselect[R] reagent kit (Beckman Coulter). After each step (fragmentation, ligation, and size selection), purification was conducted using magnetic beads and the integrity, size distribution, concentration, and quality of the library in those steps were checked using the Agilent[R] 2100 Bioanalyzer[R] instrument and Agilent High Sensitivity DNA Kit (Agilent Technologies UK Limited).

Template-positive ion sphere particles containing clonally amplified DNA were prepared by the Ion Personal Genome Machine[TM] (PGM[TM]) Template OT2 200 Kit (for 200 base-read libraries) (Life Technologies) with the Ion OneTouch[TM] 2 System. Then, the percentage of template-positive ion sphere particles was checked by the Ion Sphere[TM] Quality Control assay (Life Technologies) on the Qubit 2.0 Fluorometer (Life Technologies) and then enriched by the Ion OneTouch ES Instrument before loading onto a 316[TM] chip. Sequencing was performed using the Ion PGM[TM] Sequencing 200 Kit v2 (Life Technologies) and the Ion Torrent PGM[TM].

BIOINFORMATICS FOR RHD LR-PCR

Torrent Suite[TM] Software Version 4.4 was used to generate a summary sequencing report indicating the number of reads generated by the sequencer, the percentage of chip loading, and the sequencing files. The FastQC software was run to assess the quality control across the reads generated (14). The sequencing samples were aligned to the human genome reference sequence (hg19) by use of the Binary Alignment/Map (BAM) and were visualized using Integrative Genome Viewer (IGV) Version 2.3.46.

The samples were annotated using the variant call format files to obtain the SNPs and indels to analyze the genotype and predict the phenotype. Antigens were determined by choosing the right transcript according to the Blood Group Antigen Factsbook (15). Each antigen was determined by its chromosomal location, the type of variant (SNP or indel), gene, the reference nucleotide, the changing nucleotide, the depth of coverage, the transcript used in analysis based on the NCBI database, the location of the variant (intronic or exonic), the codon, an exon number of that variant, an amino acid substitution, and the position of the nucleotide change. The SeattleSeq Annotation tool 141 site was used to annotate the sequencing data of the LR-PCR approach (16). By using Browser Extensible Data files, the bedtools website was used to mask the RHCE gene to analyze the RHD gene (17). The RHCE gene was annotated by "Ns" on its sequencing nucleotides.

RHD INTRONIC SNP SEQUENCING

gDNA samples from blood donors of different phenotypes were tested. RHD-specific primers amplified the regions around the intronic SNPs (Table 2). Further, 2 different enzymes were used, namely, BioMix[TM] 2X master mix (Bioline Reagents Limited) or Q5[R] Hot Start High-Fidelity 2X Master Mix (New England Biolabs). A 50-[micro]L PCR reaction was prepared containing 1X master mix, 200 ng of DNA template, and 1 [micro]mol/L of each of the primers. Cycling was performed on a Veriti Thermal Cycler (Life Technologies) following optimized conditions; 95[degrees]C for 10 min, 35 cycles of 95[degrees]C for 30 s and optimized annealing temperature for 1 min, 72[degrees]C for 30 s, followed by a final 72[degrees]C step for 10 min. To validate PCR amplification, PCR products were run on a 1% w/v agarose gel in 1X TAE buffer. PCR products were purified using the QIAquick Gel Extraction Kit, (Qiagen Ltd.) according to the manufacturer's instructions. PCR amplicons were subjected to Sanger sequencing by Eurofins Genomics. Results were aligned with the human genome reference sequence (hg19). CodonCode Aligner 6.0 software was used to analyze the data.

Results

DETERMINATION OF RHD ZYGOSITY

For zygosity testing, the presence or absence of RHD amplification on the ddPCR platform was used to determine whether the samples were RHD-negative or RHD-positive, respectively. The mean number of copies per droplet for all molecules was 0.15 (0.03-0.57) for plasma DNA samples and 0.39 (0.05-0.69) for buffy coat DNA samples. The ratio of RHD5 (FAM)/AGO1 (HEX) and RHD7 (FAM)/AGO1 (HEX) generated by the Quanta-Soft v1.2 Software was then used to determine whether the D-positive samples were either hemizygous or homozygous for the RHD gene. Samples showing ratios close to 1 were determined to be homozygous RHD-positive, and samples with ratios closer to 0.5 were classified as hemizygous RHD-positive (Fig. 2).

The results showed that the assay worked equally well on cell-free DNA and gDNA for zygosity determination (Table 3; Fig. 2). Further, 3 rr control samples were tested (147J, 1660, and 7807), and the results showed amplification of only the reference (AGO1), giving a ratio of zero (Fig. 2). The hemizygous D+ [R.sub.0]r (Dce/dce) (n = 8), R1r (DCe/dce) (n = 12), and [R.sub.2]r (DcE/dce) (n = 1) samples showed ratios close to 0.5 as expected (Table 3; Fig. 2), except for sample 1777. Sample 1777, previously classified by serology as being phenotypically [R.sub.1]r (DCe/dce), expressed ratios of 0.97 and 1.04 for the RHD5 and RHD7 multiplex reactions, respectively (Table 3). This result contradicted previous serological classifications and indicated that the sample expressed 2 copies of the RHD gene. Therefore, it is more feasible that this sample actually expresses the [R.sub.1][R.sub.0] (DCe/Dce) phenotype. The homozygous D+ R1R1 (DCe/ DCe) (n = 13), [R.sub.2][R.sub.2] (DcE/DcE) (n = 5), [R.sub.1][R.sub.2] (DCe/ DcE) (n = 10), and [R.sub.2][R.sub.Z] (DcE/DCE) (n = 1) samples were expected to generate a ratio close to 1, and this was achieved in 90% of samples. Sample 087W was serologically typed as expressing the [R.sub.2][R.sub.2] (DcE/DcE) phenotype. However, the dPCR results showed that this sample is hemizygous for the RHD gene, as both assays illustrated a ratio close to 0.5 (Fig. 2). Therefore, it is likely that sample 087W has the [R.sub.2]r" (DcE/dcE) genotype as opposed to the [R.sub.2][R.sub.2] (DcE/DcE) serologically predicted genotype. Further sequencing analysis was required to determine the actual genotype of the incorrectly labeled [R.sub.1][R.sub.2] samples (729M and 351D) (Fig. 2).

RHD INTRONIC POLYMORPHISMS

We sequenced the complete RHD gene from individuals with defined RH genotypes by use of LR-PCR (Table 2), and we identified several intronic polymorphisms that closely correlated with the individuals' DCE status. On further analysis by use of Sanger sequencing, 5 SNPs showed complete concordance when scrutinized using primers flanking these regions (Table 2 and Table 4).

COMPARISON OF RHD INTRONIC POLYMORPHISMS AND ZYGOSITY

Two of the [R.sub.1][R.sub.2] (DCe/DcE) presumed genotype samples tested (729M and 351D) expressed ratios close to 0.5 for both assays (Fig. 2). Because sample 729M has also been typed as weak D, it is highly unlikely that this sample is homozygous RHD-positive. Therefore, it is clear that this sample has been misclassified as [R.sub.1][R.sub.2], but we could not ascertain whether the true genotype for sample 729M was [R.sub.2]r' (DcE/dCe), [R.sub.Z]r (DCE/dce), [R.sub.0][r.sup.y] (Dce/ dCE), or [R.sub.1]r" (DCe/dcE). In consequence, LR-PCR, coupled with next-generation sequencing, revealed that sample 729M displayed the exon 9 Gly385Ala 1154G>C SNP and thus was classified as weak D type 2. In addition, the sample illustrated multiple RHD intronic SNPs that appear to be associated with the [R.sub.2] (DcE) haplotype, showing that sample 729M is likely to be [R.sub.2]r' (DcE/dCe) (Table 4). Sample 351D was not serologically typed as weak D, but the dPCR data show that only 1 copy of RHD is present (Fig. 2), and thus, the genotype must either be [R.sub.2]r' (DcE/dCe), RZr (DCE/ dce), [R.sub.0][r.sup.y] (Dce/dCE), or [R.sub.1]r" (DCe/dcE). This sample did not show the [R.sub.2]-associated RHD intronic SNPs and hence is likely to have a genotype of [R.sub.1]r" (DCe/dcE), [R.sub.0][r.sup.y] (Dce/dCE), or [R.sub.Z]r (DCE/dce).

Discussion

The RHD zygosity assignment has been proved to be a useful diagnostic tool in the clinical management of HDFN. Here, determination of homozygous (RHD/ RHD) fathers would give confidence (assuming paternity) of prenatal prediction of D-positive fetuses and signal where further monitoring or administration of prophylactic anti-D maybe required. Without doubt, the most appropriate technique would be the assessment of D-positive infants directly by analysis of free fetal DNA in maternal plasma. However, in repeat pregnancies fathered by RHD/RHD homozygotes, maternal plasma testing would not be necessary because the fetus would invariably be D-positive. This is of course with the caveat that paternity can be assured during the maternal consenting process. Previous methods have used real-time PCR (4, 7-9), multiplex ligation-dependent probe amplification (MLPA) (6), mass spectrometry (10), and analysis of the Rhesus box (2, 5, 11). However, as we have previously mentioned, individuals who confound zygosity testing when relying on analysis of the Rhesus box repeat sequences (11) have been described. Here we describe a rapid and accurate further method for defining RHD zygosity. We have used this on a small cohort of phenotyped blood samples and showed that this method could be effectively used to define paternal zygosity and, in addition, to correct presumed phenotype in blood donors that is presently dependent on phenotype prediction.

In 3 samples we have analyzed, and a weak D sample, we have clearly shown homo- and hemizygosity for RHD, which was not in concordance with predicted phenotype. The vast majority of current genotyping methods (18-23) are not able to define zygosity (except the study by Gassner et al. (10) or unless an assessment of intronic RHD-specific SNPs is performed, some of which are described in this paper). Our description of candidate SNPs that define the RHD gene within the DcE haplotype will also provide a method to differentiate homo- or hemizygosity, and we have candidate RHD intronic SNPs that define the DCe and Dce RHD genes (Table 4). However, much more work on a larger number of donors (including the testing of rare RH haplotypes) should be done before these candidate RHD intronic SNPs can be confirmed as being truly DCe- and Dce-specific. Nevertheless, these RHD intronic SNPs may not be able to differentiate between DcE/DcE and DcE/dcE, DCe/DCe and DCe/dCe, and Dce/Dce and Dce/dce genotypes; however, the dPCR method described here is able to facilitate this (differentiating homo- and hemizygosity). Clearly, for these candidate SNPs to have clinical utility, a larger cohort of phenotyped samples will require sequencing. We have subsequently performed such an analysis on 37 Rh phenotyped individuals and have found complete concordance with the 5 DcE-associated candidate SNPs described in this study. We have identified a further 11 such candidate SNPs that also are in concordance with DcE genotype and are currently investigating a number of Rh variants and rare phenotypes (e.g., Rz) to assist in their identification (24).

This method provides a quick and accurate platform for rapid determination of RHD zygosity. In this small cohort of samples, we would be unlikely to see rare haplotypes such as DCE, dCe, dcE, and Dce. However, both dCe and dcE haplotypes were identified. Further zygosity-based studies are clearly necessary to reassess the population frequencies of these D-negative haplotypes. It is also important to consider that fathers who are RHD hemizygous DCe/dCe or DcE/dcE may pass the dCe or dcE haplotypes to their children, and these fetuses may be at risk of HDFN because of anti-C or G (25) or anti-E (26). Fetal genotyping for inheritance of both Rh C and Rh E has been routinely performed by using maternal plasma and should therefore be used in such cases where hemizygosity has been defined. We believe that the method we have describe here is a useful addition to the diagnostic repertoire available to clinicians in the management of HDFN.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contribution to the conception and design, acquisition Of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.

Authors' Disclosures or Potential Conflicts of Interest: Upon manuscript submission, all authors completed the author disclosure form. Disclosures and/or potential conflicts of interest:

Employment or Leadership: None declared.

Consultant or Advisory Role: None declared.

Stock Ownership: None declared.

Honoraria: None declared.

Research Funding: None declared.

Expert Testimony: N.D. Avent, Expert witness for Premaitha Ltd. Patents: T.E. Madgett, P120661GB; N.D. Avent, P120661GB.

Role of Sponsor: No sponsor was declared.

References

(1.) Avent ND, Reid ME. The Rh blood group system: a review. Blood 2000; 95:375-87.

(2.) Wagner FF, Flegel WA. RHD gene deletion occurred in the Rhesus box. Blood 2000; 95:3662-8.

(3.) The Rhesusbase. The RHD mutation database [Online]. Availableat: http://www.rhesusbase.info/iAccessed October 2016).

(4.) Chiu RW, Murphy MF, Fidler C, Zee BC, Wainscoat JS, Lo YD. Determination of RhD zygosity: comparison of a double amplification refractory mutation system approach and a multiplex real-time quantitative PCR approach. Clin Chem 2001; 47:667-72.

(5.) Grootkerk-Tax MG, Maaskant-van Wijk PA, Van Drunen J, Der Schoot V, Ellen C.The highly variable RH locus in nonwhite persons hampers RHD zygosity determination but yields more insight into RH-related evolutionary events. Transfusion 2005; 45:327-37.

(6.) Haer-Wigman L, Veldhuisen B, Jonkers R, Loden M, Madgett TE, Avent ND, et al. RHD and RHCE variant and zygosity genotyping via multiplex ligation-dependent probe amplification. Transfusion 2013; 53:1559-74.

(7.) Perco P, Shao CP, Mayr WR, Panzer S, Legler TJ. Testing For the Dzygosity with three different methods revealed altered Rhesus boxes and a new weak D type. Transfusion 2003; 43:335-9.

(8.) Pirelli KJ, Pietz BC, Johnson ST, Pinder HL, Bellissimo DB. Molecular determination of RHD zygosity: predicting risk of hemolytic disease of the fetus and newborn related to anti-D. Prenatal Diag 2010; 30:1207-12.

(9.) Krog GR, Clausen FB, Dziegiel MH. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism:an evaluation of four quantitative methods. Transfusion 2007; 47:715-22.

(10.) Gassner C, Meyer S, Frey BM, Vollmert C. Matrix-assisted laser desorption/ionisation, time-of-flight mass spectrometry-based blood group genotyping--the alternative approach. Transfusion Medicine Rev 2013; 27:2-9.

(11.) Matheson KA, Denomme GA. Novel 3' Rhesus box sequences confound RHD zygosity assignment. Transfusion 2002; 42:645-50.

(12.) Daniels G. Rhand RHAG Blood Group Systems. In: Human blood groups. 3rd Ed. Oxford (UK): Wiley-Blackwell; 2013. p.185.

(13.) Sillence KA, Roberts LA, Hollands HJ, Ross Welch C, Thompson HP, Kiernan M, et al. Fetal sex and RHD genotyping with digital PCR demonstrates greater sensitivity than real-time PCR. Clin Chem 2015; 61:1399407.

(14.) Andrews,S.FastQC: a quality control tool for high through put sequence data (2010) [Online]. http://www.bioinfor matics.babraham.ac.uk/projects/fastqc (Accessed October 2016).

(15.) Reid ME, Lomas-Francis C, Olsson ML. The blood group antigen factsbook. 3rd Ed. Boston (MA): Academic Press; 2012. p. 147-262.

(16.) Seattleseq Annotation Tool 141. Seattleseq variation annotation [Online]. http://snp.gs.washington.edu/ (Accessed October 2016).

(17.) Bedtools. Bedtools: a powerful toolset for genome arithmetic [Online]. http://bedtools.readthedocs.org/ (Accessed October 2016).

(18.) Hashmi G, Shariff T, Zhang Y, Cristobal J, Chau C, Seul M, et al. Determination of 24 minor red blood cell antigens for more than 2000 blood donors by high-throughput DNA analysis. Transfusion 2007; 47:73647.

(19.) Avent ND, Martinez A, Flegel WA, Olsson ML, Scott ML, Nogues N, et al. The Bloodgen project of the European Union, 2003-2009. Transfus Med Hemother 2009; 36: 162-7.

(20.) Avent ND. Large-scale blood group genotyping--clinical implications. Brit J Haematol 2009; 144:3-13.

(21.) Flegel WA, Gottschall JL, Denomme GA. Implementing mass-scale red cell genotyping at a blood center. Transfusion 2015; 55:2610-5.

(22.) Boccoz SA, LeGoff GC, Mandon CA, Corgier BP, Blum LJ, Marquette CA. Development and validation of a fully automated platform for extended blood group genotyping. J Mol Diagn 2016; 18:144-52.

(23.) Lopez M, Apraiz I, Rubia M, Piedrabuena M, Azkarate M, Veldhuisen B, et al. Performance evaluation study of ID CORE XT, a high throughput blood group genotyping platform. [Epub ahead of print] Blood Transfus November 25,2016 as doi: 10.2450/2016.0146-16.

(24.) Tounsi W, Avent ND, Madgett TE. Complete sequencing of the RHD blood group gene using next generation sequencing: determination of RHD reference sequences. Accepted abstract to be presented at the 27th Regional Congress of the International Society for Blood Transfusion (ISBT) in Copenhagen, June 17-21, 2017.

(25.) Hadley A, Poole G, Poole J, Anderson N, Robson M. Haemolytic Disease of the Newborn Due to Anti-G. Vox Sang 1996; 71:108-12.

(26.) Rouillac C, Kim CLV, Blancher A, Roubinet F, Cartron JP, Colin Y. Lack of G blood group antigen in DIIIb erythrocytes is associated with segmental DNA exchange between RH genes. Brit J Haematol 1995; 89:424-6.

(27.) Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake SR. Analysis of the size distributions of fetal and maternal cell-free DNA by paired-end sequencing. Clin Chem 2010; 56:1279-86.

(28.) Finning K, Martin P, Summers J, Massey E, Poole G, Daniels G. Effect of high throughput RHD typing of fetal DNA in maternal plasma on use of anti-RhD immunoglobulin in RhD negative pregnant women: prospective feasibility study. BMJ 2008; 336:816-8.

(29.) Legler TJ, Maas JH, Kohler M, Wagner T, Daniels GL, Perco P, Panzer S. RHD sequencing: a new tool for decision making on transfusion therapy and provision of Rh prophylaxis. Transfusion Med 2001; 11:383-88.

(30.) National Center for Biotechnology Information (NCBI). dbSNP short genetic variations [Online]. https://www.ncbi. nlm.nih.gov/projects/SNP/snp ref.cgi?rs (Accessed October2016).

Kelly A. Sillence, [1] Amr J. Halawani, [1] Wajnat A. Tounsi, [1] Kirsty A. Clarke, [1] Michele Kiernan, [1] Tracey E. Madgett, [1] * and Neil D. Avent [1]

[1] School of Biomedical and Healthcare Sciences, Plymouth University Peninsula Schools of Medicine and Dentistry, Plymouth, UK.

* Address correspondence to this author at: School of Biomedical and Healthcare Sciences, Plymouth University, Plymouth PL4 8AA, UK. Fax +44-01752-586788; e-mail tracey.madgett@plymouth.ac.uk.

Received October 25,2016; accepted April 27,2017.

Previously published online at DOI: 10.1373/clinchem.2016.268698

[2] Human Genes: Reference genes: AGO1 (argonaute RISC catalytic component 1, HGNC: 3262) (or AGO1 [eukaryotic translation initiation factor 2C, 1]). Target genes: RHD (Rh blood group, D antigen, HGNC: 10009) (or Rhesus blood group, D antigen).

[3] Nonstandard abbreviations: HDFN, hemolytic disease of the fetus and newborn; SNP, single nucleotide polymorphism, dPCR, digital PCR; gDNA, genomic DNA, dsDNA, double-stranded DNA; ddPCR, droplet digital PCR, LR-PCR, long-range PCR.

Caption: Fig. 1. LR-PCR products for the Rh blood group system. Three long-range amplicons (1, 2, and 3) were designed to amplify the entire RHD gene. An RhD-negative sample shows no bands for the RHD LR-PCR in lanes 1,2, or 3, which represent the 3 amplicons (A). An RhD-positive sample gives amplification of all 3 products, with each product being about 22 kb (B).

Caption: Fig. 2. Ratio analysis to determine zygosity by use of 2 multiplex reactions [RHD5 (FAM)IAGO1 (HEX) and RHD7(FAM)IAGO1 (HEX)] for samples with varying Rh phenotypes. The gray dotted lines at 0.5 and 1 on the y axis represent the ratio generated by hemizygous D+ samples and homozygous D+ samples, respectively. The mean ratio for hemizygous and homozygous D+ positive samples for both plasma- and buffy coat- extracted samples (Table 3) showed significant difference (P < 0.001). The arrows indicate the samples that illustrated discordant results compared with the serologically predicted genotype.
Table 1. RHD5, RHD7, and AG01 oligonucleotide sequences,
product size, and gene location.

Amplicon location     Multiplex   Primer
                      reaction

1 p36.11 RHD Exon 5   1           RHD5 Forward (a)
                                  RHD5 Reverse (a)
1 p36.11 RHD Exon 7   2           RHD7 Forward (a)
                                  RHD7 Reverse (a)
1 p34.3               1 and 2     AGOl Forward (b)
                                  AGO1 Reverse (b)

Amplicon location     Sequence (5'-3')

1 p36.11 RHD Exon 5   CGCCCTCTTCTTGTGGATG
                      GAACACGGCATTCTTCCTTTC
1 p36.11 RHD Exon 7   CAGCTCCATCATGGGCTACAA
                      AGCACCAGCAGCACAATGTAGA
1 p34.3               GTTCGGCTTTCACCAGTCT
                      CTCCATAGCTCTCCCCACTC

Amplicon location     Dual-labeled hydrolysis probe (5'-3')   Length
                                                              (bp)

1 p36.11 RHD Exon 5   FAM-TCTGGCCAAGTTTCAACTCTGCTCTGCT-BHQ1   82

1 p36.11 RHD Exon 7   FAM-AGCTTGCTGGGTCTGCTTGGAGAGATC-BHQ1    75

1 p34.3               H EX-CTGCCATGTGGAAGATGATG-BHQ1          81

(a) Taken from Finning et al.(28).

(b) Taken from Fan et al. (27).

Table 2. RHD intronicSNP and RHD LR-PCR oligonucleotide
sequences, product sizes, and corresponding SNP in the
RHD gene (hg19 human genome reference sequence, for
intronicSNPs).

Intronic SNPs    Intron   Forward primer sequence 5'-3'

25,611,580 G>A     2      TTTTACTGGACAGCCCTACTCC
25,614,400 C>G     2      GCTACCATGCCCTGCTAAT
25,625,471 T>C     3      GGGGCAGCTTCATCTTATCAAGAG
25,627,066 C>G     3      TGGGATTACAGGCAAAATTAG
25,648,349 T>C     8      TCCAGGAATGACAGGGCT

RHD exons covered

1-3               1,2     GATTG G GTCCGTG ATTG GCATT
2-7               2-6     GCCGCGAATTCACTAGTGTGACGAGTGAAACTCTATCTCGAT
                          (Ds2-s (a))
7-10              7-9     GCCGCGAATTCACTAGTGACAAACTCCCCGATGATGTGAGTG

Intronic SNPs     Reverse primer sequence 5'-3'

25,611,580 G>A   CATGGCTATTTATTGTCTAGCAGCA
25,614,400 C>G   T CCAGT ACTTTT CAG AG CC
25,625,471 T>C   CTCACTG CAACCT CCACCCGTT
25,627,066 C>G   AGGTGT G ACTT G AAG CCAT
25,648,349 T>C   TGAG GACTG CAGATAGG G

RHD exons covered

1-3              GGCCGCGGGAATTCGATTGTTGTCTTTATTTTTCAAAACCCT
2-7              GGCCGCGGGAATTCGATTGAGGCTGAGAAAGGTTAAGCCA

7-10             GGCCGCGGGAATTCGATTGTGGTACATGGCTGTATTTTATTG

Intronic SNPs    Length(bp)

25,611,580 G>A      558
25,614,400 C>G      417
25,625,471 T>C      419
25,627,066 C>G      834
25,648,349 T>C      525

RHD exons covered

1-3                22,829
2-7                23,610

7-10               22,731

(a) Adapted from Legler et al. (29).

Table 3. Zygosity testing results determined by ratio analysis
for both plasma (cfDNA)-and buffy coat (gDNA)-extracted DNA
samples of human whole blood samples.

Sample              RH (a)                         Ratio (RHD5
                                                   (FAM)/AGO1
                                                     (HEX))

147J (c)            rr (dce/dce)                        0
1660 (c)            rr (dce/dce)                        0
7807 (c)            rr (dce/dce)                        0
9763 (c)            [R.sub.0]r (Dce/dce)              0.45
069F (c)            [R.sub.0]r (Dce/dce)              0.50
740B (c)            [R.sub.0]r (Dce/dce)              0.47
258D (c)            [R.sub.0]r (Dce/dce)              0.51
079* (c)            [R.sub.0]r (Dce/dce)              0.51
649B (c)            [R.sub.0]r (Dce/dce)              0.50
8931 (c)            [R.sub.0]r (Dce/dce)              0.49
5784 (c)            [R.sub.0]r (Dce/dce)              0.49
065S (c)            [R.sub.1]r (DCe/dce)              0.49
118Z (c)            [R.sub.1]r (DCe/dce)               0.5
1226 (c)            [R.sub.1]r (DCe/dce)              0.52
1306 (c)            [R.sub.1]r (DCe/dce)              0.51
1777 (c)            [R.sub.1]r (DCe/dce)              0.97
180H (c)            [R.sub.1]r (DCe/dce)              0.52
181F (c)            [R.sub.1]r (DCe/dce)              0.52
148R (d)            [R.sub.1]r (DCe/dce)              0.50
6418 (d)            [R.sub.1]r (DCe/dce)              0.51
3093                [R.sub.1]r (DCe/dce)              0.51
572R (d)            [R.sub.1]r (DCe/dce)              0.50
7687 (d)            [R.sub.1]r (DCe/dce)              0.50
5481 (d)            [R.sub.2]r (DcE/dce)              0.50
1220 (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.98
131Z (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.99
165F (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.94
1793 (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.99
0670 (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.91
1347 (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.99
138R (c)            [R.sub.1][R.sub.1] (DCe/DCe)      0.95
052M                [R.sub.1][R.sub.1] (DCe/DCe)      0.99
247X                [R.sub.1][R.sub.1] (DCe/DCe)      1.02
078U                [R.sub.1][R.sub.1] (DCe/DCe)      0.99
103N                [R.sub.1][R.sub.1] (DCe/DCe)      1.01
1461                [R.sub.1][R.sub.1] (DCe/DCe)      0.99
877L                [R.sub.1][R.sub.1] (DCe/DCe)      1.01
658G                [R.sub.2][R.sub.2] (DcE/DcE)      1.02
738W                [R.sub.2][R.sub.2] (DcE/DcE)      1.02
087W                [R.sub.2][R.sub.2] (DcE/DcE)      0.51
132H                [R.sup.2][R.sup.2] (DcE/DcE)      1.01
689U                [R.sup.2][R.sup.2] (DcE/DcE)      0.99
729M                [R.sup.1][R.sup.2] (DCe/DcE)      0.50

896H                [R.sup.1][R.sup.2] (DCe/DcE)      0.98
898D                [R.sup.1][R.sup.2] (DCe/DcE)      0.99
351D                [R.sup.1][R.sup.2] (DCe/DcE)      0.51

9316                [R.sup.1][R.sup.2] (DCe/DcE)      1.02
911E                [R.sup.1][R.sup.2] (DCe/DcE)      1.02
4195                [R.sup.1][R.sup.2] (DCe/DcE)      1.02
645C                [R.sup.1][R.sup.2] (DCe/DcE)      1.06
3627                [R.sup.1][R.sup.2] (DCe/DcE)      0.99
8873                [R.sup.1][R.sup.2] (DCe/DcE)      1.02
746P                [R.sup.2][R.sub.2] (DcE/DCE)      1.02

Sample              Ratio (RHD7   Hemizygous or Homozygous
                    (FAM)/AGO1
                      (HEX))

147J (c)                 0        Homozygous RHD negative
1660 (c)                 0        Homozygous RHD negative
7807 (c)                 0        Homozygous RHD negative
9763 (c)               0.43       Hemizygous
069F (c)               0.49       Hemizygous
740B (c)               0.46       Hemizygous
258D (c)               0.51       Hemizygous
079* (c)               0.50       Hemizygous
649B (c)               0.50       Hemizygous
8931 (c)               0.49       Hemizygous
5784 (c)               0.50       Hemizygous
065S (c)               0.49       Hemizygous
118Z (c)               0.49       Hemizygous
1226 (c)               0.51       Hemizygous
1306 (c)               0.53       Hemizygous
1777 (c)               1.04       Homozygous RHD positive
180H (c)               0.52       Hemizygous
181F (c)               0.49       Hemizygous
148R (d)               0.50       Hemizygous
6418 (d)               0.49       Hemizygous
3093                   0.51       Hemizygous
572R (d)               0.50       Hemizygous
7687 (d)               0.51       Hemizygous
5481 (d)               0.51       Hemizygous
1220 (c)               1.01       Homozygous RHD positive
131Z (c)               1.04       Homozygous RHD positive
165F (c)               0.90       Homozygous RHD positive
1793 (c)               1.00       Homozygous RHD positive
0670 (c)               0.85       Homozygous RHD positive
1347 (c)               1.03       Homozygous RHD positive
138R (c)               0.98       Homozygous RHD positive
052M                   1.03       Homozygous RHD positive
247X                   1.01       Homozygous RHD positive
078U                   1.01       Homozygous RHD positive
103N                   1.03       Homozygous RHD positive
1461                   1.01       Homozygous RHD positive
877L                   0.98       Homozygous RHD positive
658G                   1.03       Homozygous RHD positive
738W                   1.04       Homozygous RHD positive
087W                   0.49       Hemizygous
132H                   1.03       Homozygous RHD positive
689U                   1.01       Homozygous RHD positive
729M                   0.49       Hemizygous

896H                   1.03       Homozygous RHD positive
898D                   0.97       Homozygous RHD positive
351D                   0.51       Hemizygous

9316                   1.01       Homozygous RHD positive
911E                   1.03       Homozygous RHD positive
4195                   1.01       Homozygous RHD positive
645C                   1.03       Homozygous RHD positive
3627                   1.01       Homozygous RHD positive
8873                   1.03       Homozygous RHD positive
746P                   0.99       Homozygous RHD positive

Sample              Genotype determined
                    by dPCR (b)

147J (c)            rr (dce/dce)
1660 (c)            rr (dce/dce)
7807 (c)            rr (dce/dce)
9763 (c)            [R.sub.0]r (Dce/dce)
069F (c)            [R.sub.0]r (Dce/dce)
740B (c)            [R.sub.0]r (Dce/dce)
258D (c)            [R.sub.0]r (Dce/dce)
079* (c)            [R.sub.0]r (Dce/dce)
649B (c)            [R.sub.0]r (Dce/dce)
8931 (c)            [R.sub.0]r (Dce/dce)
5784 (c)            [R.sub.0]r (Dce/dce)
065S (c)            [R.sub.1]r (DCe/dce)
118Z (c)            [R.sub.1]r (DCe/dce)
1226 (c)            [R.sub.1]r (DCe/dce)
1306 (c)            [R.sub.1]r (DCe/dce)
1777 (c)            [R.sub.1][R.sub.0] (DCe/Dce)
180H (c)            [R.sub.1]r (DCe/dce)
181F (c)            [R.sub.1]r (DCe/dce)
148R (d)            [R.sub.1]r (DCe/dce)
6418 (d)            [R.sub.1]r (DCe/dce)
3093                [R.sub.1]r (DCe/dce)
572R (d)            [R.sub.1]r (DCe/dce)
7687 (d)            [R.sub.1]r (DCe/dce)
5481 (d)            [R.sub.2]r (DcE/dce)
1220 (c)            [R.sub.1][R.sub.1] (DCe/DCe)
131Z (c)            [R.sub.1][R.sub.1] (DCe/DCe)
165F (c)            [R.sub.1][R.sub.1] (DCe/DCe)
1793 (c)            [R.sub.1][R.sub.1] (DCe/DCe)
0670 (c)            [R.sub.1][R.sub.1] (DCe/DCe)
1347 (c)            [R.sub.1][R.sub.1] (DCe/DCe)
138R (c)            [R.sub.1][R.sub.1] (DCe/DCe)
052M                [R.sub.1][R.sub.1] (DCe/DCe)
247X                [R.sub.1][R.sub.1] (DCe/DCe)
078U                [R.sub.1][R.sub.1] (DCe/DCe)
103N                [R.sub.1][R.sub.1] (DCe/DCe)
1461                [R.sub.1][R.sub.1] (DCe/DCe)
877L                [R.sub.1][R.sub.1] (DCe/DCe)
658G                [R.sub.2][R.sub.2] (DcE/DcE)
738W                [R.sub.2][R.sub.2] (DcE/DcE)
087W                [R.sub.2]r" (DcE/dcE)
132H                [R.sub.2][R.sub.2] (DcE/DcE)
689U                [R.sub.2][R.sub.2] (DcE/
729M                DcE) [R.sub.1]r" (DCe/dcE)
                    or [R.sub.2]r' (DcE/dCe) or
                    [R.sb.z]r (DCE/dce) or
                    [R.sub.0][r.sup.y] (Dce/
                    dCE)
896H                [R.sub.1][R.sub.2] (DCe/DcE)
898D                [R.sub.1][R.sub.2] (DCe/DcE)
351D                [R.sub.1]r" (DCe/dcE) or
                    [R.sub.2]r' (DcE/dCe) or
                    [R.sub.z]r (DCE/dce) or
                    [R.sub.0][r.sup.y] (Dce/
                    dCE)
9316                [R.sub.1][R.sub.2] (DCe/DcE)
911E                [R.sub.1][R.sub.2] (DCe/DcE)
4195                [R.sub.1][R.sub.2] (DCe/DcE)
645C                [R.sub.1][R.sub.2] (DCe/DcE)
3627                [R.sub.1][R.sub.2] (DCe/DcE)
8873                [R.sub.1][R.sub.2] (DCe/DcE)
746P                [R.sub.2][R.sub.z] (DcE/DCE)

(a) Serologically predicted phenotype provided by National
Health Service Blood and Transplant (NHSBT) (Bristol, UK).

(b) The C/c and E/e status based on serological information.
Only the D/d genotype was corrected by dPCR.

(c) DNA samples tested from plasma.

(d) Sample is weak D.

Table 4. RHD intronic SNP sequencing and RHD LR-PCR next
generation sequencing results for a range of DNA samples. (a)

Intronic SNPs in RHD        RHD Intron   [R.sub.1]   [R.sub.1]r
([R.sub.1]/[R.sub.1] to                  [R.sub.1]   (DCe/dce)
[R.sub.2])                               (DCe/DCe)    (n = 1)
                                          (n = 4)

25,611,580 G>A                  2           G/G          G

25,614,400 C>G                  2           C/C          C
rs28718098 (b)

25,625,471 T>C                  3           T/T          T
rs2904843 (b)

25,627,066 C>G                  3           C/C          C
rs2986167 (b)

25,648,349 T>C                  8           T/T          T
rs28669938 (b)

Intronic SNPs in RHD        [R.sub.0]r   [R.sub.2]   [R.sub.2]r
([R.sub.1]/[R.sub.1] to     (Dce/dce)    [R.sub.2]   (DcE/dce)
[R.sub.2])                   (n = 8)     (DcE/DcE)    (n = 1)
                                          (n = 6)

25,611,580 G>A                  G           A/A          A

25,614,400 C>G                  C           G/G          G
rs28718098 (b)

25,625,471 T>C                  T           C/C          C
rs2904843 (b)

25,627,066 C>G                  C           G/G          G
rs2986167 (b)

25,648,349 T>C                  T           C/C          C
rs28669938 (b)

Intronic SNPs in RHD        [R.sub.1]   Sample   Sample
([R.sub.1]/[R.sub.1] to     [R.sub.2]   729M     351D
[R.sub.2])                  (DCe/DcE)            (n = 1)
                             (n = 5)

25,611,580 G>A                 G/A        A         G

25,614,400 C>G                 C/G        G         C
rs28718098 (b)

25,625,471 T>C                 T/C        C         T
rs2904843 (b)

25,627,066 C>G                 C/G        G         C
rs2986167 (b)

25,648,349 T>C                 T/C        C         T
rs28669938 (b)

(a) The table indicates these rologically inferred genotype of the
samples provided by the National Health Service Blood and
Transplant (NHSBT) (Bristol, UK).

(b) Taken from the National Center for Biotechnology Information
(NCBI) (30).
COPYRIGHT 2017 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Sillence, Kelly A.; Halawani, Amr J.; Tounsi, Wajnat A.; Clarke, Kirsty A.; Kiernan, Michele; Madget
Publication:Clinical Chemistry
Article Type:Report
Date:Aug 1, 2017
Words:7088
Previous Article:Stronger Together: Aggregated Z-values of Traditional Quality Control Measurements and Patient Medians Improve Detection of Biases.
Next Article:A Genoproteomic Approach to Detect Peptide Markers of Bacterial Respiratory Pathogens.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |