Printer Friendly

Psoralen reverses docetaxel-induced multidrug resistance in A549/D16 human lung cancer cells lines.

ABSTRACT

Chemotherapy is the recommended treatment for advanced-stage cancers. However, the emergence of multidrug resistance (MDR), the ability of cancer cells to become simultaneously resistant to different drugs, limits the efficacy of chemotherapy. Previous studies have shown that herbal medicine or natural food may be feasible for various cancers as potent chemopreventive drug. This study aims to explore the capability of reversing the multidrug resistance of docetaxel (DOC)-resistant A549 cells (A549/D16) of psoralen and the underlying mechanisms. In this study, results showed that the cell viability of A549/D16 subline is decreased when treated with psoralen plus DOC, while psoralen has no effect on the cell proliferation on A549 and A549/D16 cells. Furthermore, mRNA and proteins levels of ABCB1 were decreased in the presence of psoralen, while decreased ABCB1 activity was also revealed by flow cytometry. Based on these results, we believe that psoralen may be feasible for reversing the multidrug resistance by inhibiting ABCB1 gene and protein expression. Such inhibition will lead to a decrease in ABCB1 activity and anti-cancer drug efflux, which eventually result in drug resistance reversal and therefore, sensitizing drug-resistant cells to death in combination with chemotherapeutic drugs.

Keywords:

Multidrug resistance

P-Glycoprotein

ABCB1

Psoralen

Docetaxel

Lung cancer

Introduction

Lung cancer is the second most frequently diagnosed cancer (Jemal et al., 2009). For inoperable and advanced-stage lung cancer cased, chemotherapy has been the optimal treatment choice. However, the ability of cancer cells to become simultaneously resistant to different drugs, a trait known as multidrug resistance (MDR), limits the efficacy of chemotherapy (Baird and Kaye, 2003). Extensive studies have revealed that the main mechanism of multidrug resistance is via the efflux mechanism based on the function of P-glycoprotein (Johnstone et al., 2000) As a member of the large ATP-binding cassette (ABC) family of membrane proteins, P-glycoprotein is the product of MDR-1 gene Qohnstone et al., 2000; Stavrovskaya, 2000). ABC transporters, consisting of P-glycoprotein (P-gp/ABCB1), multidrug resistance proteins (MRPs/ABCCs), and breast cancer resistance protein (BCRP/ABCG2), function as ATP-dependent drug efflux transporters by forming a unique defense network against multiple chemotherapeutic drugs and cellular metabolites (Tan et al., 2000). To date, 13 genes of ABC transporters have been found to be associated with drug resistance and drug transport (Gillet et al., 2007). In addition to the contribution for drug resistance at the cellular level, P-glycoprotein is also able to change the pharmacokinetics of various drugs and correlates with poor bioavailabiiity (Glavinas et al., 2004; Varma et al., 2003; Johnson, 2002). Therefore, inhibition of P-glycoprotein mediated drug efflux will lead to re-sensitization of multidrug resistance cancer cells to chemotherapeutic agents, and may allow a successful chemotherapy for originally multidrug resistant tumors (Fojo and Bates, 2003).

[FIGURE 1 OMITTED]

As one of many clinical anticancer drugs that may induce multidrug resistance, Docetaxel (DOC) has anti-mitotic properties through the binding to microtubules (MTs) and prevention of depolymerization and stabilization of microtubules (Fitzpatrick and Wheeler, 2003). These effects of DOC are correlated with mitotic arrest and cellular toxicity (Cohen et al., 1992). DOC has been applied clinically and successfully as part of various cancer chemotherapy regimens (Davies et al., 2003; Green, 2002). Since DOC is a substrate of ABCB1 transporter, the emergence of ABCB1 overexpression in cancer cells is considered the major phenotype of MDR to DOC (McGrogan et al., 2008).

[FIGURE 2 OMITTED]

Chinese herbal medicine has been widely used to prevent and treat diseases for thousands of years. Psoralen (also called Psoralen) (Fig. 1 A) is the parent compound in a family of natural products known as furocoumarins and the main active ingredients extracted from the fruits of Psoralea corylifolia L. It has been reported that psoralen had stimulatory effect on collagen matrix on new bone formation in vivo (Wong and Rabie, 2011). Psoralen promoted osteoblast differentiation by activation of BMP signaling and could be a potential anabolic agent to treat patients with bone loss-associated disease (Tang et al., 2011). Furthermore, psoralen can form DNA interstrand cross-links upon activation with UVA radiation, and the cross-links repair may involve DNA double strand breaks and/or recombination (Finlan et al., 2005; Toyooka and Ibuki, 2009). However, effects of psoralen on anti-multidrug resistance and the molecular mechanisms remain poorly unknown. In this study, a cell model derived from A549 cells was established with DOC as selection agent. Under continuous exposure, a DOC drug resistant subline, A549/D16, was obtained for investigation. The anti-multidrug resistance activity of psoralen in A549/D16 drug resistant subline was determined and clarified to demonstrate that psoralen is capable of reversing the resistance in DOC drug-resistant subline through inhibition the expression of ABCB1 gene.

[FIGURE 3 OMITTED]

Materials and methods

Chemicals

Psoralen of [greater than or equal to] 99% purity was purchased from Sigma (St. Louis, MO) and stock solution of lOmM concentration was prepared in dimethyl sulfoxide (DMSO) (Sigma, St. Louis Co.) and stored at -20 [degrees]C. The final concentration of DMSO for all treatments was less than 0.1%. Other chemicals, including 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT), Docetaxel (DOC, 10 mg), Doxorubicin and rhodamine-123 were, also obtained from Sigma Chemical Co. (St. Louis, MO, USA).

Cell culture

The process of drug-resistant A549 cell lines establish, as previously described (Chiu et al., 2010). Briefly, Human adenocarcinoma A549 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 1% NEAA, 1 mM glutamine, 1% penicillin/streptomycin, 1.5 g/1 sodium bicarbonate, and 1 mM sodium pyruvate (Sigma, St. Louis, MO, USA). The cell cultures were maintained at 37 [degrees]C in a humidified atmosphere of 5% C[O.sub.2]. A549 cells in low cellular density were seeded onto 10cm culture dish and treated with 0.5 nM DOC until the surviving cells grew to an obvious colony. The selected colony was amplified in the presence of 0.5 nM DOC until confluence before the drug dose increased in multiples of two for the next round of selection. The DOC-resistant subline maintained at 16nM DOC is denoted as A549/D16.

[FIGURE 4 OMITTED]

Cell cytotoxicity assay

The effect of psoralen on cell growth was assayed by the MTT method, as previously described (Chiu et al., 2010). Briefly, cells were cultured in 24-well plates (4 x [10.sup.4] cells/well) and stimulated for 24 h with different concentrations of psoralen. After 24 h, MTT was added to each well and further incubated for 4 h. The viable cell number was directly proportional to the production of formazan following the solubilization with isopropanol. The color intensity was measured at 570 nm. Each condition was performed in 3 replicate wells and data were obtained from at least 3 separate experiments.

RNA extraction, reverse transcription-PCR (RT-PCR) and real-time PCR

Cellular RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) and then subjected to a reverse transcription reaction using oligo (dT) primers and M-MLV Reverse Transcriptase (Promega, Madison, USA) according to the manufacturer's protocol. Resultant cDNA was initially dissolved in 30 [micro]l DEPC-[H.sub.2]O used in the following PCR reactions with primers specific for ABCB1 (forward primer 5'-TGACATTTATTCAAAGTTAAAAGCA-3', reverse primer 5'- TAGACACTTTATGCAAACATTTCAA -3') (Szakacs et al., 2004) and GAPDH. The thermal cycling conditions comprised an initial denaturation at 94 [degrees]C for 5 min, followed by 20 cycles of denaturation at 94 [degrees]C for 1 min, annealing at 58 [degrees]C for 30 s, and extension at 72 [degrees]C for 1 min. The final extension step was conducted at 72 [degrees]C for 5 min. The PCR products were analyzed by electrophoresis on 1.5% agarose gel and then quantified using Chemilmager 4400 software (Alpha lnnotech, San Leandro, CA). Real-time PCRanalysis was performed using SYBR green (Applied Biosystems) on Applied Biosystems StepOne RealTime PCR System. Expression data were normalized with GAPDH as the internal control.

Construction of ABCB1 promoter reporter plasmid and cell transfection

The ABCB1 promoter reporter plasmid was constructed, as previously described (Sun et al., 2011). Human genomic DNA was prepared from human whole blood using the phenol/chloroform extraction protocol. A DNA fragment containing ABCB1 promoter was obtained from PCR amplification with primers (forward primer 5'-GGGGTACCCCAGTCTCTACG-3', reverse primer 5'-CAAGCTTGTC CGACCTGAAGAG-3') on human genomic DNA. PCR reaction was carried out for 30 cycles at 94 [degrees]C for 30 s, 60 [degrees]C for 50 s, and 72 [degrees]C for 2 min, with a final extension of 10 min at 72 [degrees]C. The PCR product was cloned into the KpnI/HindIII site of the pGL3-basic vector. A549 cells were plated in a 6-well plate at a density of 4 x 105 cells/well. After 24 h, cells were co-transfected with 2 [micro]g of ABCB1-promoter plasmid and [beta]-galactosidase expression vector (pCH110) by lipofectamine 2000 reagent (Invitrogen, Life Technologies) according to the manufacturer's instructions. After being exposed to the DNAs for 6h, cells were reseeded in 96-well plates and Psoralen was added. After 24 h, the cell lysates were harvested with extraction buffer (25 mM glycine, pH 7.8, 15 mM MgS[O.sub.4], 4mM EGTA and 1%Triton X-100), and luciferase activity was determined using a luciferase assay kit. The value of the luciferase activity was normalized to transfection efficiency and monitored by [beta]-galactosidase expression.

Western blot analysis

Cell lysates were separated in a 10% polyacrylamide gel and transferred onto a PVDF membrane (Millipore Corporation, Milford, MA, USA). The blot was subsequently incubated with 3% non-fat milk in PBS for 1 h to block non-specific binding, and probed with a corresponding antibody against a specific protein (ABCB1 was obtained from Santa Cruz Biotechnology; [beta]-actin were obtained from BD Biosciences, USA) for 37 [degrees]C at 2 h or overnight at 4 [degrees]C, and then with an appropriate peroxidase conjugated secondary antibody for 1 h. After the final washing, signal was developed by ECL detection system and relative photographic density was quantitated by a gel documentation and analysis system (Alpha Imager 2000, Alpha lnnotech Corporation).

Rhodamin-123 flow cytometry assay

As previously described (Calatozzolo et al., 2005), suspensions of logarithmic phase cells were obtained from culture plates by trypsin. During the accumulation period, cells were resuspended in rhodamine-containing medium (improved minimum essential medium with 10% FBS and 0.1 [micro]g/ml rhodamine-123) and incubated in 5% C[O.sub.2] for 30 min. After the accumulation period, efflux was initiated by sedimentation at 800 rpm and resuspension in rhodamine-free medium (improved minimum essential medium with 10% FBS) at 37 [degrees]C in 5% C[O.sub.2] for 90 min. At the end of both the accumulation and efflux periods, cells were collected and washed in ice-cold Hanks' buffered salt solution. The washed cells were placed in Hanks' buffered salt solution with 10% FBS on ice, and kept in the dark until flow cytometry analysis. Samples were analyzed on a FACScan flow cytometer (Becton Dickinson) equipped with a 488 nm argon laser. The green fluorescence of rhodamine-123 was observed with a 530 nm band pass filter.

[FIGURE 5 OMITTED]

Annexin V/PI double staining

An FITC Annexin V Apoptosis Detection Kit 1 was used to quantify cell numbers in different stages of cell death. Briefly, 1 x [10.sup.5] cells were resuspended in 100 [micro]l 1 x binding buffer (0.01 M Hepes/NaOH (pH 7.4), 0.14 M NaCl, 2.5 mM Ca[Cl.sub.2]). With an addition of 5 [micro]l FITC Annexin V and 5 [micro]l PI, the cell suspension was gently mixed and then incubated for 15 min at room temperature in the dark. Afterwards, 400 [micro]l of 1 x binding buffer was added to each tube followed by flow cytometry analysis within 1 h.

Statistical analysis

All experiments were done in triplicate and results are shown as the mean [+ or -] SD. SigmaPlot[R], version 10 was used for data analysis and graphic presentation. Statistical significances of difference throughout this study were calculated by Student's t-test with p<0.05 being regarded as statistically significant.

Result

The lack of cytotoxic effects of psoralen on A549 and A549/D16 cells

To determine the cytotoxic effects of psoralen in parental A549 and A549/D16 cell lines, cells were treated with various concentrations of psoralen (0-20 [micro]M) for 24 h. As shown in Fig. IB, even at the highest concentration of 20 [micro]M, psoralen did not alter viability of A549 and A549/D16 cells, as compared to that of controls. To further determine the cytotoxic effects of psoralen in A549 and A549/D16 cell lines, cells were treated with psoralen. Furthermore, after a treatment of 20 [micro]M psoralen for 48 h, no significant cell death was observed (Fig. 1C). These results indicated that psoralen has no cytotoxic effect or inhibitory effect on cell proliferation in A549 and A549/D16 cell lines.

In vitro reversal of multidrug resistance by psoralen

Based on the lack of cytotoxicity of psoralen alone, the effect of a combination treatment of DOC (16 nM) with different concentrations of psoralen was tested to see if the sensitivity of A549/D16 ells to DOC could be enhanced by psoralen. While the viability of A549/D16 cells was not reduced by psoralen alone, the addition of psoralen has re-sensitizedA549/D16 cells re-sensitized to DOC toxicity in a dose-dependent manner (Fig. 2a). To further explore such reversal, cells were treated with 20 [micro]M Psoralen plus 16nM DOC for various time intervals. As results shown in Fig. 2b, significant cell death was observed after 24 and 48 h in the presence of psoralen plus DOC (Fig. 2b). These results showed that although psoralen has no inhibitory effect on cell proliferation, it could reverse DOC-resistance of A549/D16 cells and therefore enhance DOC-induced cell death.

Reduced ABCB1 expression by psoralen

Previous studies with microarray analysis and qRT-PCR have shown that ABCB1 expression of A549/D16 cells were significantly up-regulated (Calatozzolo et al., 2005). ABCB1 is one of ATP-binding cassette family and has been found to be associated with drug resistance and drug transport (Calatozzolo et al., 2005). To further determine the underlying mechanisms of enhanced DOCinduced cell death by psoralen, reverse transcription-PCR(RT-PCR), quantitative real-time PCR, and promoter reporterassays were conducted to evaluate the effects of psoralen on ABCB1 expression in A549/D16 cells. Cells were treated with 0, 5,10, and 20 [micro]M of psoralen in the presence or absence of 16nM DOC for 24 h and were then subjected to RT-PCR and real-time RT-PCR for the expression of ABCB1 gene in A549/D16 cells. Results showed that ABCB1 mRNA levels were significantly decreased by psoralen alone (Fig. 3a and b) in a concentration-dependent manner, as shown by results from real-time RT-PCR (Fig. 3c). Similar results were also observed in cells treated with psoralen plus DOC. Results in Fig. 3d showed that the luciferase activity of ABCB1 was significantly suppressed. Psoralen treated A549/D16 cells were also subjected to western blotting analysis to show that ABCB1 protein level was significantly decreased by psoralen, whether in the presence or absence of DOC (Fig. 4a and b). These results show that psoralen reduce the expression of ABCB1, at least partially, at a transcriptional level.

[FIGURE 6 OMITTED]

Reduced ABCB1 activity by psoralen as shown by rhodamin-123 efflux assay

Since the expression levels of ABCB1 were significantly decreased in psoralen-treated A549/D16 subline, the activity of ABCB1 was further examined by rhodamin-123 efflux assay. Low retention of fluorescent dye inside of the cells indicates high activity of the energy-dependent ABCB1 pumping activity. Therefore, rhodamin-123 assay can be used to monitor the specific activity of ABCB1 protein. Without psoralen, the mean fluorescence intensity values of histograms showed that the fluorescence level decreased in A549/D16 subline, as compared with that of A549 (Fig. 5a). The rhodamin-123 efflux activities of drug resistant A549/D16 subline correlated with their ABCB1 expression levels The ABCB1 activity of parental A549 cells was not affected by psoralen treatment. With a treatment of psoralen, the fluorescence level of A549/D16 subline was increased from 27.63 to 30.42 in a dose-dependent manner (Fig. 5b-d). The results showed that psoralen inhibits ABCB1 pumping activity to enhance intracellular rhodamin-123 accumulation, which then results a higher retention of fluorescent dye. To provide more compelling evidence, the activity of ABCB1 was further examined by doxorubicin (DXR) efflux assay. Via MTT toxicity assays (Fig. 6A) and Annexin V double staining (Fig. 6B), the A549/D16 subline showed higher resistance to DXR when compared with parental A549 cells. Not surprisingly, this result is consistent with the previous studies (Chiu et al., 2010). In Fig. 6C, with a treatment of psoralen, the fluorescence intensity level of A549/D16 subline was increased in a dose-dependent manner. The results provide more evidence suggest that psoralen inhibits ABCB1 pumping activity.

Discussion

Multidrug resistance (MDR) has been an exhausting and frustrating problem, which greatly limits the efficiency of chemotherapy for lung cancer of advanced stages (Baird and Kaye, 2003). As studies indicated that one of the mechanisms of multidrug resistance is P-glycoprotein overexpression (Calatozzolo et al., 2005), which enhances the function of drug-efflux pump and eventually leads to reduced intracellular concentration of drugs in multidrug resistance cancer cells. Previous efforts for reversal of multidrug resistance augments the therapeutic effects of anticancer drugs with modulators include inhibitors of the drug-efflux pump or various compounds, such as cyclosporin, tamoxifen (Liscovitch and Lavie, 2002; Sweet et al., 1989; Lavie et al., 1997). Nevertheless, has been widely used to prevent and treat various diseases, including cancers, with surprising success. Nowadays, the feasibility of Chinese traditional medicine in fighting against multidrug resistance has raised a lot of attention and initially begun to be investigated (Chai et al., 2010).

In our preliminary search for Chinese herbal medicine with anti-MDR capability, MTT assays revealed that psoralen exhibit only slight cytotoxicity to A549 and A549/D16 cells. However, the cell viability of A549/D16 subline was apparently decreased by a combination of psoralen with DOC (Fig. 2). The results suggested that psoralen produced a reversal effect of resistance to DOC at a concentration of 20 [micro]M. Since previous studies have shown that ABCB1 mRNA level of A549/D16 is higher than that in parental A549 cells, RT-PCR and real-time RT-PCR were then conducted to show that ABCB1 mRNA levels in A549/D16 cells were significantly decreased by psoralen, and even further decreased by a combination with DOC, which initially has no effect on ABCB1 expression (Fig. 3). Similar synergic effect was seen for the protein levels of ABCB1. Together with the suppression of luciferase activity of ABCB1 by psoralen, we believe that psoralen regulates the expression of ABCB1, at least partially, at a transcriptional level. Further analysis with flow cytometry also revealed an inhibitory capability of psoralen for ABCB1 pumping activity, which led to enhanced intracellular rhodamin-123 accumulation and eventually increased fluorescence level as shown in Figs. 5 and 6. Such capability for inhibiting ABCB1 pumping activity has also been reported for artesunate, and bufalin on CEM/E1000 MDR leukemia cell line. In that study done by Efferth and his colleagues, results from flow cytometry showed that artesunate significantly increased daunorubicin accumulation in epirubicin-selected multidrug resistance-related protein 1 (MRP1)-expressing CEM/epirubicin (E)1000 cells, but not in vinblastine-selected Pgp/MDRl-expressing CEM/vinblastine (VLB)100, or drug sensitive CCRF-CEM leukemia cells. Furthermore, artesunate and bufalin showed both antileukemic activity when applied alone and modulation activity when applied in combination with daunorubicin in multidrug-resistant cells, these two drugs have been recommended for novel combination treatment regimens for leukemia (Efferth et al., 2002).

Previous study shown that six natural coumarins (umbelliferone, esculin, esculetin, cnidiadin, angelicin and psoralen), only cnidiadin was capable of significantly accumulating rhodamin-123 and inhibit ABCB1 photolabeling in MDR1-transfected MadinDarby canine kidney (MDCK-MDR1) cells (Barthomeuf et al., 2005). This study indicate that the results of psoralen decrease ABCB1 expression and capability inhibit ABCB1 pumping activity may have cellular specific correlation. However, this requires have more studies to confirm. An important use of psoralen is in PUVA treatment for skin problems such as psoriasis, eczema and vitiligo. This takes advantage of the high UV absorbance of psoralen. Therefore, the PUVA therapy (psoralen therapy) might sensitize for chemotherapy by P-glycoprotein inhibition. It may a novel implication of the future work.

Conclusion

In conclusion, these data show that psoralen can effectively reverse multidrug resistance, via inhibiting the activity of ABCB1 promoter, down-regulating ABCB1 gene, expression and inhibiting the function of ABCB1 and eventually sensitizing drug-resistant cells to death in combination with chemotherapeutic drugs. Such capability had made psoralen a potential remedy to overcome the multidrug resistance involving ABCB1.

ARTICLE INFO

Article history:

Received 13 November 2013

Received in revised form 18 January 2014

Accepted 2 March 2014

Conflict of interest

The authors declare that there are no conflicts of interest.

Acknowledgements

This study was supported by grants from National Science Council Taiwan (NSC102-2320-B-040-014). The authors of the manuscript do not have a direct financial relation with the commercial identity mentioned in this paper.

References

Baird, R.D., Kaye, S.B., 2003. Drug resistance reversal--are we getting closer? Eur. J. Cancer 39, 2450-2461.

Barthomeuf, C., Grassi. J., Demeule, M., Fournier, C., Boivin, D., Beliveau, R., 2005. Inhibition of P-glycoprotein transport function and reversion of MDR1 multidrug resistance by cnidiadin. Cancer Chemother. Pharmacol. 56, 173-181.

Calatozzolo, C., Gelati, M., Ciusani, E., Sciacca, F.L., Polio, B., Cajola, L., Marras, C., Silvani, A., Vitellaro-Zuccarello, L., Croci, D., Boiardi, A., Salmaggi, A., 2005. Expression of drug resistance proteins Pg[micro]MRP1, MRP3, MRP5 and GST-pi in human glioma. J. Neurooncol. 74, 113-121.

Chai, S., To, K.K., Lin, G., 2010. Circumvention of multi-drug resistance of cancer cells by Chinese herbal medicines. Clin. Med. 5, 26.

Chiu, L.Y., Ko.J.L., Lee, Y.J., Yang, T.Y., Tee, Y.T., Sheu, G.T., 2010. L-type calcium channel blockers reverse docetaxel and vincristine-induced multidrug resistance independent of ABCB1 expression in human lung cancer cell lines. Toxicol. Lett. 192, 408-418.

Cohen, D., Higman, S.M., Hsu, S.I., Horwitz, S.B., 1992. The involvement of a LINE-1 element in a DNA rearrangement upstream of the mdr1a gene in a taxol multidrug-resistant murine cell line. J. Biol. Chem. 267, 20248-20254.

Davies, A.M., Lara Jr., P.N., Mack, P.C., Gandara, D.R., 2003. Docetaxel in non-small cell lung cancer: a review. Expert Opin. Pharmacother. 4, 553-565.

Efferth, T., Davey, M., Olbrich, A., Rucker, G., Gebhart, E., Davey, R., 2002. Activity of drugs from traditional Chinese medicine toward sensitive and MDR1- or MRP1-overexpressing multidrug-resistant human CCRF-CEM leukemia cells. Blood Cells. Mol. Dis. 28, 160-168.

Finlan, L.E., Kernohan, N.M., Thomson, G., Beattie, P.E., Hupp, T.R., Ibbotson, S.H., 2005. Differential effects of 5-aminolaevulinic acid photodynamic therapy and psoralen + ultraviolet A therapy on p53 phosphorylation in normal human skin in vivo. Br. J. Dermatol. 153, 1001-1010.

Fitzpatrick, F.A., Wheeler, R., 2003. The immunopharmacology of paclitaxel (Taxol), docetaxel (Taxotere), and related agents. Int. Immunopharmacol. 3.1699-1714.

Fojo, T., Bates, S., 2003. Strategies for reversing drug resistance. Oncogene 22, 7512-7523 (Review).

Gillet, J.P., Efferth, T., Remade, J., 2007. Chemotherapy-induced resistance by ATP binding cassette transporter genes. Biochim. Biophys. Acta 1775, 237-262.

Glavinas, H., Krajcsi, P., Cserepes, J., Sarkadi, B., 2004. The role of ABC transporters in drug resistance, metabolism and toxicity. Curr Drug Deliv. 1, 27-142.

Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., Thun, M.J., 2009. CA Cancer. J Clin. 59, 225-249.

Green, M.R., 2002. Perspectives and opportunities: docetaxel in the current and future treatment of non-small cell lung cancer. Semin. Oncol. 29, 17-21. Johnstone, R.W., Ruefli, A.A., Smyth, M.J., 2000. Multiple physiological functions for multidrug transporter P-glycoprotein? Trends Biochem. Sci. 25, 1-6.

Johnson, W.W., 2002. P-glycoprotein-mediated efflux as a major factor in the variance of absorption and distribution of drugs: modulation of chemotherapy resistance. Methods Find. Exp. Clin. Pharmacol. 24, 501-514 (Review).

Lavie, Y., Cao Ht Volner, A., Lucci, A., Han, T.Y., Geffen, V., Giuliano, A.E., Cabot, M.C., 1997. Agents that reverse multidrug resistance, tamoxifen, verapamil, and cyclosporin A, block glycosphingolipid metabolism by inhibiting ceramide glycosylation in human cancer cells. J. Biol. Chem. 272, 1682-1687.

Liscovitch, M., Lavie, Y., 2002. Cancer multidrug resistance: a review of recent drug discovery research. IDrugs 5, 349-355.

McGrogan, B.T., Gilmartin, B., Carney, D.N., McCann, A., 2008. Taxanes, microtubules and chemoresistant breast cancer. Biochim. Biophys. Acta 1785, 96-132.

Stavrovskaya, A.A., 2000. Cellular mechanisms of multidrug resistance of tumor cells. Biochemistry (Mosc). 65, 95-106 (Review).

Sun, B.T., Zheng, LH., Bao, Y.L., Yu, C.L., Wu, Y., Meng, X.Y., Li, Y.X., 2011. Reversal effect of Dioscin on multidrug resistance in human hepatoma HepG2/adriamycin cells. Eur. J. Pharmacol. 654, 129-134.

Sweet, P., Chan, P.K., Slater, L.M., 1989. Cyclosporin A and verapamil enhancement of daunorubicin-produced nucleolar protein B23 translocation in daunorubicin-resistant and -sensitive human and murine tumor cells. Cancer Res. 49, 677-680.

Szakacs, G., Chen, G.K., Gottesman, M.M., 2004. The molecular mysteries underlying P-glycoprotein-mediated multidrug resistance. Cancer Biol. Ther. 3, 382-384.

Tan. B., Piwnica-Worms, D., Ratner, L., 2000. Multidrug resistance transporters and modulation. Curr. Opin. Oncol. 12, 450-458.

Tang, D.Z., Yang, F., Yang, Z., Huang, J., Shi, Q., Chen, D., Wang, Y.J., 2011. Psoralen stimulates osteoblast differentiation through activation of BMP signaling. Biochem. Biophys. Res. Commun. 405, 256-261.

Toyooka, T., Ibuki, Y., 2009. Histone deacetylase inhibitor sodium butyrate enhances the cell killing effect of psoralen plus UVA by attenuating nucleotide excision repair. Cancer Res. 69, 3492-3500.

Varma, M.V., Ashokraj, Y., Dey, C.S., Panchagnula, R., 2003. P-glycoprotein inhibitors and their screening: a perspective from bioavailability enhancement. Pharmacol. Res. 48, 347-359.

Wong, R.W., Rabie, A.B., 2011. Effect of psoralen on bone formation. J. Orthop. Res. 29, 158-164.

Ming-Ju Hsieh (a, b, d), Mu-Kuan Chen (c), Ya-Yen Yud (e), Gwo-Tarng Sheu (f) *, Hui-Ling Chioug (g, h) *

(a) Cancer Research Center, Changhua Christian Hospital, Changhua 500, Taiwan

(b) School of Optometry, Chung Shan Medical University, Taichung 40201, Taiwan

(c) Department of Otorhinolaryngology-Head and Neck Surgery, Changhua Christian Hospital, Changhua 500, Taiwan

(d) Institute of Medicine, Chung Shan Medical University, Taichung 40201, Taiwan

(e) Department of Laboratory, Chang-Hua Hospital, Department of Health, Changhua 513, Taiwan

(f) Institute of Medical and Molecular Toxicology, Chung Shan Medical University, Taichung 40201, Taiwan

(g) School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung 40201, Taiwan

(h) Department of Clinical Laboratory, Chung Shan Medical University Hospital, Taichung 40201, Taiwan

* Corresponding authors at: School of Medical Laboratory and Biotechnology, Chung Shan Medical University, 110, Section 1, Chien-Kuo N. Road, Taichung 40201, Taiwan. Tel.: +886 424730022x12423; fax: +886 423248171.

E-mail addresses: gtsheu@csmu.edu.tw (G.-T. Sheu), hichiou@csmu.edu.tw (H.-L. Chiou).

http://dx.doi.Org/10.1016/i.phymed.2014.03.008
COPYRIGHT 2014 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Hsieh, Ming-Ju; Chen, Mu-Kuan; Yu, Ya-Yen; Sheu, Gwo-Tarng; Chiou, Hui-Ling
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9TAIW
Date:Jun 15, 2014
Words:4467
Previous Article:Gastroprotective effect of epoxy clerodane diterpene isolated from Tinospora cordifolia miers (guduchi) on indomethacin-induced gastric ulcer in rats.
Next Article:Anti-melanogenic effects of [delta]-tocotrienol are associated with tyrosinase-related proteins and MAPK signaling pathway in B16 melanoma cells.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters