Printer Friendly

Rapid, specific and sensitive coliforms/Escherichia coli detection in water samples through selectively pre enriching and an octaplex PCR.

Introduction

WHO and United States federal regulations state that public water systems must conduct analyses for Escherichia coli for any routine drinking water sample that is positive for total coliform bacteria [12]. Since confirming Escherichia coli as a suitable marker of water hygiene [29], the microbiologists tried to find a rapid, sensitive and specific method of detecting such bacterium in water. Alike other developments, bacterial detection methods are developing through the time, it means the first methods were biochemical (enzymatic) while nowadays that's the molecular (genetic) ones which override others. In biochemical assays the enzyme activity is tested and in molecular assays the genome is the sole target and not the activity, however both of them (molecular and biochemical) imparts advantages and disadvantages. For example microorganisms in VBNC phase can't be cultured and a perished cell or a single genome in water may lead to fake positive result in molecular approaches [20,9].

Biochemically, the most common feature of coliforms/Escherichia coli used in detection methods is the ability of these bacteria to ferment lactose and producing gas and acid [4]. owever we should consider some Escherichia coli strains especially pathogen ones are out of lactose fermenting capability or may be slow fermenter and some other bacteria such as some Shigella sonnei strains are lactose slow fermenter [13]. Considering the advantages and disadvantages of the mentioned approaches, we found best to join the advantages of both biochemical and molecular approaches to detect coliforms/Escherichia coli rapidly, specifically and sensitively.

Since in most of the cases especially in treated water, number of coliforms/Escherichia coli are not high enough to be detected through molecular methods, it is necessary to pre enrich the water samples to increase the number of the cells and subsequently perform molecular approaches to trace specific coliforms/Escherichia coli genes [3]. Because of the great similarity between the DNA sequence of Escherichia coli and Shigella [24], these bacteria share high percentage of genes and so it is necessary to screen Shigella. In current study we developed an enriching and selective culture medium to multiply coliforms/Escherichia coli and screen Shigella strains. Inhibiting gram positive and non microflora bacteria, carbon and energy source of this culture medium is metabolized by (most of) Escherichia coli and not by (most of) Shigella, hence ensures screening of Shigella strains. After being enriched and multiplied, DNA of the biomass is extracted and introduced into multiplex PCR to trace simultaneously 7 specific genes of coliforms/Escherichia coli.

Single detection of any gene (single PCR) may lead to wrong detection of the target bacteria, so we looked for the best marker genes of E. coli in different surveys and developed a novel octaplex PCR by which we were able to detect the following genes: uidA, tnaA, gadAB, cadA, phoE, lacZ, lamB and mdh. uidA encodes for <beta>-glucuronidase by which the transformation of 4-methylumbelliferyl-b-D-glucuronide (MUG) to the fluorogenic 4-methylumbelliferone is catalyzed [22]. This enzyme is ubiquitous in most of Escherichia coli strains however some Shigella strains also carry this gene. Tryptophanase operon (tnaOP) is a region consisting of two major structural genes: tnaA, coding for the tryptophanase which catalyzes the degradation of L-tryptophan to indole, pyruvate, and ammonia and tnaB coding for a tryptophan permease. This operon enables the bacterium to metabolize L-tryptophan as a source of nitrogen [8]. gadA/B encodes for glutamate decarboxylase. This enzyme catalyzes the a-decarboxylation of L-glutamic acid to yield [gamma]-aminobutyric acid (GABA) and carbon dioxide [4]. In Escherichia coli and some other coliforms, lysine decarboxylase is encoded by cadA which participates in the decarboxylation of lysine and synthesis of cadaverine [30]. Producing alkaline GABA and cadaverine, both glutamate decarboxylase and lysine decarboxylase enzymes have strategic role in neutralizing acidic condition. lacZ is one of the lac operon genes encoding for <beta>-galactosidase by which lactose is hydrolysed. This enzyme is a diagnostic feature of coliforms [28]. mdh is the gene responsible for malate dehydrogenase enzyme, an important TCA constituents. Malate dehydrogenase oxidizes malate to form oxaloacetate [15]. phoE encodes for an outer membrane porin protein, which forms three separate channels that traverse the width of the membrane [2]. PhoE is an Anion-selective diffusion channels induced under phosphate limitation and finally the 16S rRNA gene [17]. is a highly conserved sequence in Escherichia coli, however is not so much specific because it may be present in some Shigella strains.

Material And Methods

Selectively enriching the coliforms/Escherichia coli:

To enrich coliforms/Escherichia coli selectively and screen the Shigella strains, we developed a medium which the ingredients and the corresponding roles are as follow: peptone from casein and soymeal provides amino acids and other nitrogenous substances making it a nutritious medium. Sodium chloride maintains the osmotic equilibrium, while dipotassium hydrogen phosphate and potassium dihydrogen phosphate act as buffers to maintain pH. Sodium deoxycholate inhibit gram positive and non flora microorganisms. Since xylose is the carbon and energy source and most of Shigella strains can't metabolize it, this medium can selectively and differentially enrich coliforms and coliforms/Escherichia coli as we found experimentally. To prepare this medium, the substances listed in Table 1 should be added to 1 liter deionized water, dissolved and autoclaved (15 min at 121 [degrees]C). It is noteworthy that we tried different weights of the ingredients and checked the OD of growth so that finally optimized it as shown in Table 1.

To enrich the water samples, 100 ml of sampled water was inoculated into 100 ml, 2x mentioned enriching broth (total volume of 200 ml) and incubated at 35-37[degrees]C.

Specificity and sensitivity of Coliforms/Escherichia coli selective enriching broth:

To determine the specificity of this medium, we used some standard strains listed in Table 4. These standard strains were obtained from Iranian Research Organization for Science and Technology (IROST), Reference Laboratories of Iran in Ministry of Health and Pasteur Institute of Iran.

Incubation time determination:

To optimize the incubation period and simultaneously caring for the stringency and limitation of time, we determined the McFarland turbidity of the inoculated samples hour by hour. To do so, we used HACH DR/4000 U Spectrophotometer, 115 Vac, applying 4 different McFarland turbidity unit including 0.5, 1, 2, 3 and 4, at 600 nm wavelength.

To prepare McFarland turbidity unit, according to described and confirmed procedures, different ratio of Sulfuric acid, 1 % (vol/vol) ([H.sub.2]S[O.sub.4]) and anhydrous Barium Chloride, 1% (wt/vol) (Ba[Cl.sub.2]) were mixed.

DNA extraction:

Following incubation at 35-37[degrees]C for 15 hours, 190 ml, inoculated water was aliquoted into 4, 50 ml falcon conical centrifuge tubes, and centrifuged at 1006 x g for 15 min. The supernatant was discarded and the cells were suspended in 5 ml PBS. Vortexing the falcon tubes, the biomass of falcon tubes were transferred into 1 falcon tube and concentrated at 1006 x g for 15 min once again. Discarding the Supernatant and following biomass concentration, using AccuPrep[R] Genomic DNA Extraction Kit, DNA was extracted. To ensure the efficiency and suitability, we evaluated 5[micro]l of the extracted DNA by electrophoresis on 1.5% agarose gel in 1x TAE buffer. To evaluate the quality and quantity of the DNA, following 1/200 dilution, we determined the absorbance at 260 nm ([A.sub.260] for DNA) and 280 nm ([A.sub.280] for protein) wavelengths.

PCR condition:

To detect '6S rRNA [17], mdh [9], phoE [2], gadA/B [21], lacZ [5], uidA ([22], cadA and tnaA (Camilla et al., 2007) genes, we applied specific primers listed in Table 2 which all were introduced by investigators.

The gene amplification protocol was performed in reaction mixture at a final volume of 25 [micro]l containing 12.5 [micro]l, 2x QIAGEN Multiplex PCR Master Mix (containing HotStarTaq[R] DNA polymerase, Multiplex PCR Buffer, dNTP Mix), in addition to 2 [micro]l template DNA and specific pmol of each pair of primers, listed in Table 3.

The optimized thermocycling procedure was performed in ABI verity 96 well thermal cycler with an initial denaturation step of 15 min at 95[degrees]C followed by 35 cycles of 94[degrees]C for 30 s, annealing at 60[degrees]C for 90 s and 72[degrees]C for 90 s, and final extension at 72[degrees]C for 8 min.

Simultaneous amplification of all 8 target genes was performed by comparing presence, intensities and (non)specificity of bands applying different annealing temperature such as 59 [degrees]C, 59.5 [degrees]C 60 [degrees]C, 60.5 [degrees]C, 61 [degrees]C, [degrees] and 61.5 [degrees]C and we found experimentally, 60 [degrees]C, the best for annealing since we could visualize 8 distinct and sharp bands.

5 [micro]l of PCR products were electrophoresed on 1.5 % agarose gel, stained with SYBR green, and visualized by a Gel Doc[TM] XR+ system (Image Lab[TM] 4.0). The gel separated PCR amplicons are shown in Fig 1.

Octaplex PCR sensitivity determination:

To assess the sensitivity of current octaplex PCR assay, a 24 hour incubated Escherichia coli ATCC 25922 in lauryl sulphate broth and Shigella flexneri PTCC 1234 in GN enrichment broth were suspended in 0.1% sterile peptone water. Using HACH DR/4000 U Spectrophotometer, they were adjusted to McFarland standard of 1 (equivalent to 3 x [10.sup.8] CFU/ml) separately. A serial 10 fold dilution with 0.1% sterile peptone water was performed for 7 consecutive concentration ranges from 3 x [10.sup.7] to 3 x [10.sup.1] CFU/ml. Applying the same protocol described above, DNA was extracted from these samples and subjected to single PCR and subsequently the lower detection limits of the 10 target genes by octaplex PCR were evaluated.

Comparison between the introduced approach and the standard method to verify the efficiency:

To validate the efficiency, we tested all the samples simultaneously both by standard method (9221 D. Presence-Absence Coliforms Test) and the current introduced approach. To do so, after inoculation 100 ml water into 100 ml, 2x enriching medium and incubation for 15 h, we submitted 190 ml for DNA extraction but prolonged the incubation for 24 h for the 10 ml remained of the inoculated water and assumed it as presumptive phase. We considered xylose fermenters (acid producers) as positive and submitted the presumptive tubes into BGBL broth (to detect total coliforms as confirmed phase) and EC broth (to detect thermotolerant coliforms as completed phase).

Results:

Results for the standard strains:

Inoculating the listed standard strains and the results gained, we found such medium would be a reliable selective enriching broth for coliforms/Escherichia coli (Table 4). Determining the McFarland turbidity of inoculated samples hourly, as shown in Fig 1, we found, 15 hours incubation is long enough to multiply the coliforms/Escherichia coli to extract DNA efficiently. To check the recovery and growth of the target microorganisms and also to check the specificity of the introduced medium, we inoculated the standard strains listed in Table 4 and checked the growth status (turbidity) every 15 hours.

At the first 15 hours, coliforms/Escherichia coli showed notable turbidity however continuing the incubation period for 24 hours, some Shigella and Salmonella grew and could increase the turbidity.

Following inoculation, incubation, DNA extraction and gene amplification, we gained results listed in Table 5.

Results for environmental samples:

In this study we included water samples from different sources of Alborz province water supplies e.g., deep wells, surface and treated (chlorinated) and private (unknown) sources, during a period of 1 year (from February 2011 to March 2012). Total number of samples tested in current study through both standard method and current approach was 5235 of which 5025 samples were negative for both methods. Genetically (octaplex PCR), 280 were positive for total coliforms (containing lacZ and cadA) of which 130 were positive for Escherichia coli. Biochemically, of 5235 environmental samples, 210 were positive for total coliforms (confirmed phase) and just 67 for thermotolerant coliforms. It is necessary to mention that all environmental samples were collected from different sources and were tested just once.

Discussion:

Results gained in this study showed genetical approaches are much more accurate, rapid, sensitive and specific rather than the biochemical ones. However biochemical methods, mostly based on lactose fermentation, are more emphasized by Standard Methods for the Examination of Water and Wastewater, 21st edition. Regarding the results of study, of 280 samples genetically positive for total coliforms, 210 samples were biochemically positive for total coliforms (75%), while 70 of which were negative biochemically, It means biochemical methods lost 70 samples imparting coliforms. Of 130 samples containing Escherichia coli genes, just 67 ones could be detected biochemically (51.53%) which indicates unreliability of biochemical methods. As we found experimentally, in

some cases Escherichia coli present in water sample could grow in BGBL but not in EC medium as we found it through striking BGBL positive on EMB agar and isolating the Escherichia coli colonies. In some other cases we found Escherichia coli in consortia of other coliforms can't grow in EC medium but if isolated and inoculated, it would [26].

By the way, being time consuming and laborious, these are the most significant disadvantages of biochemical methods. As suggested by standard methods, a typical biochemical method of total, thermotolerant and Escherichia coli detection from water samples my last for 4 days while applying the current method would not last more than 24 hours.

The results of the current investigation indicate that genotypic assays should provide superior confirmational detection of E. coli in drinking water samples compared with the corresponding phenotypic assays or standard methods for lactose fermentation [19].

In contrast to the phenotypic assays, the choice of the phoE, mdh, 16S rRNA, gadAB, lacZ, uidA, cadA, tnaOP genes as a target for such genotypic assays may be relatively unimportant, but the use of all targets (in a multiplex PCR) could further increase the specificity and detect the widest range of E. coli strains possible.

In conclusion, the use of PCR and gene probes permits both the specificity and sensitivity necessary for monitoring coliforms/Escherichia as indicators of human fecal contamination of waters.

With some simplification and optimization of the DNA extraction and primer designing, PCR-based methods can permit a rapid and reliable means of assessing the bacteriological safety of waters and should provide an effective alternative methodology to conventional viable culture methods. PCR-based methods may also permit sufficient sensitivity and specificity for the direct detection of pathogens in environmental samples, rather than the current practice of relying on the indirect detection of indicator organisms [5].

Applying the current approach, not only we can detect coliforms/Escherichia coli but also we can perform analytical surveys to find the best genes for molecular detection of coliforms/Escherichia.

Acknowledgements

This study was completely funded and supported by Alborz province water and waste water Quality Control Office.

References

[1.] Andree, F., H. Vicky, B. Maurice, J. Francois, B. Luc, T. Jean, Michel, Bergeron, 2008. Analytical limits of four [beta]-glucuronidase and [beta]-galactosidase-based commercial culture methods used to detect Escherichia coli and total coliforms. Journal of Microbiological Methods., 75: 506-514.

[2.] Andree, F., H. Vicky, B. Maurice, J. Francois, B. Luc, T. Jean, Michel, Bergeron, 2009. Analytical comparison of nine PCR primer sets. Designed to detect the presence of Escherichia coli/Shigella in water samples. Waterresearch, 43: 3019-3028.

[3.] Andre'e, F., B. Luc, B. Maurice, T. Jean-Luc, V. Bernier, o. Franc, B. Eve, G. Michel, 2011. Rapid Concentration and Molecular Enrichment Approach for Sensitive Detection of Escherichia coli and Shigella Species in Potable Water Samples. Applied and Environmental Microbiology, pp: 6199-6207.

[4.] APHA/AWWA/WEF, 2005. Standard Methods for the Examination of Water and Wastewater, 21st ed. American Public Health Association/American Water Works Association/Water Environment Federation, Washington, DC.

[5.] Bej, A.K., J.L. DiCesare, L. Haff, R.M. Atlas, 1991a. Detection of Escherichia coli and Shigella spp. in water by using the polymerase chain reaction and gene probes for uid. Applied and Environmental Microbiology, 56(2): 307-314.

[6.] Bernasconi, C., G. Volponi, L. Bonadonna, 2006. Comparison of three different media for the detection of Escherichia coli and coliforms in water. Water Sci. Technol., 54: 141-145.

[7.] Brenner, K.P., C.C. Rankin, Y.R. Roybal, G.N. Stelma Jr., P.V. Scarpino, A.P. Dufour, 1993. New medium for the simultaneous detection of total coliforms and Escherichia coli in water. Appl. Environ. Microbiol., 59: 3534-3544.

[8.] Camilla, B., V. Giorgio, P. Claudia, F. Roberto, 2007. Use of the tna Operon as a New Molecular Target for Escherichia coli Detection. Applied and Environmental Microbiology, pp: 6321-6325.

[9.] Cihan, D., O. Resit, I. Onder, P. Ken, 2009. Viable But Non-Culturable State (VBNC) Of Escherichia Coli Related To Envz Under The Effect Of Ph, Starvation And Osmotic Stress In Sea Water. Polish Journal of Microbiology, 58(4): 307-317.

[10.] Eckner, K.F., 1998. Comparison of membrane filtration and multiple-tube fermentation by the Colilert and Enterolert methods for detection of waterborne coliform bacteria, Escherichia coli, and enterococci used in drinking and bathing water quality monitoring in southern Sweden. Appl. Environ. Microbiol., 64: 3079-3083.

[11.] Feng, P.C., P.A. Hartman, 1982. Fluorogenic assays for immediate confirmation of Escherichia coli. Appl. Environ. Microbiol., 43: 1320-1329.

[12.] Federal Register, 1989. Drinking water: national primary drinking water regulations. Fed. Register., 54: 27544-27568.

[13.] Hideo, I., K. Nobuo, A. Yoshichika, Michio, S. Tsuyoshi, K. Nobuo, 1991. Possible Mechanisms Underlying The Slow Lactose Fermentation Phenotype In Shigella Spp. Applied And Environmental Microbiology, pp: 2912-2917.

[14.] Horakova, K., H. Mlejnkova, P. Mlejnek, 2008. Specific detection of Escherichia coli isolated from water samples using polymerase chain reaction targeting four genes: cytochrome bd complex, lactose permease, beta-D-glucuronidase, and beta-D-galactosidase. Journal of Applied Microbiology, 105(4): 970-976.

[15.] Hsu, S.C., and H.Y. Tsen, 2001. PCR primers designed from malic acid dehydrogenases gene and their use for detection of Escherichia coli in water and milk samples. Int. J. Food Microbiol., 64: 1-11.

[16.] Khan, I.U., V. Gannon, R. Kent, W. Koning, D.R. Lapen, J. Miller, N. Neumann, R. Phillips, W. Robertson, E. Topp, E. van Bochove, T.A. Edge, 2007. Development of a rapid quantitative PCR assay for direct detection and quantification of culturable and non-culturable Escherichia coli from agriculture watersheds. Journal of Microbiological Methods, 69: 480-488.

[17.] Lane, A., Y. Tsai, C. Mayer, K. Patton, C. Palmer, 1994. Multiplex PCR for detection of the heat-labile toxin gene and shiga-like toxin I and II genes in Escherichia coli isolated from natural waters. Applied and Environmental Microbiology, pp: 3145-3149.

[18.] Martins, M.T., I.G. Rivera, D.L. Clark, M.H. Stewart, R.L. Wolfe, B.H. Olson, 1993. Distribution of uidA gene sequences in Escherichia coli isolates in water sources and comparison with the expression of betaglucuronidase activity in 4-methylumbelliferyl-beta-D-glucuronide media. Appl. Environ. Microbiol., 59: 2271-2276.

[19.] Mc Daniels, A.E., E.W. Rice, A.L. Reyes, C.H. Johnson, R.A. Haugland, G.N. Stelma Jr., 1996. Confirmational identification of Escherichia coli, a comparison of genotypic and phenotypic assays for glutamate decarboxylase and beta-D-glucuronidase. Applied and Environmental Microbiology, 62(9): 3350-3354.

[20.] Pierre, S., P. Josue, P. Julien, Tamara, 2009. Abundance of culturable versus viable Escherichia coli in freshwater. Canadian Journal of Microbiology, 55(7): 905-909, 10.1139/W09-043.

[21.] Pitkanen, T., P. Paakkari, I.T. Miettinen, H. Heinonen-Tanski, L. Paulin, M.L. Hanninen, 2007. Comparison of media for enumeration of coliform bacteria and Escherichia coli in non-disinfected water. J. Microbiol. Methods, 68: 522-529.

[22.] Rice, E.W., M.J. Allen, D.J. Brenner, S.C. Edberg, 1991. Assay for beta-glucuronidase in species of the genus Escherichia and its applications for drinking-water analysis. Appl. Environ. Microbiol., 57: 592-593.

[23.] Rice, E.W., C.H. Johnson, M.E. Dunnigan, D.J. Reasoner, 1993. Rapid glutamate decarboxylase assay for detection of Escherichia coli. Appl. Environ. Microbiol., 59: 4347-4349.

[24.] Ruiting, L., R. Peter, 2002. Escherichia coli in disguise: molecular origins of Shigella. Microbes and Infection., 4: 1125-1132.

[25.] Schets, F.M., P.J. Nobel, S. Strating, K.A. Mooijman, G.B. Engels, A. Brouwer, 2002. EU DrinkingWater Directive reference methods for enumeration of total coliforms and Escherichia coli compared with alternative methods. Lett. Appl. Microbiol., 34: 227-231.

[26.] Seidler, R.J., T.M. Evans, J.R. Kaufman, M.W. LeChevalier, 1981. Limitations of standard coliform enumeration techniques. J. AWWA, 73: 538-542.

[27.] Spierings, G., C. Ockhuijsen, H. Hofstra, J. Tommassen, 1993. Polymerase chain reaction for the specific detection of Escherichia coli/Shigella. Research in Microbiology, 144 (7): 557-564.

[28.] Tantawiwat, S., U. Tansuphasiri, W. Wongwit, V. Wongchotigul, D. Kitayaporn, 2005. Development of multiplex PCR for the detection of total coliform bacteria for Escherichia coli and Clostridium perfringens in drinking water. Southeast Asian Journal of Tropical Medicine and Public Health, 36(1): 162-169.

[29.] World Health Organization (WHO). 2001. Water Quality: Guidelines, Standards and Health. Edited by Lorna Fewtrell and Jamie Bartram. Published by IWA Publishing, London, UK. ISBN: 1 900222 28.

[30.] Yoshimi, K., K. Hiroyuki, Takashi, Takatsuka., K. Yoshiyuki, 1997. Characterization of a Second lysine decarboxylase Isolated from Escherichia coli. Journal of bacteriology, pp: 4486-4492.

(1) Roohollah Kheiri, Mahyar Mostaghim, (2) Roohollah Kheiri, (3) Mahyar Mostaghim

(1) Water Hygiene and Quality Control Office, Alborz Province Water and Waste Water Company

(2) Water and Waste Water Company, Karaj, Alborz province, IRI.

(3) Water and Waste Water Company, Karaj, Alborz province, IRI.

Corresponding Author

Roohollah kheiri, Water and Waste Water Company, Karaj, Alborz province, IRI. Phone: +982612515103. Fax: +982612502354. E-mail: r_kheirik@yahoo.com

Table 1: Coliforms/Escherichia coli selective enriching broth
typical composition

Ingredients             Company, Cat number         Weight g/l

peptone from casein     (Merck Chemicals, 107213)   20
peptone from meat       (Merck Chemicals, 107212)   3.0
sodium chloride         (Merck Chemicals, 106406)   5.0
di-potassium hydrogen   (Merck Chemicals, 105109)   2.75
  phosphate
potassium dihydrogen    (Merck Chemicals, 105108)   2.75
  phosphate
sodium deoxycholate     (Merck Chemicals, 106504)   1.5
Xylose                  (Merck Chemicals, 108689)   5

Table 2: Specific primers used in this study

gene       forward/reverse    Primer sequence              PCR
                                                           product
                                                           size
                                                           MW (bp)

phoE       forward sequence   AAAGCCGTGGCACAGGCAAGCGT      348
           reverse sequence   TCAATTTGTTATCGCTATCCAGTTGG
mdh        forward sequence   ACTGAAAGGCAAACAGCCAAG        392
           reverse sequence   CGTTCTGTTCAAATGGCCTCAGG
'6S rRNA   forward sequence   GGAAGAAGCTTGCTTCTTTGCTGAC    544
           reverse sequence   AGCCCGGGGATTTCACATCTGACTTA
gadAB      forward sequence   ACCTGCGTTGCGTAAATA           670
           reverse sequence   GGGCGGGAGAAGTTGATG
lacZ       forward sequence   ATGAAAGCTGGCTACAGGAAGGCC     876
           reverse sequence   CACCATGCCGTGGGTTTCAATATT
uidA       forward sequence   CCAAAAGCCAGACAGAGT           1700
           reverse sequence   GCACAGCACATCCCCAAAGAG
cadA       forward sequence   TGGATAACCACACCGCGTCT         2000
           reverse sequence   GGAAGGATCATATTGGCGTT
tnaOP      forward sequence   CGAGGATAAGTGCATTATGAATATCT   3065
           reverse sequence   TTAGCCAAATTTAGGTAACACGTT

gene       forward/reverse    Reference

phoE       forward sequence   Spierings et al., 1993
           reverse sequence
mdh        forward sequence   Chen et al., 2001
           reverse sequence
'6S rRNA   forward sequence   Lane et al., 1991
           reverse sequence
gadAB      forward sequence   MCdaniels et al., 1996
           reverse sequence
lacZ       forward sequence   Bej et al, 1990
           reverse sequence
uidA       forward sequence   Lang et al., 1994
           reverse sequence
cadA       forward sequence   Kikuchi et al., 1997
           reverse sequence
tnaOP      forward sequence   Bernasconi et al., 2007
           reverse sequence

Table 3: specific pmols of the
primer sets per reaction

Primer   pmol of sets of primers

phoE     12
malic    15
uspA     8
gadA/B   8.5
lac Z    11
uidA     8
cadA     10
tnaOP    9

Table 4: Standard strain growth during period of incubation

standard strains                      Growth        Growth
                                      (turbidity)   (turbidity)
                                      at 35-37      at 35-37
                                      [degrees]C    [degrees]C
                                      for 8 hours   for 15 hours

Escherichia coli ATCC 10799           fair          good
Escherichia coli ATCC 8739            fair          good
Escherichia coli ATCC 35218           fair          good
Escherichia coli ATCC 15224           fair          good
Escherichia coli ATCC 25922           fair          good
Escherichia coli ATCC 10536           fair          good
Escherichia coli PTCC 1270            fair          good
Escherichia coli ATCC 11303           fair          good
Citrobacter freundii ATCC 8454        fair          good
Citrobacter freundii ATCC 1600        fair          good
Citrobacter freundii ATCC 6879        fair          good
Enterobacter aerogenes ATCC 1221      fair          good
Enterobacter aerogenes ATCC 13048     fair          good
Klebsiella pneumoniae ATCC 10031      fair          good
Klebsiella pneumoniae ATCC 27799      fair          good
Klebsiella pneumoniae ATCC 13883      fair          good
Shigella flexneri ATCC 12022          none          none
Shigella flexneri PTCC 1234           none          fair
Shigella flexneri ATCC 25875          none          fair
Salmonella Typhimurium ATCC 19430     none          fair
Salmonella Typhi ATCC 14028           none          fair
Entrococcus fecalis ATCC 9584         none          none
Entrococcus fecalis ATCC 11700        none          none
Vibrio Cholerae PTCC 1611             none          none
Pseudomonas aeruginosa ATCC 9027      none          none
Clostridium perfringens ATCC 10873    none          none

standard strains                      Growth (turbidity)
                                      at 35-37[degrees]C
                                      for 24 hours

Escherichia coli ATCC 10799           very good
Escherichia coli ATCC 8739            very good
Escherichia coli ATCC 35218           very good
Escherichia coli ATCC 15224           very good
Escherichia coli ATCC 25922           very good
Escherichia coli ATCC 10536           very good
Escherichia coli PTCC 1270            very good
Escherichia coli ATCC 11303           very good
Citrobacter freundii ATCC 8454        very good
Citrobacter freundii ATCC 1600        very good
Citrobacter freundii ATCC 6879        very good
Enterobacter aerogenes ATCC 1221      very good
Enterobacter aerogenes ATCC 13048     very good
Klebsiella pneumoniae ATCC 10031      very good
Klebsiella pneumoniae ATCC 27799      very good
Klebsiella pneumoniae ATCC 13883      very good
Shigella flexneri ATCC 12022          fair
Shigella flexneri PTCC 1234           fair
Shigella flexneri ATCC 25875          fair
Salmonella Typhimurium ATCC 19430     fair
Salmonella Typhi ATCC 14028           fair
Entrococcus fecalis ATCC 9584         none
Entrococcus fecalis ATCC 11700        none
Vibrio Cholerae PTCC 1611             none
Pseudomonas aeruginosa ATCC 9027      none/poor
Clostridium perfringens ATCC 10873    none

Table 5: Genes detected in standard strains by octaplex PCR

standard strains                      mdh   phoE   16S rRNA   gadA/B

Escherichia coli ATCC 10799           +     +      +          +
Escherichia coli ATCC 8739            +     +      +          +
Escherichia coli ATCC 35218           +     +      +          +
Escherichia coli ATCC 15224           +     +      +          +
Escherichia coli ATCC 25922           +     +      +          +
Escherichia coli ATCC 10536           +     +      +          +
Escherichia coli PTCC 1270            +     +      +          +
Escherichia coli ATCC 11303           +     +      +          +
Citrobacter freundii ATCC 8454        +     -      -          -
Citrobacter freundii ATCC 1600        -     -      -          -
Citrobacter freundii ATCC 6879        +     -      -          -
Enterobacter aerogenes ATCC 1221      -     -      -          -
Enterobacter aerogenes ATCC 13048     -     -      -          -
Klebsiella pneumoniae ATCC 10031      +     -      -          -
Klebsiella pneumoniae ATCC 27799      +     -      -          -
Klebsiella pneumoniae ATCC 13883      +     -      -          -
Shigella flexneri ATCC 12022          +     +      +          +
Shigella flexneri PTCC 1234           +     +      +          +
Shigella flexneri ATCC 25875          +     +      +          +
Salmonella Typhimurium ATCC 19430     +     -      +          -
Salmonella Typhi ATCC 14028           -     -      -          -
Entrococcus fecalis ATCC 9584         -     -      -          -
Entrococcus fecalis ATCC 11700        -     -      -          -
Vibrio Cholerae PTCC 1611             -     -      -          -
Pseudomonas aeruginosa ATCC 9027      -     -      -          -
Clostridium perfringens ATCC 10873    -     -      -          -

standard strains                      lacZ   uidA   cadA   tnaOP

Escherichia coli ATCC 10799           +      +      +      +
Escherichia coli ATCC 8739            +      +      +      +
Escherichia coli ATCC 35218           +      +      +      +
Escherichia coli ATCC 15224           +      +      +      +
Escherichia coli ATCC 25922           +      +      +      +
Escherichia coli ATCC 10536           +      +      +      +
Escherichia coli PTCC 1270            +      +      +      +
Escherichia coli ATCC 11303           +      +      +      +
Citrobacter freundii ATCC 8454        -      -      -      -
Citrobacter freundii ATCC 1600        +      -      +      -
Citrobacter freundii ATCC 6879        -      -      -      -
Enterobacter aerogenes ATCC 1221      +      -      +      -
Enterobacter aerogenes ATCC 13048     +      -      +      -
Klebsiella pneumoniae ATCC 10031      +      -      +      -
Klebsiella pneumoniae ATCC 27799      +      -      +      -
Klebsiella pneumoniae ATCC 13883      +      -      +      -
Shigella flexneri ATCC 12022          -      +      -      -
Shigella flexneri PTCC 1234           +      +      -      -
Shigella flexneri ATCC 25875          -      +      -      -
Salmonella Typhimurium ATCC 19430     -      -      -      -
Salmonella Typhi ATCC 14028           -      -      +      -
Entrococcus fecalis ATCC 9584         -      -      -      -
Entrococcus fecalis ATCC 11700        -      -      -      -
Vibrio Cholerae PTCC 1611             -      -      -      -
Pseudomonas aeruginosa ATCC 9027      -      -      -      -
Clostridium perfringens ATCC 10873    -      -      -      -
COPYRIGHT 2013 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Kheiri, Roohollah; Mostaghim, Mahyar
Publication:Advances in Environmental Biology
Article Type:Report
Geographic Code:7IRAN
Date:Sep 1, 2013
Words:4425
Previous Article:Applied of genetic algorithm in reliability optimization for parallel-series systems with interval component.
Next Article:Efficacy evaluation of four different culture and PCR-based methods of Escherichia coli detection in water samples.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |