Printer Friendly

Pyramiding Resistance Genes to Northern Leaf Blight and Head Smut in Maize.

Byline: JIANG MIN, ZHANG CHUNYU, HUSSAIN KHALID, LI NAN, SUN QUAN, MIAO QING, WU SUWEN AND LIN FENG

ABSTRACT

Northern leaf blight (NLB) and head smut are two important diseases of maize (Zea mays) in China. The use of resistant cultivars is the most effective, economical and environmentally friendly means to cope with these diseases. For combining alleles for resistance to both NLB and head smut, parental inbred Ent17 with NLB resistance and parental inbred Ent12 with head smut resistance were crossed. The resistance screening for F2, F3 generations of the cross Ent17xEnt12 were conducted based on the phenotypic values and marker assisted-selection. Two pyramided lines carrying Ht1, Ht2 and head smut resistance QTL, three lines carrying Ht1 and head smut resistance QTL were found.

The result revealed that lines carrying Ht1, Ht2 and head smut QTL had resistance level and yield over donor Ent17, Ent12, lines carrying Ht1 and Ht2, and lines carrying Ht1 and head smut QTL, suggesting that marker assisted-selection strategy can be used effectively to select high yielding and resistance level in breeding materials in maize. (c) 2012 Friends Science Publishers

Key Words: Maize; Northern corn leaf blight; Head smut; Pyramiding; MAS

INTRODUCTION

Northern leaf blight (NLB), caused by Helminthosporium turcicum Pass., and head smut (HS), caused by Sphacelotheca reilana (KUhn) Clint, are two important diseases of maize (Zea mays) in China. The use of resistant cultivars is the most effective, economical, and environmentally friendly means to control epidemics of NLB and HS, and pyramiding of resistant genes/quantitative trait loci (QTLs) against both NLB and HS into elite cultivars would be a promising way to improve maize resistance against these diseases.

Marker assisted-breeding has been used to effectively integrate major genes or QTLs with large effect into single genotypes (Huang et al., 1997; Hittalmani et al., 2000; Castro et al., 2003a b; Richardson et al., 2006). The completion of maize genome sequence have made it possible to identify and map precisely a number of genes through linked DNA markers and improve desired traits by refined molecular breeding strategies (www.maizesequence.org/). There were many reports about molecular mapping on NLB resistance genes Ht1 (Bentolila et al., 1991; Van et al., 2001), Ht2 (Zaitlin et al., 1992; Van et al., 2001; Yin et al., 2003), Ht3 (Van et al., 2001), HtN (Simcox et al., 1993; Van et al., 2001) and QTL (Dingerdissen et al., 1996) and HS resistance QTL (Lu et al., 1999; LUbberstedt et al., 1999; Chen et al., 2008). Marker assisted-selection can be used for pyramiding these resistance genes and developing broad-spectrum resistance to NLB and HS.

According to the previously reported linked-markers to resistance genes Ht1, Ht2, Ht3, HtN1 and QTLs to NLB and head smut resistance QTLs, tightly linked SSR markers falling in or nearby the reported markers were chosen from the public database of maize genome (http://www.maizeGDB.org) to monitor the presence or absence of these genes in breeding populations. The objectives of this study were to pyramid the resistance genes to both NLB and head smut with the help of marker assisted-selection, to determine resistance levels of pyramiding resistance alleles.

MATERIALS AND METHODS

Plant materials and crosses: Parental inbred Ent17 with NLB resistance and parental inbred Ent12 with head smut resistance were provided by International Maize and Wheat Improvement Center (CYMMIT), parental inbred Liao3162 susceptible to both NLB and head smut were provided by Maize institute, Liaoning Academy of Agricultural Sciences, Shenyang, Liaoning Province, China. For combining alleles for resistance to both NLB and head smut, Ent17 was crossed with Ent12. The resistance screening for F2, F3 generations of the cross Ent17xEnt12 were conducted based on the phenotypic values and marker assisted-selection. The plants of F2 and lines of F3 with disease severity greater than or within two standard deviations of the mean susceptible control Liao3162 were discarded.

Disease assessments: Field experiments were conducted during the crop seasons of 2008 and 2009. In 2008 crop season, the parents, 5 F1 and 190 F2 seeds were space-planted about 8 cm apart for facilitating note-taking of individual plants and F3 generation was produced in the field in Shenyang, Liaoning Province, China. In 2009 spring, the two parents and 162 F3 resistance lines of Ent17xEnt12, with about 30 seeds from each line and completely randomized three replications, were planted in a 4m row with 20 cm apart between rows in two nurseries in Shenyang. Mixed isolates of H. turcicum races collected from diseased leaves in the field sections were used for NLB resistance assessment. The isolates were grown on lactose-casein hydrolysate agar. The cultures and medium were mixed with water in a Waring blender. Colony growth development was monitored by measuring colony diameter at 2 day intervals for 7 days or longer. The cultures prepared for inoculations were grown for 7 to 9 days and then harvested.

The resulting suspension was filtered through two layers of cheese cloth, and calibrated 20 mL of the inoculum containing 2x103 conidia/mL was sprayed using an approximately 8-L garden sprayer onto all the plants at three to five-leaf stage. At flowering stage around two months after the inoculations, severity of NLB was rated as a 0~9 scale, based on the percentage of plants showing NLB infection, in which 1=0~3% diseased leaf area, highly resistant, 3=6~10% diseased leaf area, resistant, 5=11~30% diseased leaf area, moderately resistant, 7=31~70% diseased leaf area, moderately susceptible, and 9=over 70% diseased leaf area, highly susceptible. The sori containing teliospores of S. reilana were collected from the field in the previous growing season and mixed with soil at a ratio of 1:1,000 before plantation. The mixture of soil and teliospores were used to cover maize kernels when sowing seeds to conduct artificial inoculation.

Individual plants at maturity stage were scored for the presence/absence of sorus in either ear or tassels as an indicator for susceptibility/resistance, and the mean percent disease incidence using averaged three replicate data was subjected for further analysis, where 0~5% highly resistant, 5~20% resistant, 20~50% susceptible and over 50% highly susceptible.

At maturity stage, averaged plant height data were collected for F3 lines. After harvest, the averaged ear length, ear diameter and kernel number per ear in F3 lines were scored.

Primer selection and PCR amplification: According to previously reported linked-markers to resistance genes Ht1, Ht2, Ht3, HtN1 and QTLs to NLB and resistance QTLs to head smut, tightly linked SSR markers falling in or nearby the reported markers were chosen from the public database of maize genome (http://www.maizeGDB.org) and synthesized by Baoshengwu Inc., Dalian, China. If the resistance gene fell in two linked marker interval, all SSR markers inside the interval from the public database of maize genome were selected, if the resistance gene was outside of the two linked marker interval, SSR markers were selected down to 10 cM in the vicinity of the closest linked marker to the resistance genes, and if there was only one marker linked to the resistance genes, SSR markers from the public database of maize genome were selected within the upper and lower 10 cM of the linked marker. Total 10 pairs of SSR markers were chosen to conduct the present study (Table I).

Genomic DNA was extracted from each plant for F1 and F2, and more than 5 plants of two-leaf stage seedlings for each of the parents, susceptible control Liao 3162 and F3 lines using the cetyltrimethyl ammonium bromide (CTAB) method (Saghai-Maroof et al., 1984). PCR amplifications were performed in a GeneAmp(r) PCR System 9700 Thermo-cycler and cycling profile were based on the protocol of Senior et al. (1993) with slight modifications. A 10 mL reaction mixture consisting of 25 ng of template DNA, 1.0 mL 10X PCR buffer (Boshengwu, Dalian, China), 0.6 unit of Taq DNA polymerase, 0.2 mM each of dCTP, dGTP, dTTP, and dATP and 0.2 mL of each primer (40 mmol/L) synthesized by Boshengwu, Dalian, China. After 5 min of denaturation at 94degC, amplifications were programmed for 30 consecutive cycles, each consisting of 45s at 94degC, 45s at either 55-65degC (depending on the individual SSR primer pairs), 1 min at 72degC and followed by a 10 min extension step at 72degC.

After amplification, 6 mL of formamide loading buffer [98% formamide, 10 mM EDTA (pH 8.0), 0.5% (W/V) xylene cyanol and 0.5% (W/V) bromophenol blue] was added to the PCR products. After 4 min denaturation at 94degC, 7 mL of the PCR product and loading buffer mixture for each sample was loaded in a 8% polyacrylamide gel. After electrophoresis, the gel was silver-stained according to the recommendation of the manufacturer.

Statistical analysis: F3 field data were used for the statistical analysis. Statistic software SPSS13.0 was employed to conduct analysis of variance (ANOVA). Genotypic variation (df=16) was partitioned into four parts according to Richardson et al. (2006): Parents (df=1), resistance lines (df=4), parents versus controls (df=2), and lines within QTLs (df=9). The pooled error term was used as the denominator for F-test.

RESULTS

The results for disease assessment in the field during 2008 showed that Ent17 was resistant to NLB (severity 5%)

Table I: Sequences of SSR primers used to identify resistance genes Ht1, Ht2, Ht3, HtN1 and head smut resistance QTLs

SSR primers###Sequences###Chromosome###Taget gene/QTL

bnlg198###GTTTGGTCTTGCTGAAAAATAAAA###GCTGGAGGCCTACATTATTATCTC###2.07###Ht1

bnlg1335###GAAGGTTGCTCTTCCACTGG###TGGTTTGTGCAAGTGTCACC###2.07###Ht1

umc2210###AGCGGGTCGATCTTTCTCTTAGTT###GATGCACCATTTCAGTGAGCGAT###8.06###Ht2

umc1665###CAATCAGGAGCCAGGGAGATG###CTTAAACTTGTCGAGACGGTCCTG###8.06###Ht2

umc1029###AACACCTGCTGGATATGGATCACT###GGAAGAAAAATGTCGACCTGCTC###7.04###Ht3

bnlg1666###GCTGGTAGCTTTCAGATGGC###TGTCCCTCCTCCAGTTTCAC###7.04###Ht3

bnlg240###AAGAACAGAAGGCATTGATACATAA###TGCAGGTGTATGGGCAGCTA###8.06###HtN1

umc1728###AGTACTTTCAGGCAGGGACCTTCT###AACGCACTTCTTGTAGCTGTAGGG###8.06###HtN1

bnlg1016###CCGACTGACTCGAGCTAACC###CCGTAACTTCCAAGAACCGA###1.04###QTL for heat smut

umc1849###TCCTTGTTGAAGATTTTATTTCTGCT###GGCTTTAAGTGATGCTCAAACGTA###1.04###QTL for heat smut

Table II: The selected pyramided-resistance lines through phenotyping and marker assisted-selection

Line No. and###Carrying NLB resistance###Plant height Ear length###Ear###Kernel number Severity of Severity of

parent###gene/head smut resistance QTL###(cm)###(cm)###Diameter (cm)###per ear###NLB (%)###head smut (%)

Line 7###QTL###285###14.41###4.62###455.20###3.76###0

Line 13###QTL###318###14.20###4.64###452.40###3.67###0

Line 28###QTL###292###14.58###4.55###458.33###3.53###0

Line 30###QTL###300###14.20###4.58###448.93###3.79###1

Line 2###Ht2###292###13.80###4.72###445.90###5.39###10

Line 18###Ht2###304###13.73###4.68###454.80###5.94###10

Line19###Ht2###312###14.02###4.82###448.50###5.90###6

Line4###Ht1 + Ht2###292###14.10###4.86###462.00###5.68###6

Line 9###Ht1 + Ht2###285###14.00###4.83###464.33###5.50###8

Line 3###Ht1 + QTL###318###14.63###4.37###463.28###3.98###0

LineS###Ht1 + QTL###292###14.57###4.41###462.16###3.86###0

Line 32###Ht1 + QTL###300###14.68###4.56###460.39###3.89###0

Line 16###Ht1+Ht2+ QTL###326###15.03###4.36###471.33###4.22###0

Line 31###Ht1+Ht2+ QTL###313###15.24###4.31###478.67###4.20###0

Ent17###Ht1 and Ht2###283###14.03###4.70###465.67###5.92###15

Ent12###QTL###252###14.62###4.58###456.30###0###0

Liao 3162###check###266###13.47###4.73###437.30###8.78###56.1

Note: QTL in the table refers to QTL with resistance to head smut

Table III: The results of variance analysis for agronomic, yield traits and resistance level

Confrast###F value

###Plant height###Ear length###Ear###Kernel number Severity of NLB Severity of head smut

###(cm)###(cm)###Diameter (cm)###per ear###(%)###(%)

Ht1 + Ht2 vs. Ent17###0.701###0.383###5.208###2.824###4.141###10.280

QTLvs Ent12###54.000###3.160###0.274###1.662###15.851###1.222

Ent17 vs Ent12###1.422###23.216###1.537###1677.653###1682.227###-

Ht1 + Ht2+QTL vs Ent17###2.686###4.787###5.476###16.706###67.590###75.000

Ht1 + Ht2+QTL vs Ent12###342.659###12.766###5.784###182.978###790.092###

Ht1 + Ht2+QTL vs Ht2###12.314###13.412###5.356###55.155###97.126###63.000

Ht1 + Ht2+QTL vs QTL###13.742###14.735###8.414###19.268###13.126###1.450

Ht1 + Ht2+QTL vs Ht1+ QTL###6.754###10.943###2.551###6.619###5.197###-

Ht1 + Ht2+QTL vs Ht1+ Ht2###16.589###42.781###20.849###39.759###75.846###40.800

Ht1 +QTL vs Ht2###7.664###10.405###2.911###4.794###288.746###74.000

Ht1 +QTL vs QTL###16.582###3.566###1.272###2.379###7.764###-

Ht1 +QTL vs Ht1+Ht2###18.175###13.134###5.370###0.238###253.786###45.600

Ht1+Ht2 vs Ht2###7.252###1.131###1.332###11.376###10.516###27.802

Ht1+Ht2 vs QTL###14.543###3.462###6.735###4.657###225.952###45.720

Note: QTL in the table refers to QTL with resistance to head smut

Denotes Note: F value is significant at P less than 0.05. Denotes that F value is significant at P less than 0.01

and susceptible to head smut (severity 45%), Ent12 was resistant to head smut (severity 10%) and susceptible to NLB (severity 75%). Susceptible check Liao3162 was susceptible to both NLB and head smut. F1 plants of cross Ent17xEnt12 were resistant to NLB and head smut. Among 190 F2 plants, 162 plants were resistant to NLB, or head smut, or both of them and 28 plants were susceptible to both NLB and head smut. In 2009 spring, 162 F3 resistant lines were assessed again in the field together with marker assisted-selection. Among the 162 F3 lines, lines 3, 5 and 32

Table IV: The contrast result for parents of resistant gene and QTL of pyramided lines

Source of variation###DF###F value

###Plant height Spike length###Ear###Kernel number Severity of NLB Severity of head

###(cm)###(cm)###Diameter (cm)###per ear###(%)###smut (%)

Replications###2###0.202###0.250###1.584###0.923###0084.###0.022

Genotypes###16###10.749###14.901###6.269###14.666###531.980###5857.841

Parents###1###1.422###23.216###1.537###1677.653###1682.227###-

Pyramided lines###4###5.142###37.170###19.022###28.844###255.348###9.250

Parents vs check###2###0.538###8.267###0.600###2342.197###1830.341###31758.242

Lines within pyramided lined

QTL###3###17.846###2.300###0.519###1.597###3.733###0.250

Ht2###2###4.825###0.761###0.795###2.503###17.307###-

HG +Ht2###1###2.774###0.527###0.303###1.512###2.859###-

Htl+ QTL###2###7.493###0.453###0.652###0.150###2.140###-

Hil +Ht2 + QTL###1###2.473###2.375###2.777###25.631###0.18###-

error###34###36.883###19.7059###4.06061###21.16276###3.73769###-

Note: QTL in the table refers to QTL with resistance to head smut

Denotes that F value is significant at Pc 0.05. Denotes that F value is significant at P less than 0.01

contained band patterns of SSR markers linked to Ht1 and head smut resistance QTL, lines 16 and 31 contained band patterns of SSR markers linked to Ht1, Ht2 and head smut resistance QTL (Table II). The other 157 F3 resistant lines only had band patterns of SSR markers linked to Ht1, or Ht2, or head smut resistant QTL, or none of them. In order to compare the agronomic traits and disease severity with above-mentioned 5 pyramided lines, three highly resistant lines (line 78, 81 and 110) only with band patterns of SSR markers linked to Ht1, three highly resistant lines (line 2, 18 and 19) only with band patterns of SSR markers linked to Ht2, and four highly resistant lines (line 7, 13, 28 and 30) only with band patterns of SSR markers linked to head smut resistance QTL were selected as checks for statistical analysis (Table II). In the 162 F3 resistant lines, no lines with band patterns of SSR markers linked to Ht3 and HtN1.

Meanwhile, the parent Ent17 and Ent12 were also not found to have the band patterns of SSR markers linked to Ht3 and HtN1, suggesting that parent Ent 17 and Ent 12 did not carry Ht3 and HtN1. Furthermore, there were not Ht3 and HtN1 resistant genes among the 162 F3 resistant lines.

ANOVA revealed significant differences between pyramided lines for the resistance level, agronomic and yield traits (Tables III and IV) Ent17 with Ht1 and Ht2, Ent12 with head smut resistance QTL were significantly different from susceptible check Liao3162 for all components. There were significant differences between Ent17 and Ent12 for the resistance level and yield traits.

Comparing pyramided lines carrying Ht1 and Ht2 with resistance donor Ent17, lines carrying head smut resistance QTL alleles with resistance donor Ent12, no significant differences were found for all the components. Pyramided lines with Ht1, Ht2 and QTL showed significant differences from Ent17 for yield traits and NLB resistance level, from Ent12, lines with Ht2 and lines with Ht1 and Ht2 for all the components. By comparing lines carrying Ht1 and head smut resistance QTL with lines carrying Ht1, lines carrying Ht2, lines carrying head smut resistance QTL, and lines carrying Ht1 and Ht2, it was revealed significant differences for the yield traits and resistance level. Lines carrying Ht1 and Ht2 were significantly different from lines carrying Ht2 for the agronomic traits and resistance level, from lines carrying head smut resistance QTL for all the components.

DISCUSSION

Conventional breeders select genotypes indirectly through phenotype traits. Experienced breeders can accurately judge phenotype traits, overcome the influence of environmental factors on phenotype traits, and implement intentional selection during self-cross breeding. However, selection from early generations, like F2 or F3 generations, often leads to the wrong choice due to the subjectivity and influence of environmental factors on phenotypic traits, which the selected plants or lines have no target traits or required genetic background, especially for head smut breeding because of its quantitative traits. With the help of molecular markers tightly linked to resistance genes, marker-assisted breeding will help the breeders to make selection at early stage, provide opportunities for breeders to pyramid different resistance genes and develop high-yielding, multi-resistant maize inbred lines.

There are many reports about the use of marker-assisted technology leading to the release of varieties in different crop species. With the help of marker-assisted selection and genetic transformation, an elite Indica rice line IR50 was obtained by pyramiding blast resistance gene Piz5 and bacterial blight resistance gene Xa21 (Narayanan et al., 2002).

New soybean lines pyramided genes Rsv1, Rsv3, and Rsv4 for SMV resistance using microsatellite markers have been successfully developed (Shi et al., 2009). In order to avoid the selection of new virus strains and to create more durable resistances, pyramiding of resistance genes has been effectively used as a promising strategy (Werner et al., 2005).

The present study is an early stage for pyramiding breeding (Fig. 1). F1 was just for producing F2, F3 and more advanced generations. The phenotype resistance assessment combined with marker assisted-selection started from F2. Due to non-repeatable F2 data, data from F3 generation was employed to preliminarily explain pyramiding resistance genes/QTLs to both NLB and head smut using statistical program SPSS. Two pyramided lines carrying Ht1, Ht2 and head smut resistance QTL, three lines carrying Ht1 and head smut resistance QTL were found. Comparing with conventional phenotypic selection, marker assisted-selection had exact choice for required genetic background and pyramided inbred lines could be created after 4-5 generations proceeding selection from F2 (Fig. 1).

The ANOVA analysis revealed that lines carrying Ht1, Ht2 and head smut QTL had resistance level and yield over parental lines Ent17 and Ent12, lines carrying Ht1 and Ht2, and lines carrying Ht1 and head smut QTL, suggesting that marker assisted-selection strategy can be used effectively to select high yield and high resistance level breeding materials in maize.

Acknowledgement: This study was supported by Liaoning Provincial Educational Department Project (2009.1-2012.12), Shenyang Scientific Instrument Project (2009.1-2012.12) and Shenyang basic research for application project (F10-205-1-24).

REFERENCES

Bentolila, S., C. Cuitton, N. Bouvet, A. Sailland, S. Nykaze and G. Freysainet, 1991. Identification of RFLP marker tightly linked to the Ht1 gene in maize. Theor. Appl. Genet., 82: 393-398

Castro, A.J., F. Capettini, A.E. Corey, T, Filichkina, P.M. Hayes, A. Kleinhofs, D. Kudrna, K. Richardson, S. Sandoval-Islas, C. Rossi and H. Vivar, 2003a. Mapping and pyramiding of qualitative and quantitative resistance to stripe rust in barley. Theor. Appl. Genet., 107: 922-930

Castro, A.J., X.M. Chen, P.M. Hayes and M. Johnston, 2003b. Pyramiding Quantitative Trait Locus (QTL) Alleles Determining Resistance to Barley Stripe Rust: Effects on Resistance at the Seedling Stage. Crop Sci., 43: 651-659

Chen, Y.S., Q. Chao, G.Q. Tan, J. Zhao, M.J. Zhang, Q. Ji and M.L. Xu, 2008. Identification and fine-mapping of a major QTL conferring resistance against head smut in maize. Theor. Appl. Genet., 117: 1241-1252

Dingerdissen, A.L., H.H. Geiger, M. Lee, A. Schechert and H.G. Welz, 1996. Interval mapping of genes for quantitative resistance of maize to setosphaeria turcica, cause of northern leaf blight, in a tropical environment. Mol. Breed., 2: 143-156

Hittalmani, S., A. Parco, T.V. Mew and Z.N. Huang, 2000. Fine mapping and DNA marker-Asisted pyramiding of the three major genes for blast resistance in rice. Theor. Appl. Genet., 100: 1121-1128

Huang, N., E.R. Angeles, J. Domingo, G. Magpantay, S. Singh, G. Zhang, N. Kumaravadivel, J. Bennett and G.S. Khush, 1997. Pyramiding of bacterial blight resistance genes in rice: maker-assisted selection using RFLP and PCR. Theor. Appl. Genet., 95: 313-320

Lu, X.W. and J.L. Brewbaker, 1999. Molecular mapping of QTLs conferring resistance to Sphacelotheca reiliana (KUhn) Clint. Maize Genet. Cooper. Newslett., 73: 361-369

LUbberstedt, T.G., X. Liu, A.E. Melchinger and X.C. Xia, 1999. QTL mapping of resistance to Sporisorium reiliana in maize. Theor. Appl. Genet., 99: 593-598

Narayanan, N.N., N. Baisakh, C.M. Vera Cruz, S.S. Gnanamanickam, K. Datta and S.K. Datta, 2002. Molecular breeding for the development of Blast and Bacterial Blight resistance in Rice cv. IR50. Crop Sci., 42: 2072-2079

Richardson, K.L., M.I. Vales, J.G. Kling, C.C. Mundt and P.M. Hayes, 2006. Pyramiding and dissecting disease resistance QTL to barley stripe rust. Theor. Appl. Genet., 113: 485-495

Saghai-Maroof, M.A., K. Soliman, R.A. Jorgensen and R.W. Allard, 1984. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA, 81: 8014-8018

Shi, Y., H. Kui, X. Guo, Z. Gu, Y. Wang and A. Wang, 2009. Genetic linkage map of the pearl oyster, Pinctada martensii (Dunker). Aquacult. Res., 41: 35-44

Simcox, K.D., M. McMullen and R. Louie, 1993. Mapping the HtN1 resistance gene to the long arm of chromosome 8. Maize Genet. Cooper. Newslett., 67: 118-119

Van, S.D., C.A. Lambert and A. Lehmensick, 2001. Scar markers for the Ht1, Ht2, Ht3 and HtN1 resistance genes in maize. Maize Genet. Conf. Abst., 43: 134

Werner, K., W. Friedt and F. Ordon, 2005. Strategies for pyramiding resistance genes against the barley yellow mosaic virus complex (BaMMV, BaYMV, BaYMV-2). Mol. Breed., 16: 45-55

Yin, X.Y., Q.H. Wang, J.L. Yang, D.M. Jin, F. Wang, B. Wang and J.R. Zhang, 2003. Fine mapping of the Ht2 (Helminthosporium turcicum resistance 2) gene in maize. Chinese Sci. Bull., 48: 165-169

Zaitlin, D., S. DeMars and M. Gupta, 1992. Linkage of a second gene for NCLB resistance to molecular markers in maize. Maize Genet. Cooper. Newslett., 66: 69-70

Biotechnology and Bioscience College, Shenyang Agricultural University, Shenyang (110866), China, +Department of Botany, University of Gujrat (UoG), Gujrat (50700), Pakistan, ++Maize Institute, Liaoning Academy of Agricultural Sciences, Shenyang (110161), China, PCollege of Science Institute, Shenyang Agricultural University, Shenyang (110161), China, 1Corresponding author's e-mail: fenglinsn@126.com; wusuwen001@126.com
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Jiang Min; Zhang Chunyu; Hussain Khalid; Li Nan; Sun Quan; Miao Qing; Wu Suwen; Lin Feng
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9CHIN
Date:Jun 30, 2012
Words:4031
Previous Article:Determination of Pollen Production and Quality attributes of some Almond Cultivars (Prunus dulcis) and Selected Wild Almond (Amygdalus orientalis)...
Next Article:Effects of Dietary Available Phosphorus and Microbial Phytase on Growth Performance, Carcass Traits, Serum Minerals and Toe Ash Content in Broiler...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters