Printer Friendly

Protective Effect of Bacillus subtilis B10 against Hydrogen Peroxide- Induced Oxidative Stress in a Murine Macrophage Cell Line.

Byline: Ya-Li Li, Kai Lei, Xin Xu, Imran Rashid Rajput, Dong-You Yu and Wei-Fen Li

Abstract

The present study was designed to determine, whether Bacillus subtilis B10 could enhance the antioxidant activity of RAW 264.7 cells and attenuate the oxidative stress induced by hydrogen peroxide (H2O2). In addition, the responses were contrasted with a powerful antioxidant, vitamin E. RAW 264.7 cells were pretreated for 12 h with 100 mM vitamin E or B. subtilis B10 (1x108 c.f.u. well-1), respectively and consecutively exposed to 500 uM H2O2 for an additional 6 h of incubation. Additional control group was included with exposure to B. subtilis B10 (1x108 c.f.u. well-1) in the absence of H2O2. After incubation, cells were collected for further analysis of anti-oxidative indicators.

The results showed that, cells pre-treated with B. subtilis B10 manifested remarkable increase in total antioxidant capacity (T-AOC), total superoxide dismutase (T-SOD), catalase (CAT), anti-superoxide activity (ASOA), glutathione peroxidase (GPX) as well as glutathione reductase (GR) levels and significant drop in myeloperoxidase (MPO) and malondialdehyde (MDA) content. The activity of inducible NO synthase (iNOS) was also elevated in B. subtilis group, while NO content decreased markedly. Additionally, exposure to H2O2 with prior B. subtilis B10 treatment induced high gene expression levels of glutathione S-transferases (GST) and g-glutamylcysteine synthetase (g-GCS) in RAW 264.7 cells. However, vitamin E showed a limited protective effect when compared with B. subtilis B10 in our study.

The current findings concluded that, B. subtilis B10 protected cells from H2O2 induced oxidative damage, presumably by enhancing enzymatic antioxidant defense systems of RAW264.7 cells. (c) 2013 Friends Science Publishers

Keywords: Bacillus subtilis; Vitamin E; Oxidative stress; RAW264.7 cells

Introduction

Oxidative damage, mediated by reactive oxygen species (ROS), has been implicated in initiation or progression of numerous disorders, and closely relates to animal production, reproductive performance and general welfare of the farm animals (Lykkesfeldt et al., 2007). Mammalian cells possess inherent antioxidant mechanisms to scavenge or neutralize ROS (Wijeratne et al., 2005); however there is insufficient antioxidant capacity to prevent ROS-mediated injury when animals are fed in high stress condition, and exposed to invading pathogens or some chemicals. Therefore, antioxidant therapy may provide a potentially important alternative treatment to reduce the oxidative damage (Lykkesfeldt et al., 2007).

Due to the potential toxic effect of synthetic antioxidants, much attention then has been focused on the use of natural antioxidants (e.g., vitamin E, carotenoids, GSH, probiotics) to improve animal health and performance (Wongputtisin et al., 2007). Applications of probiotics have been revealed numerous health benefits since its application to exert, beneficiary effects particularly in animals and human (Huang et al., 2012; Rajput and Li, 2012). The anti-oxidative effect of probiotics has been reported recently (Koller et al., 2008; Martarelli et al., 2011). Bacillus subtilis is one of the direct-fed microbial products that have been safely and commonly used as human food and animal feed (Qin et al., 2013). Application of B. subtilis was beneficial to improve antioxidant capacity of ducks (Rajput et al., 2013) and broilers (Li et al., 2011).

Previously, we have reported that B. subtilis B10 possessed antioxidant properties and were able to protect human derived colon cells against oxidative damage induced by H2O2 (Cui et al., 2011). Intestinal macrophages are essential for local homeostasis, and little information is presently available about the effects of B. subtilis on anti-oxidant activity of macrophages under oxidative stress. Therefore, evidences inspired us to focus our research on the protective effect of B. subtilis B10 against hydrogen peroxide-induced oxidative stress in RAW264.7 cells.

Materials and Methods

Bacteria

Bacillus subtilis B10 (B. subtilis B10) used during

experiment was isolated and identified by Institute of Feed Science, Zhejiang University. The bacterial strain was cultured in Luria-Bertani (LB) (Oxoid, England) medium at 30degC till log phase (16 h). Bacterial cells were harvested by centrifugation (10 min at 6000 rpm), washed twice with sterile Phosphate-Buffered Saline (PBS) buffer (pH 7.4) and heated at 100degC for 30 min.

Cell Culture

RAW 264.7 (ATCC TIB71), a murine macrophage cell line, was obtained from the Cell Resource Center of Shanghai Institute of Biological (Shanghai, China). The cells were cultured according to our previous procedure (Li et al., 2012).

Experimental Design

RAW 264.7 cells with different treatments were designated as G I, G II, G III, G IV and G V respectively. G I, with no hydrogen peroxide (H2O2) treatment, served as control group. Oxidation was induced by exposing RAW 264.7 cells to 500 uM H2O2 in DMEM for 6 h (group II, H2O2). In group III (G III, VE+H2O2) and IV (G IV, B10+H2O2), RAW 264.7 cells were pretreated for 12 h with 100 mM vitamin E or B. subtilis B10 (1x108 c.f.u. well-1, heat-killed) respectively, and consecutively exposed to 500 uM H2O2 for an additional 6 h of incubation. Group V (G V, B10) with exposure to B. subtilis B10 (1x108 c.f.u. well-1, heat- killed) in the absence of H2O2 acted as additional control group. Vitamin E was dissolved in absolute ethanol and then diluted in DMEM to a final concentration (100 mM). Each group had six replicated wells. After the 18-h incubation, cells were collected separately for further analysis.

Anti-oxidative Indicators Measurement

The activities of total antioxidant capacity (T-AOC), superoxide dismutase (SOD), catalase (CAT), myeloperoxidase (MPO), glutathione peroxidase (GPX), glutathione reductase (GR), anti-superoxide activity (ASOA), inducible NO synthase (iNOS) and concentrations of glutathione (GSH), glutathione disulfide (GSSG), malondialdehyde (MDA), nitric oxide (NO) were determined using the detection kit provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China) (Hu et al., 2012; Tong et al., 2012).

Quantitative Real-time PCR Studies

Total RNA extraction was extracted by using RNAiso Plus reagent (Takara, Japan). RT-PCR was performed as previously described (Li et al., 2013). Change in gene expression was determined using the 2-[?][?]CT method. The primer sequences used for qRT-PCR are described in Table 1. At least 3 independent experiments performed in triplicate.

Statistical Analysis

Data were analyzed using the one-way analysis of variance procedure of SPSS 16.0 for Windows. All data were represented as mean +- S.D. P-values of ( Less than 0.05) were considered to be statistically significant.

Results

Antioxidant Enzyme Activity

The results showed (Table 2) that, treatment with H2O2 (G II) significantly increased MPO activity while the activities of GPX and GR were obviously decreased. Additionally, no change was found in T-AOC, T-SOD, GSH and GSSG levels as compared to control (G I).

Results analysis revealed that VE prevention group (G III, VE+H2O2) had high levels of GPX and GR while, MPO showed remarkable decrease (P Less than 0.05) when compared with H2O2 group (G II). Besides, VE group (G III) showed a non- significant effect on the other antioxidant indexes.

The activities of T-AOC, T-SOD, CAT, ASOA, GPX and GR were observed remarkable higher whereas the levels of MPO and MDA were markedly lower in B. subtilis B10 group (G IV, B10+H2O2) as compared to G II and G I. In addition, antioxidant enzyme activities of cells pretreated with B10 (G IV, B10+H2O2) were higher (P Less than 0.05) than that of VE group (G III, VE+H2O2). GSH concentrations showed a slight increase in (G IV), while this increase was not statistically significant. Additionally, cells treated with B. subtilis B10 in the absence of H2O2 exhibited elevated levels of T-SOD, GR as well as MPO in (G V, B10).

Nitric Oxide and Inducible Nitric Oxide Synthase

After incubation with H2O2 for 6 h, significant reduction in NO levels was noted in the cells of group (II, III, IV) as compared to non-treated cells in (G I). The activity of iNOS showed notable decrease (P Less than 0.05) in (G II) and (G III) when compared with control (G I). Whilst, B. subtilis B10 (G IV, B10+H2O2) was found able to restore iNOS activity to the normal level. Besides, remarkably elevated levels of NO and iNOS were observed in (G V, B10) (Fig. 1).

Expression of Genes Involved in Oxidative Stress

The results (Fig. 2) showed that GCS, XO and NOX1 mRNA expressions were significantly enhanced in H2O2 group (G II), while no change was found in GR, GST, SOD and TRX2 mRNA expressions levels as compared to control (G I). The expression levels of relevant oxidant- related genes of cells pretreated with VE were not significantly different from that of H2O2 group (G II). B. subtilis B10 (G IV, B10+H2O2) promoted GST and GCS mRNA expressions (P Less than 0.05), whereas expression of SOD was down-regulated markedly by B10 when compared with H2O2 group (G II). While, changes in transcription levels of GR, TRX2, XO and NOX1 were not observed between G IV and G II.

Table 1: Sequences of forward and reverse primers used for qRT-PCR

Target###Primer sequence###Size (bp)

-actin###F:5'CCTGTACGCCAACACAGTGC3'###211

###R:5'ATACTCCTGCTTGCTGATCC3'

GAPDH###F:5'GTTGTCTCCTGCGACTTCA3'###293

###R:5'GCCCCTCCTGTTATTATGG3'

GSR###F:5'GTAGGAAGCCCACCACGAC3'###173

###R:5'AGCATAGACGCCTTTGACATT3'

GST###F:5'GCCCTGTGGCATAAGGTGAT3'###129

###R:5'TTTGTCCTGGAGGAACTTGTCT3'

-GCS###F:5'AACTCTGCCTATGTGGTATTCG3'###269

###R:5'TTCCCATTGATGATGGTGTCTA3'

SOD###F:5'GAAGCATGGCGATGAAAGC3'###273

###R:5'CAGTCACATTGCCCAGGTCTC3'

XO###F:5'CTGTCTTTGCGAAGGATGAG3'###140

###R:5'CTGGATTGTGATAATGGCTGG3'

TRX2###F:5'GGAAACCAGAAGCCGAACA3'###151

###R:5'GACAAGGAATAGAAGGGACAGAT3'

NOX1###F:5'CCGTTCATATTCGAGCAGC3'###81

Table 2: Antioxidant enzyme activities of cells in different treatment groups

Target###GI###G II###G###III G###IV G V

###(control)###(H2O2)###(VE+H2O2)###(B10+H2O2)###(B10)

T-AOC###0.49+-0.11c 1.04+-0.20bc###1.41+-0.25b###4.45+-0.83a###0.638+-0.32c

T-SOD###27.5+-0.72c 26.7+-0.46c###27.5+-0.79c###48+-0.54a###39.5+-0.77b

CAT###ND###ND###ND###28.93+-1.48###ND

MPO###0.44+-0.01c 0.75+-0.03a###0.63+-0.05b###0.59+-0.04b###0.63+-0.01b

ASOA###ND###ND###ND###144.7+-1.04###ND

MDA###1.38+-0.18a 1.50+-0.60a###1.27+-0.06a###1.03+-0.17b###1.40+-0.21a

GPX###1.9+-0.8c###ND###3.64+-0.11b###6.52+-0.21a###1.44+-0.07c

GR###9.89+-0.4 c

###8+-0.27 d

###10.3+-0.74c 14.1+-1.88a###11.9+-0.74b

GSH###4.46+-0.78###4.32+-0.47###3.97+-1.01###5.43+-0.47###5.45+-0.63

GSSG###0.2+-0.02###0.21+-0.02###0.19+-0.02###0.23+-0.05###0.22+-0.03

Data were expressed as mean +- SD. Different letters indicate a statistically significant difference between groups (P Less than 0.05). ND stands for Non-Detectable. Units: T-AOC (U/mgprot), T-SOD (U/mgprot), CAT (U/mgprot), MPO (U/gprot), ASOA (U/gprot), MDA (nmol/mgprot), GPX (U/mgprot), GR (U/gprot), GSH (mmol/gprot), GSSG (mmol/gprot)

Discussion

Antioxidant Enzyme Activity

Body endures oxidative stress, when natural antioxidant defense mechanism fails to protect cells against damage caused by high level of ROS (De Bont and van Larebeke,2004).

The mammalian cells have evolved an elaborative and protective antioxidant defense system to prevent oxidative damage by scavenging free radicals. Evidences have been shown that the antioxidant triad comprising SOD, CAT, GPX constitutes the first line of defense against the adverse effects of ROS (Koziorowka-Gilun et al., 2011).

Besides, GSH redox system appears to be the main non-enzymatic antioxidant against ROS-mediated damage. GSH can be converted to GSSG through GPX, and converted back to GSH by GR (Yao et al., 2006). Thus, changes in the GSH, GSSG and its related enzymatic reactions (GPX and Fig. 1: Nitric oxide content and inducible NO synthase activity of cells in different treatment groups Data were expressed as mean +- SD. Different letters indicate a statistically significant difference between groups (P Less than 0.05). The error bars indicate standard deviations. G I (control), G II (H2O2), G III (VE+H2O2), G IV (B10+H2O2), G V (B10)

Fig. 2: Expression of genes involved in oxidative stress of cells in different treatment groups

Data were expressed as mean +- SD. Different letters indicate a statistically significant difference between groups (P Less than 0.05). The error bars indicate standard deviations. G I (control), G II (H2O2), G III (VE+H2O2), G IV (B10+H2O2), G V (B10) GR) may sensibly reflect the antioxidant status.

In the present study, we found remarkable reduction in GPX and GR activities in cells after exposure to H2O2, indicating that oxidative stress might have occurred. Conversely, B. subtilis B10 showed a potent protective effect in our study. Cells pre-incubated with B. subtilis B10 exhibited elevated levels of T-AOC, T-SOD, CAT, ASOA, GPX as well as GR. These findings coincided with Li et al. (2012) who demonstrated that, Enterococcus faecium EF1 could enhance the activity of enzymatic antioxidant defense systems of Caco-2 cells under oxidative stress. Another study described that lactic acid bacteria were also protective towards H2O2 induced oxidative damages in colon cells (Koller et al., 2008). Our results revealed beneficial effects of B. subtilis B10 against oxidative stress by increasing the scavenging rate of free radicals via enhancing enzymatic defense.

Generally, it is accepted that MPO converts H2O2 to highly reactive hypochlorous acid with potent cytotoxic properties (Mutze et al., 2003) and it also serves as a reliable marker of the degree of oxidative stress during haemodialysis (Wu et al., 2005). In our study, activity of MPO showed remarkable increase in macrophage cells incubated with H2O2, while pre-incubation with B. subtilis B10 reduced the level of MPO. Previously, Westman et al. (2006) reported that activated macrophages produced and released MPO during inflammation. The current findings suggested that B. subtilis B10 may possess antioxidant properties to prevent H2O2-induced macrophages activation and the ensuing damage. Meanwhile, the molecular mechanisms that initiate these changes in MPO activity will require additional study.

MDA is a main product of lipid peroxidation, and the most commonly indicator for the extent of stress- induced damage (Weismann et al., 2011). In the current findings, significantly lower MDA content was noted in B. subtilis B10 pre-treated group, and the reduction in MDA content was inversely proportionate in coordination to increase in T-AOC, T-SOD, CAT, GPX and GR levels. Therefore, the ensemble of results suggested that B. subtilis B10 could ameliorate oxidative stress on RAW264.7 cells.

Vitamin E is a powerful lipid-soluble antioxidant vital for the maintenance of oxidant-antioxidant homeostasis. Therefore, in the current study, vitamin E revealed greater activities of GPX and GR, while lower MPO levels in vitamin E pre-treated cells, suggesting that vitamin E may play a limited role to down-regulate the H2O2 induced oxidative stress in RAW 264.7 cells. So, as pointed out by van Haaften et al. (2003), vitamin E might have the protective effects on GSH-dependent enzymes. Our data indicated that, although vitamin E is a vital chain-breaking antioxidant, it may have a limited capacity to enhance the antioxidant defense system of RAW 264.7 cells.

Nitric Oxide and Inducible Nitric Oxide Synthase

Nitric oxide (NO) has been proposed to possess both anti- oxidant and pro-oxidant properties (Borniquel et al., 2006). NO could react with peroxyl radicals as a sacrificial chain- breaking antioxidant (Hummel et al., 2006). This might account for the reduced NO levels observed in our study after treatment with H2O2. Conversely, NO also acts as a pro-oxidant when it forms highly reactive peroxynitrite with superoxide, to enhance antibacterial activity of macrophages (Hummel et al., 2006). In our study, NO level was lower in B. subtilis B10 pre-treated macrophage amongst groups. This finding may indicate that pre-treatment with B. subtilis B10 may result in amounts of NO consumption in macrophages, and may promote the reaction of NO with peroxyl radicals, thereby decreasing the NO content in macrophages.

Bacterial infection generally leads to activation of iNOS in macrophages, thus producing large amounts of NO to kill invading bacteria (Chiou et al., 2000). As observed here, significant reduction in iNOS levels was noted in cells treated with H2O2. This finding was in line with a previous study, which showed that oxidative stress induced by pro-oxidants inhibited the expression of iNOS in macrophages (Cho et al., 2005). However, we found a discrepancy between NO concentration and levels of iNOS. In the current study, elevated iNOS activity was manifested in B. subtilis B10 group, and this might be consistent with a greater rate of NO consumption in macrophages, thus a higher level of iNOS may be required.

Expression of Genes Involved in Oxidative Stress

Glutathione S-transferases (GST), a superfamily of phase II detoxification enzymes, catalyze conjugation of GSH to a wide variety of electrophilic chemicals (Townsend and Tew, 2003).

While, g-glutamylcysteine synthetase (g-GCS) is a rate-limiting enzyme in de novo synthesis of GSH and it plays a pivotal role in GSH homeostasis (Hibi et al., 2004). It was observed in our report that, exposure to H2O2 with prior B. subtilis B10 treatment induced high gene expression levels of GST and g-GCS in RAW 264.7 cells. Previous studies have shown that, exposure cells to oxidants such as H2O2, caused depletion of GSH, which was concomitant with increased mRNA expression for g-GCS gene (Tian et al., 1997). Moreover, Shukla et al. (2000) also illustrated that transcriptional levels of GST and g-GCS were up-regulated to help maintain redox homeostasis and to cope with oxidative stress in alveolar epithelial cells. Our data may indicate that, prior B. subtilis B10 treatment enhanced capacity of RAW 264.7 cells to counteract the oxidative stress caused by H2O2 treatment. These adaptive responses to H2O2-induced stress were probably due to the increased rates of glutathione utilization.

Transcriptional activation of g-GCS might be responsible for the enhanced GSH synthesis, while GST induction might provide a more efficient means for the elimination of lipid peroxidation products (Shukla et al., 2000).

It is known that NADPH oxidase system (NOXs) is a family of superoxide-generating enzymes that can catalyze the regulated formation of ROS (Gianni et al., 2010). Furthermore, Dikalov et al. (2008) reported that NADPH oxidase-1 (NOX1) was responsible for angiotensin II- induced superoxide production and the increased oxidant stress and vascular disorders. Here we demonstrated that, NOX1 mRNA expression was up-regulated in RAW 264.7 cells challenged with H2O2. This finding was in keeping with previous studies by Qian et al. (2011) who reported that exposure of cells to H2O2 could lead to the activation of NOX activity in retinal pigment epithelium cell.

Moreover, it was reported that ROS derived from NADPH oxidases could modulate endothelial cell xanthine oxidase (XO) levels (McNally et al., 2003). XO is a ubiquitous enzyme, widely known for its production of ROS and, has been implicated in many inflammatory diseases (Kanczler et al., 2003). Our data showed that the transcription level of XO in RAW 264.7 cells was significantly augmented after exposure to H2O2 and, this might be associated with the increased expression of NOX1 mRNA.

Thioredoxin (TRX) is an important antioxidant present in all types of organisms (Takatsume et al., 2005) and mitochondrial thioredoxin-2 was commonly used as a source of reducing equivalents to scavenge H2O2 (Nonn et al., 2003). TRX2, the gene encoding thioredoxin-2, is already known to be induced by several chemicals that cause oxidative stress (Takatsume et al., 2005). It has previously been described that over-expression of thioredoxin gene TRX2 resulted in reduction of oxidative cellular damage (Gomez-Pastor et al., 2010). However, in the current study, no change was found in TRX2 mRNA expression level in cells following different treatment. Additionally, we found a discrepancy between mRNA levels and enzymatic activity of SOD. This discrepancy was probably due to differences in mRNA and protein turnover rates, as well as the posttranscriptional regulation.

Taken together, B. subtilis B10 showed a potent protective effect in our study and we found that B. subtilis B10 could increase the scavenging rate of free radicals by enhancing enzymatic defense, thereby ameliorating oxidative stress on RAW264.7 cells induced by H2O2. However, the precise mechanism whereby B. subtilis increased the antioxidant activity of RAW264.7 cells remained unknown, therefore, their signaling and transduction pathways need further investigation.

Acknowledgements

This study was supported by the Key Science and Technology Program of Zhejiang Province, China (No. 2006C12086) and the Special Research Fund for the Ph. D Program of University, China (No.20110101110101).

References

Borniquel, S., I. Valle, S. Cadenas, S. Lamas and M. Monsalve, 2006. Nitric oxide regulates mitochondrial oxidative stress protection via the transcriptional coactivator PGC-1alpha. FASEB J., 20: 1889-1891

Chiou, W.F., C.F. Chen and J.J. Lin, 2000. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide. Brit. J. Pharmacol., 129: 1553-1560

Cho, I.J., A.K. Lee, S.J. Lee, M.G. Lee and S.G. Kim, 2005. Repression by oxidative stress of iNOS and cytokine gene induction in macrophages results from AP-1 and NF-kappa B inhibition mediated by B cell translocation gene-1 activation. Free Radical Biol. Med., 39: 1523-1536

Cui, Z.W., Q. Huang, Y. Huang, H.Z. Wu, J. Wen and W.F. Li, 2011. Effects of Bacillus subtilis on antioxidative function of Caco-2 cells. Chin. J. Anim. Nutr., 23: 293-298

De Bont, R. and N. van Larebeke, 2004. Endogenous DNA damage in humans: a review of quantitative data. Mutagenesis, 19: 169-185

Dikalov, S.I., A.E. Dikalova, A.T. Bikineyeva, H.H. Schmidt, D.G. Harrison and K.K. Griendling, 2008. Distinct roles of Nox1 and Nox4 in basal and angiotensin II-stimulated superoxide and hydrogen peroxide production. Free Radical Biol. Med., 45: 1340-1351

Gianni, D., N. Taulet, H. Zhang, C. DerMardirossian, J. Kister, L. Martinez, W.R. Roush, S.J. Brown, G.M. Bokoch and H. Rosen, 2010. A novel and specific NADPH oxidase-1 (Nox1) small-molecule inhibitor blocks the formation of functional invadopodia in human colon cancer cells. ACS Chem. Biol., 5: 981-993

Gomez-Pastor, R., R. Perez-Torrado, E. Cabiscol, J. Ros and E. Matallana, 2010. Reduction of oxidative cellular damage by overexpression of the thioredoxin TRX2 gene improves yield and quality of wine yeast dry active biomass. Microb. Cell Fact., 9: 9

Hibi, T., H. Nii, T. Nakatsu, A. Kimura, H. Kato, J. Hiratake and J. Oda, 2004. Crystal structure of gamma-glutamylcysteine synthetase: insights in to the mechanism of catalysis by a key enzyme for glutathione homeostasis. Proc. Natl. Acad. Sci. USA, 101: 15052- 15057

Hu, C.H., D.G. Wang, H.Y. Pan, W.B. Zheng, A.Y. Zuo and J.X. Liu, 2012.

Effects of broccoli stem and leaf meal on broiler performance, skin pigmentation, antioxidant function, and meat quality. Poult. Sci., 91: 2229-2234

Huang, Y., Y.L. Li, Q. Huang, Z.W. Cui, D.Y. Yu, I.R. Rajput, C.H. Hu and W.F. Li, 2012. Effect of orally administered Enterococcus faecium EF1 on intestinal cytokines and chemokines production of suckling piglets. Pak. Vet. J., 32: 81-84

Hummel, S.G., A.J. Fischer, S.M. Martin, F.Q. Schafer and G.R. Buettner, 2006. Nitric oxide as a cellular antioxidant: A little goes a long way. Free Radic. Biol. Med., 40: 501-506

Kanczler, J.M., T.M. Millar, T. Bodamyali, D.R. Blake and C.R. Stevens, 2003. Xanthine oxidase mediates cytokine-induced, but not hormone-induced bone resorption. Free Radical Res., 37: 179-187 Koller, V.J., B. Marian, R. Stidl, A. Nersesyan, H. Winter, T. Simic, G. Sontag and S. Knasmuller, 2008. Impact of lactic acid bacteria on oxidative DNA damage in human derived colon cells. Food Chem. Toxicol., 46: 1221-1229

Koziorowka-Gilun, M., M. Koziorowski, J. Strzezek and L. Fraser, 2011. Seasonal changes in antioxidant defence systems in seminal plasma and fluids of the boar reproductive tract. Reprod. Biol., 11: 37-47

Li, W.F., Q. Huang, Y.L. Li, I.R. Rajput, Y. Huang and C.H. Hu, 2012. Induction of probiotic strain Enterococcus faecium EF1 on the production of cytokines, superoxide anion and prostaglandin E2 in a macrophage cell line. Pak. Vet. J., 32: 530-534

Li, W.F., Y. Huang, Y.L. Li, Q. Huang, Z.W. Cui, D.Y. Yu, I.R. Rajput and C.H. Hu, 2013. Effect of oral administration of Enterococcus faecium EF1 on innate immunity of sucking piglets. Pak. Vet. J., 33: 9-13

Li, W.F., Z.W. Cui, I.R. Rajput, Y.L. Li, H.Z. Wu and D.Y. Yu, 2012. Effect of Enterococcus faecium 1 (EF1) on antioxidant functioning activity of Caco-2 cells. J. Anim. Vet. Adv., 11: 2307-2312

Li, W.F., J. Wen, H.Z. Wu, L. Zhai and D.Y. Yu, 2011. Effects of Bacillus subtilis on growth performance, antioxidant capacity and immunity of intestinal mucosa in broilers. Chin. J. Anim. Sci., 47: 58-61

Lykkesfeldt, J. and O. Svendsen, 2007. Oxidants and antioxidants in disease: oxidative stress in farm animals. Vet. J., 173: 502-511

Martarelli, D., M.C. Verdenelli, S. Scuri, M. Cocchioni, S. Silvi, C.Cecchini and P. Pompei, 2011. Effect of a probiotic intake on oxidant and antioxidant parameters in plasma of athletes during intense exercise training. Curr. Microbiol., 62: 1689-1696

McNally, J.S., M.E. Davis, D.P. Giddens, A. Saha, J. Hwang, S. Dikalov, H. Jo and D.G. Harrison, 2003. Role of xanthine oxidoreductase and NAD(P)H oxidase in endothelial superoxide production in response to oscillatory shear stress. Amer. J. Physiol. Heart Circ. Physiol., 285: 2290-2297

Mutze, S., U. Hebling, W. Stremmel, J. Wang, J. Arnhold, K. Pantopoulos and S. Mueller, 2003. Myeloperoxidase-derived hypochlorous acid antagonizes the oxidative stress-mediated activation of iron regulatory protein 1. J. Biol. Chem., 278: 40542-40549

Nonn, L., M. Berggren and G. Powis, 2003. Increased expression of mitochondrial peroxiredoxin-3 (thioredoxin peroxidase-2) protects cancer cells against hypoxia and drug-induced hydrogen peroxide- dependent apoptosis. Mol. Cancer Res., 1: 682-689

Qian, J., K.T. Keyes, B. Long, G. Chen and Y. Ye, 2011. Impact of HMG-CoA reductase inhibition on oxidant-induced injury in human retinal pigment epithelium cells. J. Cell Biochem., 112: 2480-2489

Qin, H., H. Yang, Z. Qiao, S. Gao and Z. Liu, 2013. Identification and characterization of a Bacillus subtilis strain HB-1 isolated from Yandou, a fermented soybean food in China. Food Cont., 31: 22-27

Rajput, I.R. and W.F. Li, 2012. Potential role of probiotics in mechanism of intestinal immunity. Pak. Vet. J., 32: 303-308

Rajput, I.R., W.F. Li, Y.L. Li, J. Lei and M.Q. Wang, 2013. Application of probiotic (Bacillus subtilis) to enhance immunity, antioxidation, digestive enzymes activity and hematological profile of Shaoxing duck. Pak. Vet. J., 33: 69-72

Shukla, G.S., A. Shukla, R.J. Potts, M. Osier, B.A. Hart and J.F. Chiu, 2000. Cadmium-mediated oxidative stress in alveolar epithelial cells induces the expression of gamma-glutamylcysteine synthetase catalytic subunit and glutathione S-transferase alpha and pi isoforms: potential role of activator protein-1. Cell Biol. Toxicol., 16: 347-362

Takatsume, Y., K. Maeta, S. Izawa and Y. Inoue, 2005. Enrichment of yeast thioredoxin by green tea extract through activation of Yap1 transcription factor in Saccharomyces cerevisiae. J. Agric. Food Chem., 53: 332-337

Tian, L., M.M. Shi and H.J. Forman, 1997. Increased transcription of the regulatory subunit of gamma-glutamylcysteine synthetase in rat lung epithelial L2 cells exposed to oxidative stress or glutathione depletion. Arch. Biochem. Biophys., 342: 126-133

Tong, T.K., H. Lin, G. Lippi, J. Nie, Y. Tian, 2012. Serum oxidant and antioxidant status in adolescents undergoing professional endurance sports training. Oxid. Med. Cell Longev., 2012, Article ID 741239

Townsend, D.M. and K.D. Tew, 2003. The role of glutathione-S-transferase in anti-cancer drug resistance. Oncogene, 22: 7369-7375

van Haaften, R.I., G.R. Haenen, C.T. Evelo and A. Bast, 2003. Effect of vitamin E on glutathione -dependent enzymes. Drug Metab. Rev., 35: 215-253

Weismann, D., K. Hartvigsen, N. Lauer, K.L. Bennett, H.P. Scholl, P.Charbel Issa, M. Cano, H. Brandstatter, S. Tsimikas, C. Skerka, G. Superti-Furga, J.T. Handa, P.F. Zipfel, J.L. Witztum and C.J. Binder, 2011. Complement factor H binds malondialdehyde epitopes and protects from oxidative stress. Nature, 478: 76-81

Westman, E., K. Lundberg and H. Erlandsson Harris, 2006. Arthritogenicity of collagen type II is increased by chlorination. Clin. Exp. Immunol.,145: 339-345

Wijeratne, S.S., S.L. Cuppett and V. Schlegel, 2005. Hydrogen peroxide induced oxidative stress damage and antioxidant enzyme response in Caco-2 human colon cells. J. Agric. Food Chem., 53: 8768-8774

Wongputtisin, P., C. Khanongnuch, P. Pongpiachan and S. Lumyong, 2007. Antioxidant activity improvement of soybean meal by microbial fermentation. Res. J. Microbiol., 2: 577-583

Wu, C.C., J.S. Chen, W.M. Wu, T.N. Liao, P. Chu, S.H. Lin, C.H. Chuang and Y.F. Lin, 2005. Myeloperoxidase serves as a marker of oxidative stress during single haemodialysis session using two different biocompatible dialysis membranes. Nephrol. Dial. Transplant., 20:1134-1139

Yao, J.K., S. Leonard and R. Reddy, 2006. Altered glutathione redox state in schizophrenia. Dis. Markers, 22: 83-93

Key Laboratory of Molecular Animal Nutrition and Feed Sciences, College of Animal Science, Zhejiang University, Hangzhou, P.R. China, 310058

For correspondence: wfli@zju.edu.cn; liyali06@163.com

To cite this paper: Li, Y.L., K. Lei, X. Xu, I.R. Rajput, D.Y. Yu and W.F. Li, 2013. Protective effect of Bacillus subtilis B10 against hydrogen peroxide- induced oxidative stress in a murine macrophage cell line. Int. J. Agric. Biol., 15: 927-932
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Li, Ya-Li; Lei, Kai; Xu, Xin; Rajput, Imran Rashid; Yu, Dong-You; Li, Wei-Fen
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9CHIN
Date:Oct 31, 2013
Words:4864
Previous Article:Molecular Investigations to Determine the Ectomycorrhizal Habit of Lactarius sanguifluus Associated with Coniferous and Deciduous Vegetation of...
Next Article:Over-expression of Cytochrome P450s in Helicoverpa armigera in Response to Bio-insecticide, Cantharidin.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters