Printer Friendly

RELATIONSHIP BETWEEN THE INSERTION/DELETION VARIANTS OF POU1F1, FSH, ANDMUC13 AND TESTIS MEASUREMENT TRAITS IN MALE PIGLETS.

Byline: Fa Ren, Shuai Yu, Xuelian Zhang, Xiaoyan Lv, Xiuzhu Sun and Chuanying Pan

ABSTRACT

The aim of this study was to investigate the insertion/deletion (indel) mutations of the POU domain class 1 transcription factor 1 (POU1F1), the follicle-stimulating hormone b-subunit (FSHb), and themucin 13 (MUC13) genes, as well as to evaluate their associations with testis measurement traits in male piglets. In total, these indels were analyzed in 442 individuals from two pig breeds by PCR and agarose gel electrophoresis. As a result, three genotypes (homozygous insertion and heterozygote and homozygous deletion) were found at each locus. Association analyses revealed a significant relationship between POU1F1 indel and testis short girth (TSG) in 15-day-old Large White (LW) pigs (P = 0.016). At the POU1F1indel locus, the testis measurement traits of pigs with the AA and AB genotypes were larger than those of pigs with the BB genotype.

As for FSHb, an indel was found to be significantly associated with testis long circumference (TLC) (P = 0.050) and testis weight (TW) (P = 0.001) of 40-day-old Landrace (LD) piglets, with the BB genotype showing the largest testis measurement traits. We found no significant relationships between indels of MUC13 and the testis measurement traits. The significant influence of indels ofPOU1F1 and FSHb suggests that both POU1F1 and FSHb influence reproductive potential, and therefore, could be possible candidate genes for the breeding improvement of male piglets.

Keywords: Pigs; POU1F1 gene; MUC13 gene; FSHb gene; Insertion/deletion (indel).

INTRODUCTION

In the past two decades, there has been an increasing interest in understanding the genetic determinants of reproductive traits in livestock. This has led to improvement in the global pig industry, an economically important livestock for agriculture (Park et al., 2015). Research toward improving reproductive traits is considered more promising than feeding and housing improvements (Buske, 2006). Hence, there is major interest among breeders to identify reproductive traits that can be selected.

Various marker-assisted selection (MAS) programs have been developed in order to increase the economic performance of swine farms (Marantidis et al., 2016). In particular, identification of insertion/deletion (indel) events has allowed the identification of relevant pig genes to a greater extent than the study of single nucleotide polymorphisms (SNPs) (Sathya et al., 2014). For example, the 18-bp indel of SOX9 has been identified as one of the functional genes for porcine inguinal and/or scrotal hernia (Brenig et al., 2015). To date, however, there have been no studies regarding candidate genes directly related to reproduction such as those affecting male pigs testis size.

POU domain class 1 transcription factor 1 (POU1F1) is the first pituitary-specific transcription factor to be identified in the human and mouse (Wang et al., 2015). The pigPOU1F1 gene is located on chromosome 13 and contains 6 exons and 5 introns. Its partial genomic sequence has been reported (Yu et al., 2001). POU1F1 contains a POU DNA-binding domain with two regions: a POU homeodomain required for DNA binding and a POU-specific domain essential for DNA-binding specificity and dimerization (Ozmen et al., 2014). The POU1F1 transcription factor is expressed in the pituitary gland where it regulates pituitary development and the expression of growth hormone genes (Cohen et al., 1996). Previous research revealed genetic polymorphisms in POU1F1 by using the POU domain probe, restriction fragment length polymorphism (RFLP), and polymerase chain reaction (PCR) techniques (Sadeghi et al., 2014).

A significant genotype effect of POU1F1 on average daily weight gain was found in the finishing period when focusing on crossbred 45, 70, and 180-day pig populations (Song et al., 2005). Therefore, POU1F1 is an essential factor regulating the development and reproduction of animals (Wu et al., 2009). Several indels including one potentially important 313-bp indel have been identified in Chinese pigs (Song et al., 2007). However, to date no studies have examined the association between testis measurement traits and POU1F1indels in male piglets.

Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family (Kato et al., 2011). Each hormone in the family shares a common a-glycoprotein subunit and contains a unique b-subunit that confers physiological specificity to the respective hormone (Aikawaet al., 2004). Both subunits of FSH participate in receptor binding and signaling effects, but each has its own function. The effect of FSH on animal reproductive performance is mainly affected by genetic variation within the b-subunit, both in its gene regulatory region and its coding region. A 280-bp indel of FSHb has been confirmed in different pig breeds(Zhao et al., 1999). To date, however, the possible functional significance of this 280-bp indel of FSHb is unknown in pigs.

Mucins (MUC) are glycoproteins that cover the apical surfaces of epithelial cells in gastrointestinal and respiratory tracts, forming the first line of host defense against enteric pathogens (Zhang et al., 2008). The protein family mediates interactions between epithelial cells and their milieu by modulating cell adhesion, the lubrication and protection of mucosa, the renewal and differentiation of epithelia and cell signal transduction (RingelandLohr, 2003). Previous studies have shown that MUC is in close linkage disequilibrium with the F4bcR locus, which acts as a marker to identify susceptible pigs (Fontanesi et al., 2012). MUC13 is a transmembranemucin that is highly expressed in the gastrointestinal tract (Williams et al., 2001). The aberrant expression of MUC13 is associated with intestinal-type gastric cancer, colorectal cancer and inflammatory bowel disease (Moehle et al., 2006).

The 68-bp indel mutation in intron 2 of MUC13 has been reported as an important anti-disease genetic marker for molecular breeding in the Yorkshire population(Sun et al., 2015).MUC13 aslo is one of hormonal control of mucin proteins (Poonet al., 2014). However, until now, the 68-bp indel of MUC13 and its influence on the testis measurement traits in male piglets is unknown.

In some mammals, testis measurement traitscan reflect spermatogenesis (Gouletsou et al., 2008). Hence, identifying individual differences in testis measurement traits may be key to selecting animals with high reproductive capacity. Some studies focusing on rams and bulls reported that testis measurement traits might be an indicator of fertility, suggesting high correlation between the traits (Devkota et al., 2008; Rege et al., 2000). Chen et al. (2016) from our group found that an indel in the sperm flagella 2 (SPEF2) gene on chromosome 16 could influence the testis measurement traits of boars (Chen et al., 2016).

Related studies have identified a number of different indels in POU1F1, FSHb, and MUC13. The purpose of this study was to investigate the indels of POU1F1, FSHb, and MUC13 in the Large White (LW) and Landrace (LD) pigs, two of the most popular breeds in many countries, including China (Bergfelder-Druing et al., 2015), and to evaluate their association with testis measurement traits in male piglets for the first time. Our findings would contribute toward improving the breeding and genetics in male piglets.

MATERIALS AND METHODS

Animal sources and data collection (testicular traits): A total of 442fresh and complete testis samples were obtained from castrated male piglets belonging to two breeds, LD and LW, which were reared at the National Swine Breeding Farm, Ankang, Shaanxi, China. Among of them, all LD male piglets (n=72) were 40 days old; 32.43% LW piglets (n=120) were 40 days old, while 67.57% LW piglets (n=250) were 15 days old. Data on testis weight (TW), testis long circumference (TLC) and testis short girth (TSG) were obtained from the testicular tissues, to be used for association evaluation analyses (Chen et al., 2016).

Genomic DNA isolation and DNA pool construction: Genomic DNA of the above samples was isolated from the testis samples following the procedure as described in Sambrock and Russell (Sambrook and Russell, 2002) and Lan et al (Lan et al., 2007). Those DNA samples were quantified and subsequently diluted to 50 ng/uL as their working solutions (Wu et al., 2014). DNA pools were constructed with 50 individual genomic DNA samples randomly chosen from each pig breed and used as a PCR template (Shi et al., 2016).

Primer design and PCR amplification: Three pairs of PCR primers for POU1F1,FSHb, and MUC13 were designed according to Song et al. (Song et al., 2007), Zhao et al. (Zhao et al., 1999), and Sun et al. (Sun et al., 2015) (Table 1), respectively. All PCR primers were synthesized by GenScript (Nanjing, Jiangsu Province, China). The PCRs of POU1F1, FSHb and MUC13 were performed in a volume of 20 uL, which contained 1 uL of template DNA, 0.5 uL of each primer (forward and reverse primer), 10 uL Primer Script RT Enzyme Mix I and 8 uL ddH2O.

All PCR reactions were carried out using the touchdown PCR (TD-PCR) procedure and products detected by agarose gelelectrophoresis.TD-PCR reactions were carried out as follows: initial denaturation for 4 min at 95 degC, followed by 15 cycles of denaturation for 30 s at 94 degC, annealing for 30 s at 65 degC (with a decrease of 1 degC per cycle), and extension for 1000 bp/min at 72 degC, another 23 cycles of 30 s at 94 degC, 30 s at 50 degC, and 1000 bp/min at 72degC, and a final extension of 10 min at 72 degC.

Statistical analysis: The Hardy-Weinberg equilibrium (HWE), genotypic and allelic frequencies were directly calculated using the SHEsis program (http://analysis.bio-x.cn) (Shi et al., 2016). Polymorphism information content (PIC) was calculated using an online calculator (http://www.msrcall.com/Gdicall.aspx) (Wu et al., 2014; Jia et al., 2015; Yang et al., 2016). The associations test of the indels with three testis measurement traits (TW, TLC, and TSG) were considered at two different growth periods (15-day/40-day) in LW piglets, and one period (40-day) in LD piglets, respectively. These association analyses were performed by analysis of variance (ANOVA) on the software SPSS (Version 18.0) if data agreed with the characteristics of normality and homogeneity of variances.

If not, the nonparametric test (Kruskal-Wallis) was conducted using SPSS (18.0). The ANOVA applied the general linear model (GLM) and the reduced linear model was as follows: Yijk=u+ai+bj+eijk, where Yijk represents the observation of the testis measurement traits (TW, TLC, and TSG) evaluated on the ithlevel of the fixed factor age (ai) and the jth level of the fixed factor genotype or combined genotype (bj); u represents the overall mean for each trait; and eijk is the random error for the ijkth individual (Pan et al., 2013). Theassociated LD and LW breed effect was not included in the linear model, as an initial statistical analysis indicated that the effect did not have a significant influence on the variability of traits in the pigs (Chen et al., 2016).

RESULTS

The frequency of the indel variants: In this study, the indel variants of POU1F1, FSHb, and MUC13 were investigated using polyacrylamide gel electrophoresis analysis.

As shown in Figure 1, the electrophoretogram revealed three genotypes (named AA, BB, and AB) for POU1F1 (Fig.1a), FSHb (Fig.1b), and MUC13(Fig.1c), respectively. In the analysis of POU1F1, the genotype BB exhibited one band (1926 bp), the AA genotype exhibited one band (2239 bp), and the AB genotype exhibited two bands (2239 bp and 1926bp) (Fig.1a). FSHb showed a homozygote insertion type (AA) consisting of 500 bp, a deletion type (BB) consisting of 220 bp and a heterozygote type (AB, 500 bp and 220 bp) (Fig.1b). MUC13 also showed three genotypes: AA (151 bp), BB (83 bp), and AB (151 bp, 83 bp) (Fig.1c).

The frequencies of alleles of the three genes were analyzed (Table 2). Our results indicated that the AA genotype of POU1F1 had a high frequency in LD and LW breeds. Furthermore,the B allelic frequencies in LD and LW breeds, respectively, were 0.902 and 0.664 for FSHb and 0.825 and 0.580 for MUC13. In order to evaluate genetic diversity, we calculated homozygosity (Ho), heterozygosity (He), effective allele numbers (Ne), and PIC at each locus (Table 2). The PIC value showed that the LW breed possesses medium genetic diversity (0.25 < PIC < 0.5), whereas the LD breed has low genetic diversity (0 < PIC 0.05) (Table 2).

Associations between the indel variants and the testis measurement traits in male piglets: In the two breeds, the associations between the different indels of three genes and the pig testis measurement traits were investigated (Table 3). A significant relationship was observed between the 313-bp indel of POU1F1 and TSG at 15-day-old in LW pigs (P = 0.016). The BB genotypes showed a lower TW than other genotypes. Furthermore, significant relationships were observed between the 280-bp indel of FSHb and testis measurement traits (TLC and TW) in the 40-day old LD breed(P = 0.050 and P = 0.001, respectively). At the 40-day old stage, LD individuals with FSHbgenotype BB showed greater testis measurement traits than those with genotypes AA and AB. However, we found no significant relationships between the 68-bp indel of MUC13and testis measurement traits.

Table 1. Amplification PCR primer sequences of the pig POU1F1, FSHb and MUC13 genes.

Primer###Primer sequences (53)###Sizes (bp)###Detection###Notes

###F:ATAGGTTGGGATGAGAAGAAT###2239/###AA=2239 bp

###Cited from

###R:GGTTTCCATAATGACAGGAAGGG###1926###AB=2239 bp

POU1F1###Song et al.

###+1926 bp

###(2007)

###BB= 1926bp

###F:CCTTTAAGACAGTCAATGGC###500/###AA=500 bp###Cited from zhao

###R:ACTGGTCTATTCATCCTCTC###220###AB=500 bp###et al (1999)

###FSH

###+220 bp

###BB=220 bp

###F:TTCTACTCTGATTCCACATCACG###151/###AA=151bp###Cited from Sun

###R:TGGTCATGTCTAGGACTCTTTGAG###83###AB=151 bp###et al (2015)

###MUC13

###+83 bp

###BB=83 bp

Table 2 Genotypic and allelic frequencies and population indexes for pig POU1F1, FSHb and MUC13 genes.

###Allelic###Population parameters

Breeds/Loci###Sizes###Genotypic frequencies###HWE

###frequencies

POU1F1-indel###N###BB###AB###AA###B###A###P values###Ho###He###Ne###PIC

LD###72###0.000###0.130###0.870###0.065###0.935###P>0.05###0.879###0.121###1.138###0.114

LW###372###0.059###0.364###0.577###0.241###0.759###P>0.05###0.634###0.366###1.576###0.299

FSH--indel###N###BB###AB###AA###B###A###P values###Ho###He###Ne###PIC

LD###72###0.459###0.410###0.131###0.664###0.336###P>0.05###0.554###0.446###1.806###0.347

LW###372###0.818###0.167###0.014###0.902###0.098###P>0.05###0.823###0.177###1.215###0.161

MUC13-indel###N###BB###AB###AA###B###A###P values###Ho###He###Ne###PIC

LD###72###0.683###0.286###0.032###0.825###0.175###P>0.05###0.712###0.288###1.405###0.247

LW###372###0.315###0.537###0.154###0.580###0.420###P>0.05###0.513###0.487###1.950###0.368

Table 3. Relationship between the indels and reproduction traits in male piglets (LSM+-SE)(PG polymorphism and production traits in Italian heavy pigs using a selective genotyping approach. Anim. Biotechnol, 23(3):147-155.

Gouletsou, P.G., A.D.Galatos and L.S. Leontides (2008). Comparison between ultrasonographic and caliper measurements of testicular volume in the dog. Anim Reprod Sci, 108(1-2):1-12.

Jacobson, E.M., P.Li and A. Leon-del-Rio (1997).Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected arrangement and flexibility. Genes Dev, 11(2):198-212.

Jia, W. C., X. F. Wu, X. C. Li, T. Xia, H. Chen, C. Y. Pan and X.Y. Lan (2015). Novel genetic variants associated with mRNA expression of STAT3 gene significantly affected goat growth traits. Small Ruminant Res, 129:25-36.

Kato, T., A. Ishikawa, S. Yoshida,Y. Sano, K. Kitahara, M. Nakayama, T. Susaand Y. Kato (2011). Molecular cloning of LIM homeodomain transcription factor Lhx2 as a transcription factor of porcine follicle-stimulating hormone beta subunit (FSHb) gene. J Reprod Dev, 58(1): 147-155.

Kim, G.W., J. Y. Yoo and H. Y. Kim (2014).Association of genotype of POU1F1 intron 1 with carcass characteristics in crossbred pigs. J Anim. Sci. Technol., 56:25.

Lan, X.Y., C. Y. Pan, H. Chen, C. L. Zhang, J. Y. Li, M. Zhao, C. Z. Lei, A. L. Zhang and L. Zhang (2007). An AluI PCR-RFLP detecting a silent allele at the goat POU1F1 locus and its association with production traits. Small Ruminant Res, 73: 8-12.

Luoreng, Z., L.X. Wang and S.D. Sun (2007).Genetic polymorphism of FSH b subunit gene and correlation with reproductive traits in Beijing Black Pig. Yi Chuan, 29(12):1497-1503.

Linville, R. C., C. D. Pomp, R. K. Johnson and R. F. Rothschild (2001). Candidate gene analysis for loci affecting litter size and ovulation rate in swine. J. Anim. Sci, 79(1):60-67.

Marantidis, A., G. P. Laliotis and M. Avdi (2016). Association of RBP4 genotype with phenotypic reproductive traits of sows. Genet Res Int, 2016:4940532.

Moehle, C., N. Ackermann, T. Langmann, C. Aslanidis, A. Kel, O. Kel-Margoulis, A. Schmitz-Madry, A. Zahn, W. Stremmel and G. Schmitz (2006). Aberrant intestinal expression and allelic variants of mucin genes associated with inflammatory bowel disease.J Mol Med (Berl), 84(12):1055-1066.

Ozmen, O., S.Kul and E.O.Unal (2014).Polymorphism of sheep POU1F1 gene exon 6 and 3'UTR region and their association with milk production traits.Iran J Vet Res, 15(4):331-335.

Pan, C.Y., C.Y.Wu, W.C.Jia, Y. Xu, S.R.Hu, C.Z.Lei, X.Y.Lan and H.Chen (2013). A critical functional missense mutation (H173R) in the bovine PROP1 gene significantly affects growth traits in cattle. Gene, 531 (1):398-402.

Park, S. J., J.Ha, I. S.Kim, S. J.Kwon,J. H.Hwang, D. H.Park,D. J.Kang, T. W.Kim, S. W.Kim and C. W. Kim (2015). Effects of LEP, GYS1, MYOD1, and MYF5 polymorphisms on pig economic traits. Ann Anim Sci, 3:629-640.

Poon, C.E., L. Lecce, M. L. Day and C. R.Murphy (2014). Mucin 15 is lost but mucin 13 remains in uterine luminal epithelial cells and the blastocyst at the time of implantation in the rat. Reprod. Fertil. Dev., 26(3):421-431.

Rege, J. E., F. Toe, E. Mukasa-Mugerwa, S. Tembely, D. Anindo, R. L. Baker and A. Lahlou-Kassi (2000). Reproductive characteristics of Ethiopian highland sheep II. Genetic parameters of semen characteristics and their relationships with testicular measurements in ram lambs. Small Ruminant Res, 37:173-187.

Ren J, X. Yan, H. Ai, Z. Zhang, X. Huang, J.Ouyang, M. Yang, H. Yang, P. Han, W.Zeng, Y. Chen, Y.Guo, S. Xiao, N. Ding and L. Huang (2012).Susceptibility towards enterotoxigenic Escherichia coli F4ac diarrhea is governed by the MUC13 gene in pigs. PLoS One, 7(9):e44573.

Ringel, J and M.Lohr (2003). The MUC gene family: Their role in diagnosis and early detection of pancreatic cancer. Molecular Cancer, 2:9.

Sadeghi, M., A. J alil-Sarghale and M. Moradi-Shahrbabak (2014). Associations of POU1F1 gene polymorphisms and protein structure changes with growth traits and blood metabolites in two Iranian sheep breeds. J Genet, 93(3):831-835.

Sambrook, J and D. W. Russell (2002).Translated by Huang Pei Tang. Molecular cloning: a laboratory manual.3rd edn Science Press, Beijing, China.

Sathya, B., A. P. Dharshini and G. R. Kumar (2014). NGS meta data analysis for identification of SNP and INDEL patterns in human airway transcriptome: A preliminary indicator for lung cancer. Appl Transl Genom, 4:4-9.

Shi, T., W. W. Peng, J. Y. Yan, H. F. Cai, X. Y. Lan, C. Z. Lei, Y. Y. Bai and H. Chen (2016). A novel 17 bpindel in the SMAD3 gene alters transcription level, contributing to phenotypic traits in Chinese cattle. Arch Anim Breed, 59:151-157.

Song, C., B. Gao, Y. Teng, X. Wang, Z. Wang, Q. Li, H.Mi, R. Jing and J.Mao (2005). MspI polymorphisms in the 3rd intron of the swine POU1F1 gene and their associations with growth performance. J Appl Genet, 46(3):285-289.

Song, C. Y., B. Gao, S. H. Teng, X. Y. Wang, F. Xie, G. H. Chen, Z.Y. Wang, R. B. Jing and J. D. Mao (2007). Polymorphisms in intron 1 of the porcine POU1F1 gene. J Appl Genet, 48(4): 371-374.

Sun, L., S.P.Zhu and R.W. Xia (2015).Effect of insertion/deletion mutation in MUC13 gene intron 2 on gene expression level and economic traits.Genetics and Breeding, 51(9):4-8.

Wang, J., G. W. Li, A. E. Mauricio, L. J. Yan, S. Y. Chen, X. B. Jia and S.J. Lai (2015). A novel single nucleotide polymorphism of the POU1F1 gene associated with meat quality traits in rabbits. AnnAnimSci,3:611-620.

Williams, S.J., D. H. Wreschner, M. Tran, H. J. Eyre, G. R. Sutherland and M.A. McGuckin (2001). MUC13, a novel human cell surface mucin expressed by epithelial and hemopoietic cells. J BiolChem, 276(21):18327-18336.

Wu, H., C. Y. Song and B. Gao (2009). Association between the 313 bpindel in porcine POU1F1 gene and reproduction traits. J. Northeast Agricultural University, 16(3):22-26.

Wu, X.F., W. C. Jia, J. J. Zhang, X. C. Li, C. Y. Pan, C. Z. Lei, H. Chen, R. H. Dang and X.Y. Lan (2014). Determination of the novel genetic variants of goat STAT5A gene and their effects on body measurement traits in two Chinese native breeds. Small Ruminant Res, 121:232-243.

Xu, P., Q. Li, K. Jiang, Q. Yang, M. Bi, C. Jiang, X. Wang, C. Wang, L. Li, C. Qiao, H. Gong, Y. Xing and J. Ren (2016). BAC mediated transgenic Large White boars with FSHa/b genes from Chinese Erhualian pigs. Transgenic Res, 25(5):693-709.

Yang, Q., S. Zhang, L. Liu, X. Cao, C. Lei, X. Qi, F. Lin, W. Qu, X. Qi, J. Liu, R, Wang, H, Chen and X, Lan (2016). Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion, 10(5):409-419.

Yu., T. P., H. S. Sun, S. Wahls, I. Sanchez-Serrano, M. F. Rothschild and C. K. Tuggle (2001).Cloning of the full-length pig PIT1 (POU1F1) cDNA and a novel alternative PIT1 transcript, and functional studies of their encoded proteins. Anim Biotechnol, 12(1):1-19.

Zang, L., Y. Wang, B. Sun, X. Zhang, C. Yang, L. Kang, Z. Zhao and Y. Jiang (2016). Identification of a 13bp indel polymorphism in the 3'-UTR of DGAT2 gene associated with backfat thickness and lean percentage in pigs. Gene, 576(2Pt 2):729-733.

Zhang, B., J.Ren, X.Yan, X.Huang, H.Ji, Q.Peng, Z.Zhang and L.Huang (2008). Investigation of the porcine MUC13 gene: isolation, expression, polymorphisms and strong association with susceptibility to enterotoxigenic Escherichia coli F4ab/ac.Anim Genet, 39(3):258-266.

Zhao, Y.F., N.Li, L.Xiao,G.S.Cao, Y.Z.Chen,S.Zhang, Y.F.Chen and C.X.Wu (1999). The retrotransponsons insert mutation of pig FSHb subunit gene and correlation with litter size. Science in China, 29(1):81-86.
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Article Type:Report
Geographic Code:9CHIN
Date:Jun 30, 2017
Words:4043
Previous Article:MITOCHONDRIAL DNA MARKER BASED PHYLOGENETIC ANALYSIS OF PAKISTANI NILGAI (Boselaphus tragocamelus).
Next Article:PREVALENCE OF TICK INFESTATION IN DIFFERENT BREEDS OF CATTLE IN BALOCHISTAN.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |