Printer Friendly

ROLE OF METAL DETOXIFICATION BY GLUTAREDOXIN GENE AND ITS ISOLATION FROM CHROMIUM RESISTANT CYANOBACTERIA.

Byline: Abdul Hameed and Shahida Hasnain

ABSTRACT

Polypeptide profile of chromium resistant cyanobacteria strains Synechocystis sp. AHZ-HB-MK and S. sp. AHZ- HB-P2A was compared in the presence of K2CrO4 (0g mL-1,50g mL-1 and100g mL-1).Both strains showed difference in protein expression, at 50g mL-1 conc. Polypeptides of 20KDa and 18KDa showed increased expression by S.AHZ-HB-MK and S. sp. AHZ-HB-P2A respectively. Metal concentrations and exposure time also effected the protein expressions. Isolation and sequencing of representative genes indicated Glutaredoxin is a protein that helps cyanobacteria to survive in oxidative stres s caused by Chromium. Glutaredoxin gene was able to be sequenced only in Synechocystis sp. AHZ-HB-MK.

Key words: Glutaredoxin, oxidative stress, cyanobacteria, Synechocystis.

INTRODUCTION

With the advent of technologies and research cyanobacteria are now considered as potential candidates for bioremediation of metal contaminated sites, fields and promote plant growth even in the metal polluted cultivated areas. Cyanobacteria do so because of their metal tolerance and plant growth promoting ability. They can tolerate many metals by having different indigenous mechanisms. They have different detoxification system such as metal expulsion from the cell, their compartmentalization and synthesis of such proteins for example metallothioneins that can bind and make complex with metals [1].

Heavy metals such as Chromium can cause toxicity in all organisms including plant in which they induce the formation of reactive oxygen species mostly by autoxidation and Fenton reaction which requires divalent metals ion and a source of reducing agent to regenerate the metal [2]. In plants reactive oxygen species are also generated naturally during light independent photosynthesis [3].This oxidative stress caused by either way effects badly on the survival of microbes as well as plants. Reactive oxygen species targets biomolecules such as nucleic acid protein and lipid moieties [2]. Due to these harmful effects plants exhibit reduction in growth, phytomass, chlorosis, impaired photosynthesis, stunting and finally plant death [4] .

To protect themselves from the damage of these oxidants, cyanobacteria are supposed to produce some scavenger molecules as do all higher plant and eukaryotic organisms that can balance oxidative stress within the cell environment. These proteins can also be categorized as stress proteins that are not constitutively produced in normal circumstances rather they are produced in different situations (heat stress , metals stress , pH stress and salt stress) in order to nullify the

MATERIALS AND METHOD

Isolation and characterization

Two strains of cyanobacteria genus Synechocystis sp. AHZ- HB-MK and S. sp. AHZ-HB-P2A were previously isolated, characterized and molecularly identified [9-11].

Protein profiling by Polyacrylamide gel electrophoresis (PAGE)

For extraction of cyanobacterial proteins, cyanobacteria were grown in BG 11 supplemented with 50g mL-1of K2CrO4 at 282C. After 15 days cells were harvested and total cell proteins were resolved on PAGE. The protein profile of Synechocystis strains was resolved after 1, 3 and 7 days at effect of these stresses so that organism may survive. Non- protein thiols have already been investigated as probable mechanism of heavy metal detoxification in cyanobacteria [5]. Sometimes Reactive oxygen species by themselves induce the expression of these antioxidants [6]. Most important of these proteins are glutathione which is being produced by almost all organisms ranging from prokaryotes to eukaryotes including humans. But some phylum of archea and bacteria lack its gene [7].

Glutaredoxins have two active site cysteine residues in the sequence Cys-Pro-Tyr-Cys. The N-terminal cysteine is required for both protein disulfide reduction and reduction of mixed protein-glutathione disulfides, while the other cysteine is required only for reduction of intramolecular protein disulfide bonds. It gets reduced by the oxidation of Glutathione [8]. Many studies has been done to identify and isolate glutaredoxin genes from cyanobacteria specially genus Synechocystis. Its functionality and detoxification parameters have also been determined.

In present study cyanobacteria subjected to sudden shift in one or several parameters affecting their growth or survival due to which program of gene expression was initiated, which was manifested as an increased or decreased amount of a set of proteins synthesized in response to stress. In cyanobacteria chromium stress strongly stimulates the expression of a set of proteins that probably allow them to survive in the rapidly changing environment. Evaluation of difference in polypeptide profile of chromium resistant cyanobacteria was made that were growing in the presence (10 g mL-, 50g mL-1 and 100 g mL-1) and absence of chromium. In addition to that the gene that expressed under stress condition was isolated, sequenced and identified.

Different concentrations of chromium K2CrO4, which were already used for the probable mechanisms of heavy metal detoxification through non-proteins thiols.

DNA Isolation, Amplification and Elution for Sequencing DNA isolation was performed according to previous study [11].

Polymerase Chain Reaction (PCR) for Glutaredoxin gene amplification PCR was performed in a Perkin-Elmer DNA Themai Cycler (Perkin-Elmer Co. Norwalk- CT, USA). PCR was performed in MASTERCYCLER(R) 5333 eppendorf, Version 2.30.33-99 under standard conditions. Glutaredoxin gene was amplified in the genome of both Synechocystis sp. AHZ-HB-MK and S. sp. AHZ-HB-P2A. For all genes the template DNA used was 100 ng. After mixing Primers and other ingredients of PCR in amplification tube it was placed in thermoblock of thermocycler, which was fitted with heated lids. Amplified the nucleic acids during the Denaturation, annealing and extension cycles. The programming was according to the primer used. The conditions of time durations and temperature were optimized and they were specified.

Gel Extraction of Amplified DNA

After confirmation of amplified DNA by visualizing it through gel electrophoresis, this DNA was eluted and taken for sequencing. Two different kits were used for DNA elution. Fermentas Kit # K 0513 And QIAquick Gel Extraction Kit (Cat. # 28704, Qiagen, Inc.).

RESULTS

Protein profiling by PAGE Synechocystis sp. AHZ-HB-MK

In this strain, twenty proteins of 135, 132, 120, 110, 104, 62.5, 57.5, 52.4, 47.5, 44.9, 37.5, 35, 33.7, 30, 27, 25, 23.7, 20, 18 and 14.4 KDa were identified at 0g mL-1 chromium. The expression of only one polypeptide of 20 KDa improved, however, twelve polypeptides of 110,104,62.5,57.5, 47.5, 35,33.7,30,27,23.7,18 and 14.4 KDa had reduced expression, while seven polypeptides of 135,132,120,52.4,47.5,44.9 and 27 KDa had completely vanished in the presence of 50g mL-1 chromium (Table 1).

Synechocystis sp. AHZ-HB-P2A

In this strain, twenty one proteins of 135, 132, 120, 110, 104, 62.5, 57.5, 52.4, 51.2, 47.5, 44.9, 37.5, 35, 33.7, 30, 27, 25, 23.7, 20, 18 and 14.4 KDa were identified at 0g mL-1 chromium. The expression of only one polypeptide of 18 KDa remained same; however, fourteen polypeptides of 135, 132, 120, 110, 104, 62.5, 57.5, 52.4, 33.7, 30, 27, 25, 23.7 and 20 KDa had reduced expression, while six polypeptides of 51.2, 47.5, 44.9, 37.5, 35 and 14.4 KDa completely vanished in the presence of 50g mL-1 chromium (Table 1).

To evaluate change in protein expression in more detail same procedure was also followed for different concentrations of metals such as 0g mL-1, 10g mL-1 and 100g mL-1 at different time intervals (Table 2).

DNA Isolation, Amplification and Elution for Sequencing DNA was obtained from the both strains of cyanobacteria and visualized by gel electrophoresis. Glutaredoxin gene amplification was done by PCR by adding appropriate primers and maintaining amplification temperature. 5'- TGAGAGCCCTGGCTTTATTG-3' was used as forward primer and 5'-CAACTTGCCTGCACCATCTA-3' as reverse primer. These were the primer that amplified the target gene. In order to confirm that whether the gene was present in both strains and amplification is done properly, gel electrophoresis was performed. After eluting DNA from the gel it was subjected to sequencing. Results of sequencing were manipulated as below:

Sequence of Glutaredoxin Gene for Synechocystis sp. AHZ-HB-MK

This strain gave sequence with forward primer 5' TGAGAGCCCTGGCTTTATTG 3' during first attempt. The partial sequence of this gene, the blast [12] gave 96% similarity to Synechocystis PCC 6803 genome with Glutaredoxin 3 gene. The data was submitted to GenBank and was issued an accession number as DQ398587. The Electropherogram of partial sequence of Glutaredoxin gene of this strain is shown as Figure 1.

BLAST (Basic Local Alignment Search Tool) Analysis Sequencing was difficult because fragment lengths were very short that is why only Synechocystis sp. AHZ-HB-MK could be sequenced and analyzed further. The sequence obtained was compared with known sequences using BLAST [12]. The sequenced data then submitted to GenBank, in order to obtain the accession numbers for sequenced gene fragments. The query asking glutathione reductase gene from CyanoBase (The Genome Database for Cyanobacteria) for the reference strain Synechocystis sp. PCC 6803 gave result as follows:

Gene Information (Chr) ssr2061 Location: Init: 1050812 Term: 1051078 Length (aa): 88 Gene Products: Glutaredoxin 3.

The Gene Sequence was Synechocystis PCC 6803 .The Homology/ Similarity Studies of Synechocystis sp. AHZ-HB-MK Strain and Synechocystis PCC 6803 Glutaredoxin 3 Gene. The Retrieved Result with Alignment of Two Sequences is Given Below.

The blast gave 96% similarity to Synechocystis PCC 6803 gi|47118304|dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome Length=3573470 Features in this part of subject sequence: Solanesyl diphosphate synthase Glutaredoxin 3 Score = 254 bits (128), Expect = 7e-65 Identities = 146/152 (96%), Gaps = 0/152 (0%) Strand=Plus/Plus"

Query: The Sequence of Synechocystis sp. AHZ-HB-MK

Submitted to Blast

Subject: The Sequence of Synechocystis PCC 6803

Retrieved though Blast

Table 1: Polypeptide profile of chromium resistant cyanobacterial strains under 0g mL-1 and 50g mL-1 chromium r=reduced expression of polypeptide,d=polypeptide inhibited,m=more expression

Synechoc###0g mL -1 135 132 120 110 104 62.5 57.5 52.4 47.5 44.9 37.5 35 33.7 30 27 25 23.7 20 8 14.4

ystis sp.

AHZ-###50g mL -1 d###d###d###r###r###r###r###d###r###D###d###r###R###r###r###d###R###m###r###r

HB-MK

Synechoc###0g mL-1###135 132 120 110 104 62.5 57.5 52.4 47.5 44.9 37.5 35 33.7 30 27 25 23.7 20 18 14.4

ystis sp.

AHZ-###50g mL-1###d###d###d###r###r###r###r###d###r###d###d###r###R###r###r###d###r###m###r###r

HB-P2A

Table 2: Polypeptide profile of chromium resistant Synechocystis strains under 0g mL-1, 10g mL-1 and 100g mL-1 chromium.

###CYANOBACTERIAL STRAINS

Synechocystis sp. AHZ-HB-MK###Synechocystis sp. AHZ-HB-P2A

0g mL-1###10g mL-1###100g mL-1###0g mL-1###10g mL-1###100g mL-1

Cont.###1day###3day###7day###1day###3day###7day###Cont.###1day###3day###7day###1day###3day###7day

135###m###m###r###r###r###d###135###m###M###r###r###m###r

132###m###m###d###m###m###d###132###m###M###r###r###m###r

120###m###m###d###m###m###d###120###m###M###r###r###m###r

110###m###m###r###m###m###r###110###m###R###r###m###m###r

104###m###m###r###m###m###r###104###m###R###r###r###m###r

62.5###m###m###r###r###m###r###62.5###m###M###r###m###m###r

57.5###m###m###m###m###m###r###57.5###m###R###r###r###r###r

52.4###r###r###r###r###m###d###52.4###m###M###r###m###m###r

47.5###r###m###d###r###r###r###51.2###r###D###r###r###r###d

44.9###r###m###d###r###d###d###47.5###m###R###m###m###r###d

37.5###r###r###d###r###r###d###44.9###r###D###r###m###r###d

35###m###r###d###r###r###r###37.5###r###R###r###r###d###d

33.7###r###r###d###r###r###r###35###m###R###m###m###r###d

30###r###m###r###r###r###r###33.7###m###R###d###r###r###r

27###r###r###d###r###r###r###30###r###R###d###r###r###r

25###m###r###d###r###d###d###27###r###R###r###r###r###r

23.7###r###m###r###r###m###r###25###r###R###d###d###r###r

20###m###m###m###m###m###m###23.7###m###M###m###m###m###r

18###m###m###r###r###r###r###20###m###M###d###m###m###r

14.4###same###r###r###r###r###r###18###same###R###same###same###r###same

###14.4###r###R###r###r###r###d

DISCUSSION

Cyanobacteria are well known and potential candidate for bioremediation and metal detoxification. Synechocystis sp. AHZ-HB-MK and Synechocystis sp.AHZ-HB-P2A were already studied for their role in detoxification through non-protein thiols. In present study they were also tested for the presence and consequently sequencing of Glutaredoxin gene. Presence of Glutaredoxin gene was observed when polypeptide profiling was done in order to determine the effect of chromium on the synthesis of stress proteins. The Synechocystis PCC 6803 has already been used for the study of some other heavy metal resistance mechanisms, but not for chromium [13-15]. The reference strain Synechocystis PCC 6803 was obtained and subsequently used for comparative study of probable mechanism of heavy metal detoxification through non-protein thiols.

Chromium stress resulted in alteration in polypeptide profile of chromium resistant cyanobacteria. Polypeptide pattern revealed that three different types of changes in these strains in response to chromium stress were observed i.e., (i) loss of certain proteins (ii) reduction in expression of some proteins and (iii) improvement in expression of some proteins. The interesting comparisons in between Synechocystis sp. AHZ-HB-MK and Synechocystis sp.AHZ-HB-P2A

Strains for a polypeptide of 20 KDa was that its expression in Synechocystis sp. AHZ-HB-MK was high in both chromium treatments of 10g mL-1 chromium and 100g mL-1 chromium with passage of time than Synechocystis sp. AHZ-HB-P2A, where its expression was reduced/ lost at 7 days of chromium treatment, this polypeptide may have involved in high chromium resistance of former strain over latter. In strain Synechocystis sp. AHZ-HB-P2A a polypeptide of 51.2 KDa was found, however, it was absent in Synechocystis sp. AHZ-HB-MK. This clearly differentiates between both strains. There is another finding form the above study that different cyanobacteria strains may have evolved different mechanisms for chromium resistance/ detoxification.

These findings urged to identify their respective genes. That is why the amplified genes in both strains were isolated and sequenced. All sequencing attempts were made in Beckman Coulter(R) (CEQ 8000) sequencer and data was analyzed by the software, CEQ System (Ver.9.0.25). The sequencing was only achieved after obtaining high purity of amplified fragment through spin column QIAquick Gel Extraction Kit (Cat. # 28704) purification, rather than silica beads treatment (Fermentas # K 0513). Same result has also been reported by [16-17]. Hence proved that QIAquick Gel Extraction Kit (Cat. # 28704)is more efficient.The amplified gene being less than 250 base pairs was very difficult to get sequenced, after many attempts this gene in strain Synechocystis sp. AHZ-HB-MK was sequenced, but all attempts were in vein for Synechocystis sp. AHZ-HB-P2A.

The smaller fragment sequencin g is quite difficult as compare to large fragment; it may be due to less template availability for polymerase enzyme.

In this study an attempt has been made to target and sequence gene analogue to glutaredoxin3 ofSynechocystis PCC 6803 in Synechocystis sp. AHZ- HB-MK and Synechocystis sp. AHZ-HB-P2A strains isolated and characterized previously. The Glutaredoxin 3 (grxC) probable function of Glutaredoxinssr2061 has already been studied in Synechocystis PCC6803 that it has a glutathione- disulfide oxidoreductase activity in the presence of NADPH, reduces low molecular weight disulfides and proteins[18]. The glutaredoxin was amplified in both cyanobacterial strains in this present study, some scientists [19] were also successful to amplify this gene in all strains reported by him, it is also strengthening a possibility that the designed primers of this gene may be from conserved region of different cyanobacteria or cyanobacterial strains isolated in present study.

The amplified fragment in Synechocystis strains were of 230 base pairs size approximately, which correspond to 250 base pairs fragment isolated by some scientists [19].Literature review suggests that glutaredoxin 3 works along with another gene product glutathione synthetase, that form glutathione. It causes reduction of oxidized form of glutathione (GSSG in to GSH) to reduced form for its further use to overcome oxidative stress by binding with heavy metals. Finding of the 96% homology of Synechocystis MK (S)" glutaredoxin 3 gene did not only illustrate the presence of this gene in closely related organisms, but also confirmed the role of glutathione in particular as one of the mechanism of heavy metal detoxification.

Moreover increased expression of other polypeptide after chromium stress can lead us to the identification of gl utathione synthetase genes that also provide additional help to the organism like cyanobacteria to combat with metal stress in the environment. To date much less is known about the roles of glutathione in cyanobacteria that are the evolutionary precursor of the chloroplast. An understanding of glutathione in cyanobacteria is expected to provide novel insight into the evolution of the elaborate and extensive pathways that utilize glutathione in photosynthetic organisms [14].

REFERENCE

1. Yoshida, N., R. Ikeda, and T. Okuno, Identification and characterization of heavy metal-resistant unicellular alga isolated from soil and its potential for phytoremediation. Bioresource Technology, 2006. 97(15): p. 1843-1849.

2. Cabiscol, E., J. Tamarit, and J. Ros, Oxidative stress in bacteria and protein damage by reactive oxygen species. International Microbiology, 2010. 3(1): p. 3-8.

3. Foyer, C.H. and S. Shigeoka, Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiology, 2011. 155(1): p. 93-100.

4. Hameed, A. and S. Hasnain, Role of cyanobacterial strains on Triticum aestivum growth under chromium stress in laboratory. Science international, 2014. 26(4): p. 1737-1742.

5. Hameed, A., et al., Induction of non protein thiols by chromium in cyanobacteria isolated from polluted areas. African Journal of Microbiology Research, 2013. 7(40): p. 4806-4811.

6. Singh, S.P., D.-P. HAder, and R.P. Sinha, Cyanobacteria and ultraviolet radiation (UVR) stress: Mitigation strategies. Ageing Research Reviews, 2010. 9(2): p. 79-90.

7. Rouhier, N., et al., Glutaredoxins: roles in iron homeostasis. Trends in Biochemical Sciences, 2010. 35(1): p. 43-52.

8. MA1/4hlenhoff, U., et al., Cytosolic monothiol glutaredoxins function in intracellular iron sensing and trafficking via their bound iron-sulfur cluster. Cell metabolism, 2010. 12(4): p. 373-385.

9. Hameed, A. and S. Hasnain. Cultural characteristics of chromium resistant filamentous cyanobacteria isolated from local environment in pakistan. in Proceedings of the first international conference on environmentally sustainable development (ESDev-2005), COMSATS Institute of Information Technology, Abbottabad, Pakistan. 2005. 3: p. 1527-1536.

10. Hameed, A. and S. Hasnain, Cultural Characteristics of Chromium Resistant Unicellular Cyanobacteria Isolated From Local Environment in Pakistan. Oceanol.Limnol, 2005. 23(4): p. 433-441.

11. Hameed, A. and S. Hasnain, Isolation and molecular identification of metal resistant Synechocystis from polluted areas. African Journal of Microbiology Research, 2012. 6(3): p. 648-652.

12. Altschul, S.F., et al., Basic local alignment search tool. J. Mol. Biol, 1990. 215: p. 403-410.

13. Kim, S.G., et al., Redox, mutagenic and structural studies of the glutaredoxin/arsenate reductase couple from the cyanobacterium Synechocystis sp. PCC 6803. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics, 2012. 1824(2): p. 392-403.

14. Cameron, J.C. and H.B. Pakrasi, Essential role of glutathione in acclimation to environmental and redox perturbations in the cyanobacterium Synechocystis sp. PCC 6803. Plant Physiology, 2010. 154(4): p. 1672-1685.

15. Marteyn, B., et al., The Synechocystis PCC6803 MerA-like enzyme operates in the reduction of both mercury and uranium under the control of the glutaredoxin 1 enzyme. Journal of bacteriology, 2013. 195(18): p. 4138-4145.

16. Okumura, N., Masamoto, K. and Wada, H. 1997. The gshB gene in the cyanobacterium Synechococcus sp. PCC 7942 encodes a functional glutathione synthetase. Microbiol. 143: 2883-2890.

17. Li, R., Carmichael, W.C., Liu, Y. Watanabe, M. M. 2000. Taxonomic re-evaluation of Aphanizomenon flos-aquae NH-5 based on morphology and 16S rRNA gene sequences. Hydrobiologia, 438: 99-105.

18. Picciocchi, A., et al., CGFS-type monothiol glutaredoxins from the cyanobacterium Synechocystis PCC6803 and other evolutionary distant model organisms possess a glutathione- ligated [2Fe-2S] cluster. Biochemistry, 2007. 46(51): p. 15018-15026.

19. Jiang, F., et al., Cloning, sequencing, and regulation of the glutathione reductase gene from the cyanobacterium Anabaena PCC 7120. J Biol Chem, 1995. 270(39): p. 22882-
COPYRIGHT 2015 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Science International
Article Type:Report
Date:Apr 30, 2015
Words:3391
Previous Article:APPLICATION OF COMBINED LEADER PROGRESSION AND CSM FOR LIGHTNING STROKE CALCULATION OF ELECTRIC RAILWAY OVERHEAD FEEDING SYSTEM.
Next Article:BISACCATE POLLEN FROM CHHIDRU FORMATION, WESTERN SALT RANGE, PAKSTAN.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters