Printer Friendly

Rapid Diagnosis of Tick-Borne Illnesses by Use of One-Step Isothermal Nucleic Acid Amplification and Bio-Optical Sensor Detection.

Severe fever with thrombocytopenia syndrome (SFTS) [3] and scrub typhus are common tick-borne infectious diseases in eastern Asia, especially Korea, China, and Japan (1, 2). SFTS is caused by SFTS virus (SFTSV), a novel Phlebovirus in the family Bunyaviridae, which was first identified in China in 2009 (3), and subsequently found in Korea and Japan (4, 5). In China, the mortality rate of SFTS is about 12% (6). In Korea, the incidence of SFTS increased from 36 cases in 2013 to 79 cases in 2015, and the overall mortality rate was higher than that in China, with 54 deaths among 170 confirmed cases (32%) (7). Scrub typhus is caused by Orientia tsutsugamushi, classified in the family Rickettsiaceae (8). It is prevalent in the Asia-Pacific region, where about 1 million cases are reported annually (9). In Korea, 5000-6000 cases have been reported annually since 2005 (7), and the prevalence has increased, with 9513 confirmed cases reported in 2015 (7). However, the clinical presentations of scrub typhus substantially overlap with those of SFTS. Therefore, laboratory tests to differentiate early between SFTS and scrub typhus are urgently needed to ensure specific antimicrobial treatment for scrub typhus and to institute appropriate precautions for SFTS because of its potential transmission to healthcare workers (10).

The diagnosis of scrub typhus generally relies on serologic tests, especially indirect immunofluorescence assays (IFA), which can detect a 4-fold increase in antibody titer between paired sera (11, 12). However, this serologic test requires paired serum samples and cannot be used in the acute phase of the disease. Real-time PCR has been proposed for early clinical diagnosis of scrub typhus (13, 14), but the samples assayed in these studies were buffy coats, which required technical expertise for their preparation. Because O. tsutsugamushi is an obligate intracellular parasite (1), bacterial loads in sera are expected to be low. Therefore, the clinical sensitivity of real-time PCR for detecting O. tsutsugamushi by use of serum samples remains insufficient (13, 15). Real-time reverse transcription (RT)-PCR for SFTSV has been developed recently for differential diagnosis of SFTS (16, 17), but neither has it been standardized nor is it commercially available. In sum, serologic diagnosis of scrub typhus is of limited use in clinical practice, and molecular diagnosis has suboptimal clinical sensitivity, especially for scrub typhus. In addition, both conventional tests take several hours, so a more rapid and sensitive test to differentiate common tick-borne illnesses is needed.

In this study, we developed a 1-step isothermal nucleic acid amplification procedure with bio-optical sensor detection (iNAD) that has high sensitivity, specificity, and is rapid (20-30 min) under isothermal conditions for both DNA and RNA analysis. This assay is based on a combination of 2 techniques, isothermal solid-phase DNA amplification and detection (iSAD) for DNA analysis and isothermal 1-step RNA amplification and detection (iROAD) for RNA analysis (18, 19). Our goal was to compare the diagnostic performance of iNAD with that of real-time PCR with use of plasma specimens from patients with confirmed tick-borne illnesses in South Korea.

Methods

PATIENTS AND SPECIMEN COLLECTION AND PROCESSING

We prospectively enrolled adult patients with suspected tick-borne illness in Asan Medical Center, a 2700-bed tertiary hospital in Seoul, South Korea, between 2015 and 2016, and collected blood samples from these patients. About 8 mL of blood was collected in EDTA tubes from the patients, and plasma was obtained by centrifugation at 1200g for 10 min. Each 500 [micro]L of plasma was aliquoted into 1.5 mL of microcentrifuge tubes and stored at -80 [degrees]C until testing. One vial of plasma (500 [micro]L) was sent to the Korea Centers for Disease Control to confirm infection of SFTSV by detecting viral RNA by RT-PCR, by use of a DiaStar 2X OneStep RT-PCR Pre-Mix kit (SolGent) as previously described (10). The remaining plasma was stored at -80 [degrees]C for further use.

A diagnosis of scrub typhus was established when either a single positive result from IFA (SD. Bioline Tsutsugamushi Assay; Standard Diagnostics), or a [greater than or equal to] 1:640 or 4-fold rise of IFA titer in successive samples was documented (20). The stored plasma samples from the patients confirmed with SFTS and scrub typhus were thawed to compare the diagnostic performance of iNAD with that of real-time PCR. On the basis of previous studies (13-17), we initially expected that the clinical sensitivity of real-time PCR for scrub typhus will not be high in confirmed patients with scrub typhus, while the clinical sensitivity of real-time PCR for SFTSV will be high in patients with SFTS. Therefore, we included the recovery phase plasma samples in case of patients with SFTS so that we could evaluate the ability of iNAD to detect a very low viral load of SFTSV. The final classification of the patients' plasma specimens was blinded to the research laboratory personnel. Both DNA and RNA were simultaneously extracted from each plasma sample. The extracted DNA for scrub typhus and RNA for SFTS were used for real-time PCR of SFTSV and scrub typhus, and iNAD of SFTSV and scrub typhus. True positive or negative results of the real-time PCR and iNAD were determined by the final diagnosis of SFTS confirmed by RT-PCR of the Korea Centers for Disease Control, and scrub typhus by IFA results for scrub typhus. The sample processing flow chart is shown in Fig. 1 in the Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol64/ issue3. The Institutional Review Board of Asan Medical Center approved the study protocol, and informed consent was obtained from all participants.

DESIGN OF PRIMERS AND PROBES

Primers and probes for SFTSV were designed by use of the SFTSV M and S segments. To detect O. tsutsugamushi, we used the 56-kDa type-specific antigen gene, which encodes the primary immunogen located on the outer membrane (21, 22) commonly used in conventional as well as real-time PCR (23, 24). To identify highly conserved regions, the following sequences were aligned by use of the ClustalW program (25): M segments of SFTSV (GenBank accession numbers: NC018138, KR698332, KR017863, AB985654, KF887440, KJ597824, KF358692, KC473541), S segments of SFTSV (Gen Bank accession numbers: NC018137, KR612087, KR612074, KR612073, KR612072, KR698319, KT254589, KU738910, KR017826), and the 56-kDa type-specific antigen gene of O. tsutsugamushi (GenBank accession numbers: KJ742368, KJ868218, KF523362, JQ898387, HQ660214, HQ660200, HQ731680, GU446620). The Primer3 program was used to design the primers and probes for real-time PCR (26). The specificity of each primer and probe was checked by BLAST search against the NCBI database. The primers and probes for iNAD were designed manually, based on the sequences of the primers and probes for real-time PCR. The primers and probes used in this study are shown in Table 1.

EXTRACTIONS OF RNA AND DNA AND PREPARATION OF STANDARD CONTROLS

Viral RNA was extracted with a QIAamp Viral RNA Kit (Qiagen Inc.), and genomic DNA was extracted with a QIAamp DNA mini kit (Qiagen) according to the manufacturer's instructions.

To prepare SFTS viral RNA transcript controls, fragments containing the target regions of the assays were amplified with primers containing the T7 promoter sequence on the antisense strand. The amplicons were then transcribed in vitro by use of a MEGAscriptT7 Transcription Kit (AmbionLife Technologies). Synthetic RNA transcripts were purified with a MEGAclear Kit (Ambion) and quantified with a Nanodrop spectrophotometer (Thermo Scientific).

Plasmids containing the amplified regions of the M and S segments of SFTSV and the 56-kDa antigen gene of O. tsutsugamushi were generated by ligation into pGEM-T Easy Vector (Promega) and transferred into Escherichia coli JM109. E. coli strains were stored in glycerol at -80 [degrees]C.

TAQMAN PROBE-BASED REAL-TIME PCR

Multiplex real-time RT-PCR assays with Taqman probe to detect SFTSV were performed by use of a LightCycler Multiplex RNA Virus Master (Roche), in 20 [micro]L of reaction mixtures containing 4 [micro]L of 5X master mix, 0.1 [micro]L of 200X enzyme mix, 4 [micro]L primer and probe mix, and 5 [micro]L of extracted RNA or synthetic RNA. The primer and probe mix consisted of 250 nmol/L S segment, M segment, and [beta]-actin primers, 250 nmol/L S segment probe, and 125 nmol/L M segment and [beta]-actin probes. RT-PCR amplification was performed with a LightCycler 96 system (Roche) with the following conditions: reverse transcription at 50 [degrees]C for 10 min, preincubation at 95 [degrees]C for 10 min, followed by 45 cycles of 2-step amplification (95 [degrees]C for 5 s and 56 [degrees]C for 30 s). To generate a calibration curve, serial dilutions from [10.sup.7] to [10.sup.1] copies/[micro]l of synthetic RNA were assayed in 5 independent sets of reactions. To detect O. tsutsugamushi, Taqman probe-based real-time PCR was performed with FastStart Essential DNA Probes Master (Roche) in 20 [micro]L of reaction mixtures containing 10 [micro]L of 2X master mix, 250 nmol/L of ST primers, 100 nmol/L of ST probe, and 5 [micro]L of extracted DNA or control DNA. PCR amplification was performed with use of a LightCycler 96 system (Roche) in the following conditions: preincubation at 95 [degrees]C for 10 min followed by 45 cycles of 2-step amplification (95 [degrees]C for 10 s and 60 [degrees]C for 30 s). A calibration curve for quantification of O. tsutsugamushi was generated with serial dilutions of control DNA from [10.sup.6] to [10.sup.1] copies/[micro]L. All experiments were run in duplicate, and positive and negative controls were included in each assay. The SYBR Green--based real-time PCR method is described in the Methods file in the online Data Supplement.

iNAD

For the iNAD assay, detailed protocols combining silicon microring resonators (SMRs) and recombinase polymerase amplification (RPA) were used (18, 19). The preparation and operation of SMR biosensor are described in the Methods file in the online Data Supplement. The SMR sensor is a refractive index-based optical sensor that changes resonance properties in response to binding between target and ligand; it provides highly sensitive, label-free, real-time detection of biomolecules near the sensor (27, 28). RPA generates a complex of primer and recombinase that extends the DNA and eliminates the need for a nucleic acid polymerase and repetitive cycles (29). Fig. 1 illustrates the iNAD assay designed for clinical detection of bacterial DNA and viral RNA extracted from the plasma of patients with either SFTS or scrub typhus by use of QIAamp DNA and RNA kits, respectively. Following the extraction of DNA or RNA, the target region is amplified by an isothermal-based asymmetric nucleic acid amplification method with use of either RPA for DNA detection (Fig. 1, left) or RPA-RT reagents generating complementary DNA (cDNA) from RNA templates for RNA detection (Fig. 1, right). For the iNAD assay, one primer was grafted covalently to the optical sensor surface and the other primer was in solution, while the temperature was kept constant at 38 [degrees]C (for DNA) or 43 [degrees]C (for RNA). In the case of RNA, RPA-RT components contained a reverse transcriptase to covert RNA templates into DNA. Thus, cDNA was obtained from the viral RNA template with RPA-RT reaction. As a result, the cDNA was hybridized with the immobilized primer on the amine-modified SMR surface, and then the target amplification commenced from the RPA-RT mixture. The amplified targets were detected with the grafted primer on the sensor surface in a label-free and real-time manner (Fig. 1). Subsequently, the iNAD assay detected the RNA-based SFTS and DNA-based O. tsutsugamushi targets in 20 min by measuring resonance wavelength shifts.

STATISTICAL ANALYSIS

The Student t-test and the [chi square] test were used to compare the baseline clinical characteristics of SFTS and scrub typhus patients. The performances of real-time PCR and iNAD were compared by use of the [chi square] test. IBM SPSS statistics for Windows, version 22.0 (IBM Corp.), was used for statistical analysis. Confidence intervals at the 95% level (P [less than or equal to] 0.05) were considered in all cases.

Results

CLINICAL CHARACTERISTICS OF PATIENTS

We prospectively recruited 158 patients with febrile illness from May 2015 to November 2016. Of these patients, 15 (9%) were confirmed with SFTS by real-time RT-PCR and 21 (13%) were diagnosed with scrub typhus by a [greater than or equal to] 1:640 or 4-fold rise in IFA antibody titer. While SFTS was found over the entire warm season between spring and fall, scrub typhus was mainly encountered in the fall (95%, Table 2). Eschars were more common in patients with scrub typhus (16/21) than in patients with SFTS (4/15, P = 0.005). Leukopenia (WBC < 4000/[mm.sup.3]) was more frequent in patients with SFTS (14/15) than in patients with scrub typhus (4/21; P < 0.001), and thrombocytopenia (platelet < 150 X [10.sup.3]/[mm.sup.3]) was also more common in the patients with SFTS (15/15) than in the patients with scrub typhus (15/21; P = 0.03). The detailed demographic data and clinical characteristics are shown in Table 2.

DEVELOPMENT OF TAQMAN PROBE-BASED REAL-TIME PCR AND INAD FOR SFTS AND SCRUB TYPHUS

Calibration curves of Taqman probe-based real-time PCR for SFTSV and O. tsutsugamushi were obtained by plotting Ct values against copy numbers of synthetic transcript RNAs and control DNAs. The amplification plots (Fig. 2 in the online Data Supplement) had excellent linearity (M segment of SFTS, [R.sup.2] = 0.9954; S segment of SFTS, [R.sup.2] = 0.9942; scrub typhus, [R.sup.2] = 0.9995; Fig. 2 left). The detection limit for SFTSV was 10 copies per PCR reaction, and for O. tsutsugamushi was also 10 copies per PCR reaction. The Ct values of the serum samples are shown as dots in Fig. 2, right.

A calibration curve of iNAD for SFTSV was obtained by plotting resonance wavelength shifts (picometer) values against copy numbers of synthetic transcript RNAs or control DNAs. The [R.sup.2] correlation coefficients were 0.9717 for SFTSV and 0.9786 for O. tsutsugamushi (Fig. 3, left). The limit of detection for SFTS was 22 copies per reaction; for scrub typhus, 15 copies per reaction. The limits of detection of iNAD for SFTSV and O. tsutsugamushi were comparable to those of Taqman probe-based real-time PCR. Fig. 3, right, presents the resonance wavelength shifts of all the serum samples analyzed by iNAD.

To compare the limit of detection of iNAD with that of a different type of real-time PCR assay, a SYBR Green--based real-time PCR assay with a single primer pair was conducted (Fig. 3 in the online Data Supplement). The limit of detection for SFTSV was 220 copies per reaction, and the limit of detection for O. tsutsugamushi was 150 copies per reaction.

DIAGNOSTIC PERFORMANCE OF TAQMAN PROBE-BASED REAL-TIME PCR AND iNAD FOR SFTS AND SCRUB TYPHUS

In the acute phase of SFTS, the clinical sensitivities of Taqman probe-based real-time PCR and iNAD were both 100% (95% CI, 75-100). However, when samples obtained from 5 patients during the recovering phase of SFTS were included in the final analysis, the clinical sensitivity of iNAD (100%) for SFTSV was significantly higher than that of Taqman probe-based real-time PCR (75%, P = 0.047, Table 2). However, the clinical specificity of iNAD for SFTSV (86%) was not significantly different than that of Taqman probe-based real-time PCR (95%, P = 0.61). Table 1 in the online Data Supplement shows the detailed results for Taqman probe-based real-time PCR and iNAD for SFTSV- and O. tsutsugamushi-specific primers in the 15 patients with SFTS.

The clinical sensitivity of iNAD for O. tsutsugamushi (100%) was significantly higher than that of Taqman probe-based real-time PCR (67%, P = 0.009, Table 3), while the clinical specificity of iNAD for scrub typhus (90%) was similar to that of Taqman probe-based real-time PCR (95%, P > 0.99, Table 3). Table 2 in the online Data Supplement shows the results of Taqman probe-based real-time PCR and iNAD for SFTSV- and O. tsutsugamushi-specific primers in the 21 patients with scrub typhus.

Discussion

Scrub typhus was mostly prevalent in the fall between September and November (Table 2), which could be explained by the fact that humans are infected with scrub typhus by bites from the larvae of trombiculid mites, which hatch and suck body fluid in the fall (1, 7). Although SFTS was prevalent during the entire hot season, 60% of the SFTS cases in this study occurred between September and November (Table 2). Therefore, the endemic season of SFTS overlaps with that of scrub typhus. Furthermore, the geographical distribution of outdoor activities that carry the risk of exposure to ticks, as well as the resulting clinical manifestations, substantially overlaps for SFTS and scrub typhus (30, 31). Therefore, early differentiation between SFTS and scrub typhus, both of which are transmitted by ticks and can be fatal, remains challenging. We have developed a procedure, named iNAD, for detecting SFTSV and O. tsutsugamushi in sera and have shown that its clinical sensitivities for diagnosing SFTS and scrub typhus are higher than those of Taqman-based real-time PCR, without a significant loss of diagnostic specificity (Table 3).

In this study, the detection limits of the Taqman probe-based real-time PCR assays were slightly higher than those of iNAD. The limits of detection of our real-time PCR assay for SFTS viral RNA and scrub typhus bacterial DNA are consistent with previous reports in which the limits of detection for real-time PCR were 10 copies/[micro]l of viral RNA (16, 17) and 10 copies/reaction for SFTS (14). However, the real-time PCR assays developed in previous studies (14, 16,32) used multiplex primers and probes to improve the analytical sensitivity and specificity of the Taqman probe assay. Our iNAD does not use any probes or multiplex primers, just a single primer pair, and nearly achieved the limits of detection of the Taqman probe-based assay. In addition, the methodological difference between SYBR Green and Taqman probes for real-time PCR must be considered (33). When we conducted SYBR Green--based real-time PCR with a single primer pair, the limit of detection of SFTS was 220 copies per reaction, and that of scrub typhus was 150 copies per reaction (Fig. 3 in the online Data Supplement). This means that the iNAD is more analytically sensitive than SYBR Green--based real-time PCR with use of the same single primer pair, and its analytic sensitivity is comparable to that of Taqman probe-based real-time PCR. Additionally, the present iNAD could reduce costs since it uses a single primer set and no probes.

Both real-time RT-PCR and iNAD had 100% clinical sensitivity in the 15 SFTS sera collected over 1-3 days of hospitalization, whereas real-time RT-PCR gave negative results for the 5 plasma specimens from patients with late disease and iNAD gave positive results. In previous studies, the clinical diagnosis of SFTS had 94%-100% clinical sensitivity (16, 17, 34), but the authors did not include serum samples from the late recovery phase. Given that conventional PCR and real-time PCR have been considered gold standards for the diagnosis of SFTS and yet are not 100% clinically sensitive, iNAD may be useful for diagnosing SFTS patients who have mild presentations, with recent or very low-level viremia.

Previous studies obtained a range of clinical sensitivities for detection of scrub typhus by real-time PCR, depending on the sample type and phase of illness. One study found that the clinical sensitivities of real-time PCR were 50% and 28.6% for whole blood and buffy coat samples, respectively, in the acute phase of scrub typhus ([less than or equal to] 7 days of illness) (15). In contrast, one group reported 65% clinical sensitivity for serum or whole blood samples (35), and other studies achieved 83%-87% sensitivity for buffy coat samples (14, 36). In the present study, the clinical sensitivity of real-time PCR was 67% for plasma, which is within the range of the results of previous studies. However, our data clearly showed that the clinical sensitivity of iNAD (100%) in patients with scrub typhus over the 3rd to 21st day of illness was higher than that of real-time PCR (67%; Table 3 and see Table 2 in the online Data Supplement). Furthermore, iNAD was 5 times more rapid (20 min) than real-time PCR (100 min) because in iNAD the targets are simultaneously amplified and detected without thermal cycling, in a label-free and real-time manner. Therefore, iNAD can be used to detect very low amounts of DNA in the plasma of patients with scrub typhus and thus to rapidly rule out a diagnosis of that disease.

Although the iNAD had greater clinical sensitivities for detecting SFTS and scrub typhus, some factors still need to be improved. The specificity of iNAD appeared to be somewhat lower than that of Taqman probe-based real-time PCR, although the difference was not statistically significant. In addition, quantitative analysis by iNAD has not yet been validated. Thus, iNAD needs to be optimized on the basis of a larger cohort to improve it technically in terms of specificity and quantification of viral or bacterial loads in various clinical samples.

In conclusion, the iNAD method detects SFTSV and O. tsutsugamushi in plasma more rapidly and sensitively than real-time PCR. Thus, this new bio-optical sensor detection method may be useful for differentiating SFTS from scrub typhus in patients with suspected tick-borne disease.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.

Employment or Leadership: None declared.

Consultant or Advisory Role: None declared.

Stock Ownership: None declared.

Honoraria: None declared.

Research Funding: Grant from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant no. HI16C0272).

Expert Testimony: None declared.

Patents: None declared.

Role of Sponsor: The funding organizations played no role in the design of study, choice of enrolled patients, review and interpretation of data, or final approval of manuscript.

References

(1.) Seong SY, Choi MS, Kim IS. Orientia tsutsugamushi infection: overview and immune responses. Microbes Infect 2001;3:11-21.

(2.) Yun Y, Heo ST, Kim G, Hewson R, Kim H, Park D, et al. Phylogenetic analysis of severe fever with thrombocytopenia syndrome virus in South Korea and migratory bird routes between China, South Korea, and Japan. Am J Trop Med Hyg 2015;93:468-74.

(3.) Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, et al. Fever with thrombocytopenia associated with a novel bunyavirus in China. N EnglJ Med 2011;364:1523-32.

(4.) Kim KH, Yi J, Kim G, Choi SJ, Jun KI, Kim NH, et al. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg Infect Dis 2013;19:1892-94.

(5.) Takahashi T, Maeda K, Suzuki T, Ishido A, Shigeoka T, Tominaga T, et al. The first identification and retrospective study of Severe Fever with Thrombocytopenia Syndrome in Japan. J Infect Dis 2014;209:816-27.

(6.) Liu S, Chai C, Wang C, Am S, Lv H, He H, et al. Systematic review of severe fever with thrombocytopenia syndrome: virology, epidemiology, and clinical characteristics. Rev Med Virol 2014;27:90 -102.

(7.) Korea Centers for Disease Control and Prevention (KCDC). Disease information, SFTS.http://cdc.go.kr/CDC/health/ CdcKrHealth0101.jsp?menuIds=HOME001-MNU1132MNU1147-MNU0746-MNU2423&fid = 7956&cid = 70361 (Accessed November2016).

(8.) Tamura A, Ohashi N, Urakami H, Miyamura S. Classification of Rickettsia tsutsugamushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov. Int J Syst Bacteriol 1995;45:589-91.

(9.) Watt G, Parola P. Scrub typhus and tropical rickettsioses. Curr Opin Infect Dis 2003;16:429-36.

(10.) Kim WY, Choi W, Park SW, Wang EB, Lee WJ, Jee Y, et al. Nosocomial transmission of severe fever with thrombocytopenia syndrome in Korea. Clin Infect Dis 2015;60:1681-83.

(11.) Blacksell SD, Bryant NJ, Paris DH, Doust JA, Sakoda Y, Day NP. Scrub typhus serologic testing with the indirect immunofluorescence method as a diagnostic gold standard: a lack of consensus leads to a lot of confusion. Clin Infect Dis 2001;44:391-400.

(12.) La Scola B, Raoult D. Laboratory diagnosis of rickettsioses: current approaches to diagnosis of old and new rickettsial diseases. J Clin Microbiol 1997;35: 2715-27.

(13.) Paris DH, Aukkanit N, Jenjaroen K, Blacksell SD, Day NP. A highly sensitive quantitative real-time PCR assay based on the groEL gene of contemporary Thai strains of Orientia tsutsugamushi. Clin Microbiol Infect 2009; 15:488-95.

(14.) Tantibhedhyangkul W, Wongsawat E, Silpasakorn S, Waywa D, Saenyasiri N, Suesuay J, et al. Use of multiplex real-time PCR to diagnose scrub typhus. J Clin Microbiol 2017;55:1377-87.

(15.) Watthanaworawit W, Turner P, Turner C, Tanganuchitcharnchai A, Richards AL, Bourzac KM, et al. A prospective evaluation of real-time PCR assays for the detection of Orientiatsutsugamushi and Rickettsia spp. for early diagnosis of rickettsial infections during the acute phase of undifferentiated febrile illness. Am J Trop Med Hyg 2013;98:308-10.

(16.) Sun Y, Liang M, Qu J, Jin C, Zhang Q, Li J, et al. Early diagnosis of novel SFTS bunyavirus infection by quantitative real-time RT-PCR assay. J Clin Virol 2012;53: 48-53.

(17.) Li Z, Qi X, Zhou M, Bao C, Hu J, Wu B, et al. A two-tube multiplex real-time RT-PCR assay for the detection of four hemorrhagic fever viruses: severe fever with thrombocytopenia syndrome virus, Hantaan virus, Seoul virus, and dengue virus. Arch Virol 2013;158: 1857-63.

(18.) Shin Y, Perera AP, Kim KW, Park MK. Real-time, label-free isothermal solid-phase amplification/detection (ISAD)device for rapid detection of genetic alteration in cancers. Lab Chip 2013;13:2106 -14.

(19.) Koo B, Jin CE, Lee TY, Lee JH, Park MK, Sung H, et al. An isothermal, label-free, and rapid one-step RNA amplification/detection assay for diagnosis of respiratory viral infections. Biosens Bioelectron 2017;90: 187-94.

(20.) Kim DM, Lee YM, Back JH, Yang TY, Lee JH, Song HJ, et al. A serosurvey of Orientia tsutsugamushi from patients with scrub typhus. Clin Microbiol Infect 2010;16: 447-51.

(21.) Seong SY, Huh MS, Jang WJ, Park SG, Kim JG, Woo SG, et al. Induction of homologous immune response to Rickettsia tsutsugamushi Boryong with a partial 56-kilodalton recombinant antigen fused with the maltose-binding protein MBP-Bor 56. Infect Immun 1997;65:1541-1545.

(22.) Blacksell SD, Luksameetanasan R, Kalambaheti T, Aukkanit N, Paris DH, McGready R, et al. Genetic typing of the 56-kDa type-specific antigen gene of contemporary Orientiatsutsugamushi isolates causing human scrub typhus at two sites in north-eastern and western Thailand. FEMS Immunol Med Microbiol 2008;52:335-42.

(23.) Bakshi D, Singhal P, Mahajan SK, Subramaniam P, Tuteja U, Batra HV. Development of a real-time PCR assay for the diagnosis of scrub typhus cases in India and evidence of the prevalence of new genotype of O. tsutsugamushi. Acta Trop 2007;104:63-71.

(24.) Furuya Y, Yoshida Y, Katayama T, Yamamoto S, Kawamura A. Serotype-specific amplification of Rickettsia tsutsugamushi DNA by nested polymerase chain reaction. J Clin Microbiol 1993;31:1637-40.

(25.) Kyoto University Bioinformatics Center. Multiple sequence alignment by Clustal W. http://www.genome.jp/ tools/clustalw/(Accessed October 2017).

(26.) Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3-new capabilities and interfaces. Nucleic Acids Res 2012;40:e115.

(27.) Iqbal M, Gleeson MA, Spaugh B, Tybor F, Gunn WG, Hochberg M, et al. Label-free biosensor arrays based on silicon ring resonators and high-speed optical scanning instrumentation. IEEE J Sel Top Quantum Electron 2010;16:6654-61.

(28.) Bogaerts W, De Heyn P, Van Vaerenbergh T, DeVos K, Kumar Selvaraja S, Claes T, et al. Silicon microring resonators. Laser Photonics Rev 2012;6:47-73.

(29.) Piepenburg O, Williams CH, Stemple DL, Armes. NA DNA detection using recombination proteins. PLoS Biol 2006;4:e204.

(30.) Choi SY, Park SW, Bae IG, Kim SH, Ryu SY, Kim HA, et al; for Korea SFTS Clinical Network. Severe fever with thrombocytopenia syndrome in South Korea, 2013-2015. PLoS Negl Trop Dis 2016;10:e0005264.

(31.) Jeung YS, Kim CM, Yun NR, Kim SW, Han MA, Kim DM. Effect of latitude and seasonal variation on scrub typhus, South Korea, 2001-2013. Am J Trop Med Hyg 2016;94:22-5.

(32.) Yoshikawa T, Fukushi S, Tani H, Fukuma A, Taniguchi S, Toda S, et al. Sensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load. J Clin Microbiol 2014;52:3325-33.

(33.) Zhou X, Zhang T, Song D, Huang T, Peng Q, Chen Y, et al. Comparison and evaluation of conventional RTPCR, SYBR Green I and TaqMan real-time RT-PCR assays for the detection of porcine epidemic diarrhea virus. Mol Cell Probes 2017;33:36-41.

(34.) Cui L, GeY, Qi X, Xu G, Li H, Zhao K, et al. Detection of severe fever with thrombocytopenia syndrome virus by reverse transcription-cross-priming amplification coupled with vertical flow visualization. J Clin Microbiol 2012;50:3881-5.

(35.) Kramme S, An V, Khoa ND, Trin V, Tannich E, Rybniker J, et al. Panning, Orientia tsutsugamushi bacteremia and cytokine levels in Vietnamese scrub typhus patients. J Clin Microbiol 2009;47:586-9.

(36.) Kim DM, Park G, Kim HS, Lee JY, Neupane GP, Graves S, Stenos J. Comparison of conventional, nested, and real-time quantitative PCR for diagnosis of scrub typhus. J Clin Microbiol 2011;49:607-12.

Ji Yeun Kim, [1] ([dagger]) Bonhan Koo, [2] ([dagger]) Choong Eun Jin, [2] Min Chul Kim, [1] Yong Pil Chong, [1] Sang-Oh Lee, [1] Sang-Ho Choi, [1] Yang Soo Kim, [1] Jun Hee Woo, [1] Yong Shin, [2] * and Sung-Han Kim [1] *

[1] Departments of Infectious Diseases, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Republic of Korea; [2] Convergence Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Republic of Korea.

* Address correspondence to: S.-H.K. at Department of Infectious Diseases, Asan Medical Center, University of Ulsan Collegeof Medicine, 88 Olympic-ro-43-gil, Songpa-gu, Seoul, 05505, South Korea. Fax 2-3010-6970; e-mail kimsunghanmd@hotmail.com; or Y. S. at Department of Convergence Medicine, Asan Medical Center, University of Ulsan College of Medicine, 88 Olympic-ro-43-gil, Songpa-gu, Seoul, 05505, South Korea. Fax 2-3010-4193; e-mailshinyongno1@gmail.com. ([dagger]) These authors equally contributed to the work.

Received July 31,2017; accepted October 30,2017.

Previously published online at DOI: 10.1373/clinchem.2017.280230

[3] Nonstandard abbreviations: SFTS, severe fever with thrombocytopenia syndrome; SFTSV, SFTS virus; IFA, immunofluorescence assays; RT, reverse transcription; iNAD, isothermal nucleic acid amplification procedure with bio-optical sensor detection; SMR, silicon microring resonator; RPA, recombinase polymerase amplification; cDNA, complementary DNA.

Caption: Fig. 1. Schematic representation of the principle of one-step isothermal nucleic acid amplification with bio-optical sensor detection (iNAD).

The iNAD chip consisted of a sensor microring and reference microring. Each microring had a dedicated output waveguide (grating couplers). To operate the iNAD, the forward primers were immobilized on the iNAD chip (#1). Then, a mixture of RPA and the reverse primer was added to the chip to detect DNA (left) or RNA (right). For RNA amplification and detection (right), the complimentary DNA(cDNA) was synthesized from the RNA during the reaction (#2-1). This cDNA recognizes the immobilized forward primer on the chip surface, and the wavelength shift (#4-1)due to formation of a duplex of the cDNA and primer (#3-1) is measured in a label-free and real-time manner. For DNA amplification and detection (left), the target DNA recognizes the immobilized forward primer on the chip surface. A duplex is formed between the cDNA and primer (#2) and the resulting wavelength shift (#3) is measured in a label-free and real-time manner.

Caption: Fig. 2. Standard curves of real-time PCR and dot plots of the cycle thresholds of all serum samples.

The graphs on the left are standard curves for the SFTSV M segment (A), the SFTSVS segment (B), and scrub typhus (C) generated by linear regression plots of the cycle threshold values and in vitro synthetic SFTSV RNA or control O. tsutsugamushi DNA. Right figures are dot plots that represent the cycle threshold values of the serum samples. Circles represent the SFTS samples and diamonds represent the scrub typhus samples. Colors represent positive (blue) and negative (red) samples.

Caption: Fig. 3. Standard curves for iNAD and dot plots of resonant wavelength shifts for each serum sample.

Left figures are standard curves of SFTSV S segment (A) and O. tsutsugamushi (B) generated from linear regression plots of resonance wavelength shifts and in vitro synthetic SFTSV RNA or control O. tsutsugamushi DNA. Right figures are dot plots of the resonance wavelength shifts of each serum sample. Circles represent SFTS samples and diamonds represent scrub typhus samples. Colors represent positive (blue) and negative (red) samples of SFTS and scrub typhus.
Table 1. Primer and probe sequences used.

            Name
Assay   (accession #)    Start               Sequence

Real-   SFTS SF          116     CGAGAGAGCTGGCCTATGAA
time    (NC018137)
PCR     SFTS SR          263     TTCCCTGATGCCTTGACGAT
        SFTS SP          216     TGTCTTTGCCCTGACTCGAGGCA
        SFTS MF          316     ATGCTTGTCGTGAAGAAGGC
        (NC018138)
        SFTS MR          446     CTAGACTTCCCACTGCCACA
        SFTS MP          400     ACTTTTGATGGATACGTAGGCTGGGGC
        ACBT F           1670    ACTAACACTGGCTCGTGTGA
        (NC000007.14)
        ACBTR            1774    CTTGGGATGGGGAGTCTGTT
        ACBT P           1700    AGGCTGGTGTAAAGCGGCCTTGG
        STF (KJ742368)   781     GCAGCAGCTGTTAGGCTTTT
        STR              919     TTGCAGTCACCTTCACCTTG
        STP              850     CAGCGTCATGCAGGAATTAGGAAAGCCA
iNAD    iNAD-SFTS F      544     GGAGGCCTACTCTCTGTGGCAAGATGCCTTCA
        (NC018137)
        iNAD-SFTS R      675     GGCCTTCAGCCACTTTACCCGAACATCATTGG
        iNAD-ST F        778     GCAGCAGCAGCTGTTAGGCTTTTAAATGGCAATG
        (KJ742368)
        iNAD-ST R        911     GCTGCTTGCAGTCACCTTCACCTTGATTCTTTG

            Name
Assay   (accession #)      Modification

Real-   SFTS SF
time    (NC018137)
PCR     SFTS SR
        SFTS SP           5' FAM, 3' BHQ1
        SFTS MF
        (NC018138)
        SFTS MR
        SFTS MP           5'Cy5, 3' BHQ2
        ACBT F
        (NC000007.14)
        ACBTR
        ACBT P            5' HEX, 3'BHQ1
        STF (KJ742368)
        STR
        STP                5'FAM, 3'BHQ1
iNAD    iNAD-SFTS F          5' AmMC12
        (NC018137)
        iNAD-SFTS R
        iNAD-ST F            5' AmMC12
        (KJ742368)
        iNAD-ST R

Table 2. Baseline clinical characteristics of 15 patients
with severe fever with thrombocytopenia syndrome (SFTF) and
21 patients with scrub typhus.

                                            Scrub typhus
                            SFTS (n = 15)      (n = 21)      P value

Age, years,                 61 [+ or -] 7   67 [+ or -] 14    0.13
  mean [+ or -] SD
Male sex                         10               10          0.26
Season (months)
  Spring-Summer                   6               1           0.01
  (March-August)
  Fall (September-                9               20
  November)
Eschar                            4               16          0.005
Clinical characteristics
  Fever                          15               21          >0.99
  Skin rash                       1               14         <0.001
  Headache                        7               6           0.27
  Altered mental status           8               2           0.007
Underlying disease
  Previous healthy                4               12          0.07
  Diabetes                        3               5           >0.99
  Solid tumor                     0               2           0.50
  Chronic liver disease           0               2           0.50
  Chronic kidney disease          0               1           >0.99
Immunosuppressive                 0               5           0.06
  condition (a)
Leukocytosis (WBC >               0               6           0.03
  10000/[mm.sup.3])
Leukopenia (WBC <                14               4          <0.001
  4000/[mm.sup.3])
Thrombocytopenia                 15               15          0.03
  (Platelet < 150 x
  [10.sup.3]/[mm.sup.3])
Clinical course
  ICU admission                   6               2           0.04
  In-hospital mortality           1               0           0.42
Treatment
  Doxycycline                    11               21          0.06
  Ribavirin                      10               1          <0.001

SFTS, severe fever with thrombocytopenia syndrome; WBC,
white blood cell.

Data are number of patients unless otherwise indicated.

(a) Defined as patients with underlying diseases, such as
malignancy, liver cirrhosis, chronic renal failure, and
patients receiving immunosuppressive treatment.

Table 3. The diagnostic performance of real-time PCRand iNAD
with use of SFTSV- and O. tsutsugamushi-specific primers in the
15 (a) patients with SFTS and 21 patients with scrub typhus.

                           SFTSV-specific primer

                         SFTS         Scrub typhus
                        (n = 20)         (n = 21)

Real-time PCR
  Positive (n)             15               1
  Negative (n)             5 (a)            20
  Sensitivity (%)    75 (51-91) (b)
  Specificity (%)    95 (77-99) (c)
iNAD
  Positive (n)             20               3
  Negative (n)             0                18
  Sensitivity (%)   100 (83-100) (b)
  Specificity (%)    86 (65-97) (c)

                        O. tsutsugamushi-
                        specific primer

                     Scrub typhus       SFTS
                        (n = 21)      (n = 20)

Real-time PCR
  Positive (n)             14             1
  Negative (n)             7             19
  Sensitivity (%)    67 (43-85) (d)
  Specificity (%)   95 (73-100) (e)
iNAD
  Positive (n)             21             2
  Negative (n)             0             18
  Sensitivity (%)   100 (81-100) (d)
  Specificity (%)    90 (67-98) (e)

Clinical sensitivity and specificity are presented as
percentage (%) and 95% confidence interval (95% CI).

(a) Five additional plasma samples from the 15 patients with
SFTS, taken on the day of the first negative results for
real-time PCR for SFTS, were included in this analysis.

(b) P = 0.047 for the difference in sensitivity for SFTS
between real-time PCR and iNAD.

(c) P = 0.61 for the difference in specificity for SFTS
between real-time PCR and iNAD.

(d) P = 0.009 for the difference in sensitivity for scrub
typhus between real-time PCR and iNAD.

(e) P > 0.99 for the difference in specificity for scrub
typhus between real-time PCR and iNAD.
COPYRIGHT 2018 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Kim, Ji Yeun; Koo, Bonhan; Jin, Choong Eun; Kim, Min Chul; Chong, Yong Pil; Lee, Sang-Oh; Choi, Sang
Publication:Clinical Chemistry
Date:Mar 1, 2018
Words:6066
Previous Article:Digital PCR: A Sensitive and Precise Method for KIT D816V Quantification in Mastocytosis.
Next Article:Leukocyte Counts Based on DNA Methylation at Individual Cytosines.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters