Printer Friendly

Protection from oxidative stress in immunocytes of the colonial ascidian Botryllus schlosseri: Transcript characterization and expression studies.

Abstract. Botryllus schlosseri is a cosmopolitan colonial ascidian that undergoes cyclical generation changes, or takeovers, during which adult zooids are resorbed and replaced by their buds. At take-over, adult tissues undergo diffuse apoptosis and effete cells are massively ingested by circulating phagocytes, with a consequent increase in oxygen consumption and in production of reactive oxygen species (ROS). The latter are responsible for the death of phagocytes involved in the clearance of apoptotic cells and corpses by phagocytosisinduced apoptosis. However, the majority of phagocytes and hemocytes do not die, even if they experience oxidative stress. This fact suggests the presence of detoxification mechanisms assuring their protection. To test this assumption, we searched for transcripts of genes involved in detoxification in the transcriptome of B. schlosseri. We identified and characterized transcripts for Cu/Zn superoxide dismutase (SOD), [gamma]-glutamyl-cysteine ligase modulatory subunit (GCLM), glutathione synthase (GS), and two glutathione peroxidases (i.e., GPx3 and GPx5), all involved in protection from ROS. We also carried out a phylogenetic analysis of the putative amino acid sequences, confirming their similarity to their vertebrate counterparts, and studied the location of their mRNAs by in situ hybridization on hemocyte monolayers. We also analyzed gene transcription during the colonial blastogenetic cycle, which is the interval of time between one take-over and the next, by qRT-PCR. In addition, we investigated the effects of cadmium (Cd), an inducer of oxidative stress, on gene transcription. Our results indicated that i) antioxidant gene expression is modulated in the course of the blastogenetic cycle and upon exposure to Cd, and ii) hemocytes synthesize both enzymatic and nonenzymatic antioxidants, in line with the idea that they represent a major detoxification system for ascidians.

Introduction

Increasing evidence indicates that stressful conditions lead animals to increase the production of reactive oxygen species (ROS) by NADPH-, mitochondrial-, and microsomal-oxidase activity, which partially reduces molecular oxygen (Kaloyanni et al., 2009; Tomanek, 2014; Canesi, 2015; Puppel et al., 2015; Zeeshan et al., 2016). Reactive oxygen species, including superoxide anions (*[[O.sub.2].sup.-]), hydrogen peroxide ([H.sub.2][O.sub.2]), peroxyl radicals (*R[O.sub.2]), and hydroxyl radicals (*OH), exert microbicidal activity and prevent potentially pathogenic microorganisms from entering the weakened organisms. They can also activate signal transduction pathways mediating cell growth and apoptosis (De la Fuente and Victor, 2000; Lesser, 2006). Even in the immune system, phagocytes, once they are activated by the recognition of foreign molecules, increase their oxygen consumption in a process known as oxidative burst. This involves the activation of an inducible membrane oxidase and the consequent production of ROS.

When ROS levels exceed a threshold value, an imbalance occurs between the production of ROS and the ability of the cell and/or organism to readily detoxify the reactive intermediates or to repair the resulting damage. This condition, currently known as oxidative stress, is dangerous for cells and tissues because it can lead to the oxidation of lipids, proteins, and nucleic acids, producing irreversible structural and functional alterations. To prevent the negative effects of ROS, organisms evolved antioxidant defenses that can reestablish the cellular redox equilibrium, relying on both enzymatic and nonenzymatic mechanisms. Enzymes such as superoxide dismutase (SOD), catalase, glutathione reductase, and glutathione peroxidase (GPx) belong to the first category, whereas thiolrich molecules, such as glutathione (GSH), metallothioneins, and phytochelatins, number among the nonenzymatic mechanisms.

Tunicates are invertebrate chordates and are considered the sister group of vertebrates (Delsuc et al., 2006). For this reason, they are interesting organisms for evolutionary studies. Ascidians are the richest in species class of tunicates and thus are the most studied animal of this class.

Botryllus schlosseri is a colonial ascidian that performs cyclical (weekly, at 20 [degrees]C) generation changes, or take-overs, allowing recurrent rejuvenation of colonies (Manni et al., 2007; Ballarin et al., 2010). Colonies include three blastogenetic generations represented by mature, filter-feeding zooids, primary buds on zooids, and secondary buds (budlets) emerging from the primary buds (Manni et al., 2007). During the generation change, lasting 24-36 h, tissues of adult zooids undergo diffuse apoptosis (Lauzon et al., 1992, 1993; Cima and Ballarin, 2009; Ballarin et al., 2010), and cells and corpses are rapidly ingested by phagocytes infiltrating the tissues after having left the circulation (Cima et al., 2003; Manni et al., 2007; Ballarin et al., 2008a, b). In addition, a fraction of hemocytes, corresponding to 20%-30% of the total circulating cells, die by apoptosis at take-over and are replaced by new, undifferentiated hemocytes that enter the circulation from the hematopoietic sites (Ballarin et al., 2008b). Among these are the phagocytes having ingested effete cells and corpses that tend to die by phagocytosis-induced apoptosis as a consequence of excessive respiratory burst (Cima et al., 2010; Franchi et al., 2016). Reactive oxygen species are also produced when cytotoxic morula cells sense the presence of nonself (Ballarin et al., 2001) and release the enzyme phenoloxidase, which is stored in an inactive form inside their granules (Cima et al., 2004; Franchi et al., 2015). Phenoloxidase, acting on polyphenol substrata that are also released by morula cells, causes the production of ROS with microbicidal activity, for instance, during the nonfusion reaction between in-contact, genetically incompatible colonies (Ballarin et al., 2002; Franchi et al., 2015). Therefore, at take-over, when massive phagocytosis occurs, and during cytotoxic immune responses the majority of hemocytes need to protect themselves from the potential damages induced by ROS.

Until now, ascidian antioxidant strategies have been studied in the solitary species Ciona intestinalis (Franchi et al., 2012, 2014; Ferro et al., 2013) and Halocyntia roretzi (Abe et al., 1999). Available data suggest that circulating hemocytes, in addition to their role in immune responses (Ballarin et al., 2008b), are directly involved in the synthesis of ROS-scavenging molecules (Franchi et al., 2012, 2014; Ferro et al., 2013).

In the present study, we started a characterization of the ROS detoxification mechanisms in the hemocytes of B. schlosseri. New transcripts for Botryllus Cu/Zn superoxide dismutase (SOD), [gamma]-glutamyl-cysteine ligase modulatory subunit (GCLM), glutathione synthase (GS), and two glutathione peroxidases (GPx3 and GPx5) are described, and their location in hemocytes is demonstrated through in situ hybridization (ISH). We also compared the level of mRNA transcription in colonies exposed to Cd--a known inducer of oxidative stress (Liu et al., 2009) with respect to untreated colonies--by qRT-PCR. Our results indicated that immunocytes (both phagocytes and cytotoxic morula cells) are active in the transcription of genes involved in ROS detoxification, and their activity is modulated during the blastogenetic cycle and by the presence of Cd.

Materials and Methods

Animals

Colonies of Botryllus schlosseri (Tunicata, Ascidiacea) were collected near Chioggia, in the southern part of the Lagoon of Venice. They were reared according to the method of Gasparini et al. (2015), affixed to glass slides (5 x 5 cm), in aerated aquaria filled with 0.45-[micro]m filtered seawater (FSW) that was changed every other day, held at a constant temperature of 19 [degrees]C, and fed with Liquifry marine (Liquifry Co., Dorking, UK). Under these conditions, colonies reproduce asexually by palleal budding and undergo take-over weekly. Within 24-36 h, old zooids are resorbed and replaced by their buds. A colonial blastogenetic cycle is defined as the period of time between one take-over and the next. Colonial developmental phases lasting more than one day from the preceding, or following, generation change are collectively known as midcycle (MC; Manni et al., 2007).

Hemocyte collection

A colorless hemolymph containing various kinds of circulating hemocytes flows inside the lacunae and sinuses of the zooid open circulatory system and in the tunic vasculature that connects all the zooids and buds of the colony. Most of the circulating hemocytes are immunocytes, represented by phagocytes (both spreading and round) and cytotoxic morula cells (Ballarin and Cima, 2005).

Hemolymph was collected with a glass micropipette after puncture, using a fine tungsten needle, of the tunic marginal vessels of the colonies. It was diluted 1:1 in 0.38% Nacitrate in FSW (as an anti-agglutinating agent) with pH 7.5, then centrifuged at 780 g for 10 min at room temperature. The resulting pellet was then resuspended in FSW to get a final concentration of 5 x [10.sup.5] hemocytes/ml.

Exposure to cadmium

A storage solution was prepared by dissolving Cd[Cl.sub.2] in distilled water, whose concentration was determined by atomic absorption spectrometry, using a PerkinElmer 4000 spectrometer (PerkinElmer, Watham, MA), resulting in 45 mmol [l.sub.-1]. It was subsequently diluted in FSW to obtain a working solution with a final concentration of 0.2 [micro]mol [l.sub.-1]. This concentration, although higher than those found in the environment, was effective in inducing oxidative stress in the hemocytes of Botryllus schlosseri (Franchi and Ballarin, 2013), and was within the concentration ranges used in toxicological experiments with other aquatic organisms (Jeppe et al., 2014; Koutsogiannaki et al., 2015; Mugica et al., 2015).

Nine colonies of comparable size (around 25 zooids each) were exposed to 0.2 [micro]mol [l.sub.-1] Cd[Cl.sub.2] in FSW, in 3 9-1 aquaria (3 colonies per aquarium), at 16 [degrees]C. Three additional, unexposed colonies were used as controls. To avoid interference with the ROS production associated with the generation change (Cima et al., 2010), exposed colonies were at the mid-cycle phase of the blastogenetic cycle; exposure time was limited to 2, 4, and 6 h. Previous results indicated that the effects of Cd exposure on hemocytes were already observable after a one-hour exposure (Franchi and Ballarin, 2013). After the exposure, colonies were collected, blotted dry, removed from the glass slides with a razor blade, frozen in liquid nitrogen, and stored at -80 [degrees]C until use.

Primer design, RNA extraction, cDNA synthesis, cloning, and sequencing

Our EST collection was aligned on the Botryllus genome already available online (Voskoboynik et al., 2013). With this approach, many coding sequences (CDS) were recognized and recorded in our database (Campagna et al., 2016). Comparison of our CDS collection (Campagna et al., 2016) with the sequences of the vertebrate genes of interest allowed us to identify a series of nucleotide sequences and to design specific primers (Table 1) for PCR amplification. We focused our attention on the sequences of the predicted transcripts for GCLM, GS, Cu/Zn-SOD, GPx3, and GPx5, known as BsGCLM, BsGS, BsCu/Zn-SOD, BsGPx3, and BsGPx5, respectively. In all cases, the obtained EST sequences contained a 5'-terminal untranslated region (UTR) and the entire coding region. The 3'-rapid amplification of the cDNA ends (RACE) was performed using the 573' RACE Kit 2nd Generation (Roche Molecular Systems, Inc., Pleasanton, CA).

Total RNA was isolated from B. schlosseri colonies using the SV Total RNA Isolation System (Promega Corp., Madison, WI); its purity was determined spectrophotometrically by the [A.sub.260]/[A.sub.280] and [A.sub.260]/[A.sub.230] ratios. The integrity of RNA preparation was checked by visualizing the rRNA in ethidium bromide-stained 1.5% agarose gels. The first strand of cDNA was reverse-transcribed from 1 [micro]g of total RNA according to the Improm II manual (Promega Corp.). cDNA amplification was performed with Go-Taq Polymerase (Promega; 5 U/[micro]l), using the following cycling parameters: 94 [degrees]C for 2 min, 40 cycles of 94 [degrees]C for 30 s, melting temperature (Tm) for 30 s (Tms for the various primers are shown in Table 1), 72 [degrees]C for 1 min, and, a last step, at 72 [degrees]C for 10 min. Amplicons were subjected to electrophoresis and the corresponding bands were purified with ULTRAPrep Agarose Gel Extraction Mini Prep Kit (AHN Biotechnologie GmbH, Nordhausen, Germany), ligated in pGEM T-Easy Vector (Promega Corp.), and cloned in DH-5[alpha] Escherichia coli cells (Tang et al., 1994). To confirm the sequences and their expression, positively screened clones were sequenced at BMR Genomics (University of Padova) on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems, Inc., FosterCity, CA). Gene reconstructions were based on a B. schlosseri database using Spidey's algorithm (http://www.ncbi.nlm.nih.gov/spidey/).

Quantitative real-time PCR (qRT-PCR)

To estimate the total amount of mRNA for BsGCLM, BsGS, BsCu/Zn-SOD, BsGPx3, and BsGPx5, we used the qRT-PCR with the SYBR green method (FastStart Universal SYBR Green Master-Rox, Roche Molecular Systems, Inc.). In the first experimental series, mRNA was extracted from three colonies at take-over and three at mid-cycle (reference colonies) and maintained in FSW, to evaluate transcription changes under physiological conditions. In the second series, colonies at MC were exposed to 0.2 [micro]mol [l.sub.-1] Cd[Cl.sub.2] for 2, 4, and 6 h, and mRNA was extracted from three colonies for each exposure time. mRNA from three unexposed colonies (Cd concentration = 0) was used as reference control. Forward and reverse primers for BsGCLM (BsGCLF-RT and BsGCLR-RT), BsGS (BsGSF-RT and BsGSR-RT), BsCu/Zn-SOD (BsSODF-RT and BsSODR-RT), BsGPx3 (BsGPx3F and BsGPx3R-RT), BsGPx5 (BsGPx5F-RT and BsGPx5R-RT), and Bs[beta]-actin (BsACTF-RT and BsACTR-RT) transcripts--the last one (Bs[beta]-actin) used as a housekeeping gene--were synthesized by Sigma-Aldrich (St. Louis, MO) (Table 1). The stable expression of Bs[beta]-actin level (Campagna et al., 2016) explains the choice of cytoplasmic actin as reference gene for quantitative PCR experiments. To exclude contamination by genomic DNA, all of the designed primers contained parts of contiguous exons; a qualitative PCR was also carried out before qRT-PCR. Furthermore, analysis of the dissociation curve of the qRT-PCR gave no indication of the presence of contaminating DNA.

qRT-PCR analyses were performed using Applied Biosystems 7900 HT Fast Real-Time PCR System, using the following cycling parameters: 95 [degrees]C for 10 min, then 40 cycles of 95 [degrees]C for 10 s and 60 [degrees]C for 1 min. cDNA synthesis was carried out as described above. Each set of samples was run three times and each plate contained cDNA from three different biological samples (n = 3) and negative controls. The [MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII] method (Livak and Schmittgen, 2001) was used to estimate the total amount of mRNA. The amounts of transcripts in different conditions were normalized to [beta]-actin to compensate for variations in the amounts of cDNA.

Sequence alignment and phylogenetic analyses

Amino acid sequences of the proteins of interest were obtained by in silico translation. Sequence alignment and phylogenetic analyses were performed to compare the obtained sequences with those of the corresponding proteins from metazoans (Supplementary Table 1, view online). Alignments were carried out with Clustal W software (Larkin et al., 2007) and assessed using the Molecular Evolutionary Genetics Analysis (MEGA) ver. 6 program (Tamura et al., 2013) to infer evolutionary relationships among the various orthologous isoforms.

Phylogenetic reconstructions were performed according to unweighted pair group with arithmetic mean (UPGMA; Sneath and Sokal, 1973), minimum evolution (ME; Rzhetsky and Nei, 1992), neighbor-joining (NJ; Saitou and Nei, 1987), maximum parsimony (MP; Sourdis and Nei, 1988), and maximum likelihood (ML; Guindon and Gascuel, 2003) methods.

In situ hybridization (ISH)

For localization of mRNAs, sense and antisense probes for BsGCLM, BsGS, BsCu/Zn-SOD, BsGPx3, and BsGPx5 transcripts were obtained using T7 RNA- and SP6 RNA-polymerase. Probes were further purified with mini Quick Spin Columns (Roche Molecular Systems, Inc.). Whole colonies at MC (both Cd-treated and untreated) as well as hemocytes were used for ISH. Hemocytes, prepared as described above (see Hemocyte collection above in Materials and Methods), were left to adhere to Superfrost Plus slides (Thermo Fisher Scientific, Waltham, MA) for 30 min. Colonies and hemocytes were fixed in freshly prepared MOPS buffer (0.1 mol [l.sub.-1] MOPS, 1 mmol [l.sub.-1] MgS[O.sub.4], 2 mmol [l.sub.-1] EGTA, and 0.5 mol [l.sub.-1] NaCl) and 4% paraformaldehyde for 30 min and 2 h, respectively. After a prehybridization step in Hybridization Cocktail 50% Formamide (AMRESCO, Solon, OH) for 1 h at 58 [degrees]C, colonies and hemocytes were incubated with sense and antisense probes (2 [micro]g/ml biotin-labeled riboprobe in Hybridization Cocktail) overnight at 58 [degrees]C. They were then incubated with the ABC Complex (Vector Laboratories, Inc., Burlingame, CA), and positivity was revealed by incubation in 0.025% DAB and 0.004% [H.sub.2][O.sub.2] in phosphatebuffered saline (PBS; 8 g/1 NaCl, 0.2 g/1 KC1,0.2 g/1 K[H.sub.2]P[O.sub.4], 1.15 g/1 [Na.sub.2]HP[O.sub.4], pH 7.2) for 10 min. Colonies were then dehydrated, included in Paraplast Plus Xtra (Sigma-Aldrich), and 7-[micro]m sections were obtained with a Jung micrometer. Hemocytes were mounted with Acquovitrex (Carlo Erba Reagents, Cornaredo, Italy). Finally, slides were observed under a light microscope at 1250x magnification.

Statistical analyses

Each experiment was replicated three times with three independent colonies (n = 3); data are expressed as means [+ or -] SD. Multiple comparisons were carried out with ANOVA; means were compared using Duncan's test (Snedecor and Cochran, 1980).

Results

Gene and transcript organization

The PCR amplification of BsGCLM produced an amplicon of 535 base pairs (bp). The coding sequence is 870 bp long, and is flanked by 5'-UTR and 3'-UTR regions of 54 and 626 bp, respectively (GenBank ID no. KT12002). The sequence includes one exon of 1550 bp (Fig. 1).

Amplification with BsGSF and BsGSR resulted in an amplicon of 304-bp sharing similarity with other deuterostome glutathione synthases (GSs) (GenBank accession no. KT120025). The coding sequence consists of 1278 bp and the gene includes 7 exons (Fig. 1) with the ATG start codon located in the first exon and the TAG stop codon in the last exon. All of the introns were provided with the canonical guanine timine (GT) and adenine guanine (AG) splicing signal consensus.

[FIGURE 1 OMITTED]

Amplification with BsGPx5F and BsGPx5R produced an amplicon of 493 bp that, after sequencing and BLAST comparison, resulted in vertebrate transcripts similar to those of gpx3 and gpx6. This transcript presents a 675-bp coding sequence, with 5'-UTR and 3'-UTR regions of 58 and 184 bp, respectively (GenBank ID no. KT120026). The structure of the gene was analyzed by comparing the cDNA and the genomic sequences. It includes 5 exons (Fig. 1), with the ATG start codon located in the first exon and the TAG stop codon in the last exon. All of the introns were provided with the canonical GT and AG splicing signal consensus.

The PCR amplification with BsGPx3F and BsGPx3R gave an amplicon of 662 bp that, after sequencing and BLAST comparison, resulted in transcripts similar to those of gpxb and gpxc of Ciona intestinalis. The bsgpx3 transcript has a coding sequence of 636 bp, with 5' UTR and 3' UTR regions of 128 bp and 239 bp, respectively (GenBank accession no. KT120027). The gene structure was analyzed by comparing the cDNA and the genomic sequences. It includes 5 exons (Fig. 1), with the ATG start codon located in the first exon and the TGA stop codon in the last exon. All of the introns were provided with the canonical GT and AG splicing signal consensus.

BsSODF and BsSODR amplified a sequence of 322 bp, similar to Cu/Zn SOD from other deuterostomes. The coding sequence of this transcript spans 447 bp in length and is flanked by 5' UTR and 3' UTR regions of 305 bp and 305 bp, respectively (GenBank accession no. KT120028). The structure of the gene was analyzed by comparing the cDNA and the genomic sequences. It includes two exons and one intron (Fig. 1) with canonical GT and AG splicing signal consensus.

Protein organization

In silico translation of the bsgclm transcript resulted in a putative protein of 289 amino acids with an Aldo/keto reductase superfamily domain extending from residues 85 to 208, required for antioxidant activity (Fig. 2A; Supplementary Fig. 1A, view online). BsGCLM, when aligned with the same protein of other deuterostomes, showed identities ranging from 34.3% (C. intestinalis) to 28.7% (Xenopus laevis and Salmo salar) (Supplementary Fig. 1A, view online).

In silico translation of the transcript of bsgs gave a putative protein of 425 amino acids with an eu-GS superfamily domain, typical of glutathione synthases (GSs) and necessary for the creation of the ATP-dependent bond between [gamma]-glutamylcysteine and glycine, spanning from amino acid 10 to 400 (Fig. 2B; Supplementary Fig. 1B, view online). BsGS, when aligned with the same protein of other deuterostomes, showed identities ranging from 38.8% (Branchiostoma floridae) to 32.6% (Danio rerio). By comparing multiple alignments of the predicted amino acid sequence of BsGS with other deuterostome GSs, we recognized the amino acids of the active sites ([Met.sup.129], [He.sup.143], [Lys.sup.309], [Asn.sup.368], [Tyr.sup.370], the MEKI motif, [Glu.sup.427], [Lys.sup.454]); the ATP-binding amino acids ([He.sup.143], [Lys.sup.309], [Val.sup.365], [Lys.sup.367], the MEKI motif, [Glu.sup.427], [Lys.sup.454]); the magnesium-binding sites ([Glu.sup.144], [Asn.sup.146], [Glu.sup.371]); and the GSH-binding sites ([Arg.sup.123], [Ala.sup.148], [Ser.sup.150], [Glu.sup.215], [Asn.sup.217], [Gin.sup.221], [Arg.sup.452], [Val.sup.463], [Ala.sup.464]), all conserved in the Botryllus schlosseri sequence (Supplementary Fig. 1B, view online).

In silico translation of the transcript of bsgpx5 resulted in a putative protein of 224 amino acids that included a conserved GSH-peroxidase domain (residues 30-145), necessary for hydroperoxide reduction by GSH, which acts as an electron donor (Fig. 2C; Supplementary Fig. 1C, view online). BsGPx5, when aligned with the same protein of other deuterostomes, showed identities ranging from 34.5% (C. intestinalis GPxc) to 24.8% (B. floridae). By comparing multiple alignments of the predicted amino acid sequence of BsGPx5 with other deuterostome GPx, we identified two conserved amino acids of the active sites involved in catalytic activity in other deuterostomes ([Gin.sup.95], [Trp.sup.173]). Residue 61, aligning with conserved U/C (cysteine with serine/cysteine) in vertebrates, is represented by a Ser, as in B.floridae (Supplementary Fig. 1C, view online).

[FIGURE 2 OMITTED]

In silico translation of the bsgpx3 transcript resulted in a putative protein of 211 amino acids that included a conserved GSH-peroxidase domain, from residue 34 to 149 (Fig. 2C; Supplementary Fig. 1C, view online). BsGPx3, when aligned with the same protein of other deuterostomes, showed identities ranging from 38.2% (C. intestinalis GPxb) to 25% (B. floridae). By comparing multiple alignments of the predicted amino acid sequence of BsGPx3 with those of other deuterostome GPxs, we recognized the three amino acids of the active sites involved in catalytic activity (Sec/[Cys.sup.161], [Gin.sup.95], [Tip.sup.173]) (Supplementary Fig. 1C, view online).

In silico translation of the transcript of bscu/znsod resulted in a protein of 148 amino acids, with the Cu-Zn superoxide dismutase superfamily domain extending from residue 1 to 140 (Fig. 2D; Supplementary Fig. 1D, view online). BsCu/ZnSOD, when aligned with the same protein of other deuterostomes, showed identities that ranged from 57.9% (Ovis aries, Bos taurus, Bos grunniens) to 20.5% (C. intestinalis). By comparing multiple alignment of the predicted amino acid sequence of BsCu/ZnSOD with other deuterostome Cu/ZnSODs, we were able to recognize the amino acids of the active sites that bind cadmium ([His.sup.41], [His.sup.43], [His.sup.115]), zinc ([His.sup.66], [His.sup.75]), zinc and cadmium ([His.sup.58]), as well as those involved in antioxidant reactions ([Thr.sup.132], [Arg.sup.l3X]) (Supplementary Fig. 1D, view online).

Phylogenetic analyses

Phylogenetic trees were obtained from multiple alignments, using Clustal W on the predicted amino acid sequences of each considered transcript. All of the methods used gave similar results, but only trees that were obtained using maximum likelihood (ML) are presented. Trees of GCLM and GS showed that the tunicate cluster, represented by Botryilus schlosseri and Ciona intestinalis, is always positioned close to the cephalocordate + vertebrate clade (Figs. 3, 4).

As regards the phylogenetic reconstruction of deuterostome GPxs, BsGPx5 clusters together with C. intestinalis GPxc and Xenopus laevis, Xenopus tropicalis, and Danio rerio GPx3, as the sister group of vertebrate GPx1, GPx2, and GPx4 (Supplementary Fig. 2, view online), whereas BsGPx3 groups with C. intestinalis GPxc, X. laevis, and X. tropicalis GPx3, and Branchiostoma floridae GPx (Supplementary Fig. 3, view online). BsSOD clusters with B.floridae SOD; C. intestinalis SOD appears unrelated to the vertebrate group (Fig. 5).

[FIGURE 3 OMITTED]

qRT-PCR

When analyzed in the course of the blastogenetic cycle, the total amount of mRNAs for BsGCLM, BsCu/ZnSOD, and BsGPx5 significantly (P < 0.001) decreased during take-over with respect to MC. Conversely, BsGPx3, in the same conditions, significantly (P < 0.001) increased its mRNA level. The amount of mRNA for BsGS did not significantly change during TO phase with respect to mid-cycle (Fig. 6A).

Upon cadmium (Cd) exposure, the relative expression of the considered genes was deeply regulated. The quantity of mRNAs of bscu/znsod, bsgpx3, and bsgs that resulted were significantly (P < 0.05) increased, reaching the maximum amount of mRNAs, from 3- to 13-fold induction, after 2 h of treatment with Cd. The quantity then gradually decreased, with the lowest value seen at 6 h of treatment. Conversely, the level of mRNAs for BsGCLM and BsGPx5 decreased with respect to the control; BsGPx5 returned to the control value after 6 h (Fig. 6B).

[FIGURE 4 OMITTED]

In-situ hybridization

In colony sections, only hemocytes contained detectable levels of transcripts for BsGCLM, BsGS, BsCu/ZnSOD, BsGPx3, and BsGPx5 (data not shown). A more detailed analysis of hemocyte smears revealed that only immunocytes were labeled. In the presence of the specific riboprobes for BsGCLM and BsGPx3, cytotoxic morula cells and phagocytes were labeled, the former (BsGCLM) prevailing at take-over, and BsGPx3 prevailing at mid-cycle. Morula cells, at takeover, and phagocytes, at mid-cycle and take-over, were also recognized by antisense probes for BsGS and BsCu/ZnSOD, whereas only phagocytes were labeled by the probe for BsGPx5 (at mid-cycle and take-over). In addition, undifferentiated young cells, also called hemoblasts, appeared stained with the specific probes for GPx5 and Cu/ZnSOD in both mid-cycle and take-over. Incubation with the sense probes gave no labeling of the cells (Fig. 7).

Discussion

Despite the phylogenetic position of tunicates as the vertebrate sister group, their stress responses have been poorly investigated until now. A limited but increasing body of evidence indicates that ascidian hemocytes play important roles in stress responses by producing antioxidant molecules able to counteract the stress-related increase of ROS production (Franchis et al., 2011, 2012, 2014; Ferro et al., 2013).

In the compound ascidian Botryllus schlosseri, high quantities of ROS are produced both during the non-fusion reaction between genetically incompatible colonies, resulting in diffuse cytotoxicity along the contact region (Ballarin et al., 2002) and at take-over, as a consequence of the increased respiratory burst in phagocytes that have ingested apoptotic cells and corpses deriving from the tissues of the old zooids (Cima et al., 2010; Franchi et al., 2016). In both processes, hemocytes are directly involved. Although some of them undergo ROS-induced cell death, most hemocytes do not die, suggesting their ability to overcome unfavorable conditions.

In the present work, we identified and characterized the transcripts for five Botryllus schlosseri enzymes (BsSOD, BsGCLM, BsGS, BsGPx3, and BsGPx5) involved in ROS detoxification mechanisms. To our knowledge, this is the first study of these genes in Botryllus. In addition, we demonstrated the modulation of the transcription of the abovereported genes during take-over and on exposure to cadmium. In both cases, increased production of ROS has been reported (Cima et al., 2010; Franchi and Ballarin, 2013). This suggests that oxidative stress is the cause of the observed gene modulation and that cells face an increasing level of ROS by producing thiol-containing molecules, such as glutathione (GSH), or antioxidant enzymes. The location of the transcripts in immunocytes, as revealed by in situ hybridization, supports our previous observations in the solitary ascidian Ciona intestinal is (Franchi et al., 2011, 2012, 2014; Ferro et al., 2013), indicating that, in the absence of detoxifying organs, hemocytes represent the main detoxification system of tunicates. The reported presence of some transcript-related labeling in young hemocytes probably marks their first steps towards fully differentiated circulating cells.

[FIGURE 5 OMITTED]

The main intracellular antioxidant molecule is represented by GSH, a tripeptide ([gamma]-glutamylcysteinylglycine) with a thiol group able to react with ROS, resulting in the formation of oxidized GSH (GSSG). In mammals, the synthesis of GSH involves two ATP-dependent reactions catalyzed by different enzymes. The first is [gamma]-glutamyl-cysteine ligase (GCL), composed of a catalytic and a modulatory subunit (GCLC and GCLM, respectively) (Griffith, 1999; Dickinson and Forman, 2002). The second enzyme is glutathione synthase (GS), which catalyzes the binding of L-glycine to previously formed [gamma]-glutamylcysteine. The transcripts for both genes are present in Botryllus immunocytes, either in phagocytes or morula cells. The amount of transcripts for BsGCLM decreases during take-over, as well as during Cd-treatment, suggesting a weak contribution of this subunit and, consequently, a probable major role of GCLC in the regulation of GSH synthesis in B. schlosseri. The increase in the amount of mRNA for BsGS in hemocytes from Cd-exposed colonies is probably due to Cd-induced oxidative stress, in accordance with the known induction of GSH synthesis by ROS (Franchi et al., 2012; Jeppe et al., 2014). In contrast, the absence of modulation in the level of transcript for BsGS, during the generation change, probably represents the equilibrium between the increase in gene expression, as a consequence of oxidative stress, and the decrease in the total number of aged cells as a consequence of apoptosis at take-over.

Among the detoxifying enzymes, superoxide dismutase (SOD) catalyzes a redox reaction, converting superoxide anions into molecular oxygen and hydrogen peroxide (Fridovich, 1986). GPxs, however, catalyze the reduction of peroxides using GSH as substrate (Sunde and Hoekstra, 1980). Members of the GPx family can include a selenocysteine (SEC) residue in their N-terminal region. This residue is related to the presence of a SEC insertion sequence (SECIS) in the corresponding mRNA that allows the translation of the UGA codon of the catalytic site as SEC instead of as a STOP codon (Brigelius-Flohe, 1999; Brigelius-Flohe and Maiorino, 2013). In mammals, eight types of GPx have been identified so far (Brigelius-Flohe and Maiorino, 2013), expressed in various tissues (Ghyselinck et al., 1993; Arthur, 2000; Toppo et al., 2008; Brigelius-Flohe and Maiorino, 2013).

[FIGURE 6 OMITTED]

As stated earlier, our results indicated that the transcripts of these enzymes change during take-over and upon Cd exposure. For Cd, we observed an increase in the amount of mRNA for BsGS, BsGPx3, and BsCu/ZnSOD in exposed colonies. This finding is in agreement with the results obtained in solitary ascidians, which saw an increase in the transcription of genes for GCLC, GCLM, GS, metallothioneins, phytochelatin synthase, and SODb in Ciona intestinalis after treatment with 10 [micro]mol [l.sub.-1] Cd[Cl.sub.2] (Franchi et al., 2011, 2012, 2014; Ferro et al., 2013). The met al., cadmium, can deeply influence cysteine metabolism, acting at the level of the trans-sulfuration pathway, and cysteine is essential in detoxification processes because the amino acid is required for the synthesis of nonenzymatic, thiol-rich molecules, such as GSH, metallothioneins, and phytochelatins (Hughes et al., 2009; Jeppe et al., 2014).

The identified BsCu/ZnSOD lacks the signal peptide and can be considered an intracellular enzyme. According to the in silico hybridization results, its mRNA is located in morula cells and phagocytes. The lower amount of transcript at takeover is probably related to the fact that the transcripts are present in mature immunocytes, most of which, in this phase of the colonial blastogenetic cycle, undergo cell death by apoptosis (Cima et al., 2010). However, the gene is activated by Cd exposure, resulting in an increase in the transcript level, in agreement with what was observed for the intracellular SOD of C. intestinalis (Ferro et al., 2013).

GPxs include enzymes with or without the SECIS element, corresponding to a SEC or a Cys residue in the active site of the proteins, respectively. BsGPx3 shares with vertebrate GPx3 and GPx6 the presence of the SECIS. In addition, like vertebrate GPx3, BsGPx3 has the signal peptide that is absent in vertebrate GPx6. BsGPx5 lacks the SECIS and presents the signal peptide, as with vertebrate GPx5. What is unusual in BsGPx5 is the substitution of a Cys with a Ser residue, which has no reported antioxidant activity, in the catalytic site. The mRNA of both enzymes is mainly located in phagocytes, with BsGPx3 mRNA detectable only during the mid-cycle, when most of the phagocytes assume the spreading morphology and are not massively involved in phagocytosis (Ballarin et al., 1994).

Different structure, pattern of expression, and response to Cd[Cl.sub.2] treatment strongly suggest different roles for the two BsGPx enzymes, with BsGPx3 more active in oxidative stress response and BsGPx5 probably involved in cellular homeostasis. This fits the observed increase in the amount of the mRNA for BsGPx3 at the generation change and in the presence of Cd, both the situations being marked by high ROS production. The decrease of the transcript level for BsGPx5, as detected by qRT PCR, at the take-over can be related to the decrease in the number of mature phagocytes in the colonial circulation.

Since changes in the amount of total mRNA do not necessarily correlate with changes in protein synthesis, these transcriptional data need to be augmented by quantification of the products (e.g., through the measure of enzyme activity), the focus of future research.

Acknowledgments

This work was supported by the Italian Ministry of Education, Universities and Research (MIUR; Prin 2010/11, 20109XZEPR).

Literature Cited

Abe, Y., G. Ishikawa, H. Satoh, K. Azumi, and H. Yokosawa. 1999. Primary structure and function of superoxide dismutase from the ascidian Halocynthia roretzi. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 122: 321-326.

Arthur, J. R. 2000. The glutathione peroxidases. Cell. Mol. Life Sci. 57: 1825-1835.

Ballarin, L., and F. Cima. 2005. Cytochemical properties of Botryllus schlosseri haemocytes: indications for morpho-functional characterisation. Eur. J. Histochem. 49: 255-264

Ballarin, L., F. Cima, and A. Sabbadin. 1994. Phagocytosis in the colonial ascidian Botryllus schlosseri. Dev. Comp. Immunol. 18: 467-481.

Ballarin, L., A. Franchini, E. Ottaviani, and A. Sabbadin. 2001. Morula cells as the major immunomodulatory hemocytes in ascidians: evidence from the colonial species Botryllus schlosseri. Biol. Bull. 201: 59-64.

Ballarin, L., F. Cima, M. Floreani, and A. Sabbadin. 2002. Oxidative stress induces cytotoxicity during rejection reaction in the compound ascidian Botryllus schlosseri. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 133: 411-418.

Ballarin, L., P. Burighel, and F. Cima. 2008a. A tale of death and life: natural apoptosis in the colonial ascidian Botryllus schlosseri (Urochordata, Ascidiacea). Curr. Pharm. Des. 14: 138-147.

Ballarin, L., A. Menin, L. Tallandini, V. Matozzo, P. Burighel, G. Basso, E. Fortunato, and F. Cima. 2008b. Haemocytes and blastogenetic cycle in the colonial ascidian Botryllus schlosseri: a matter of life and death. Cell Tissue Res. 331: 555-564.

Ballarin, L., F. Schiavon, and L. Manni. 2010. Natural apoptosis during the blastogenetic cycle of the colonial ascidian Botryllus schlosseri: a morphological analysis. Zool. Sci. 27: 96-102.

Brigelius-Flohe, R. 1999. Tissue-specific functions of individual glutathione peroxidases. Free Radic. Biol. Med. 27: 951-965.

Brigelius-Flohe, R., and M. Maiorino. 2013. Glutathione peroxidases. Biochim. Biophys. Acta 1830: 3289-3303.

Campagna, D., F. Gasparini, N. Franchi, N. Vitulo, F. Ballin, L. Manni, G. Valle, and L. Ballarin. 2016. Transcriptome dynamics in the asexual cycle of the chordate Botryllus schlosseri. BMC Genomics 17: 275.

Canesi, L. 2015. Pro-oxidant and antioxidant processes in aquatic invertebrates. Ann. N. Y. Acad. Sci. 1340: 1-7.

Cima, F., and L. Ballarin. 2009. Apoptosis and pattern of Bcl-2 and Bax expression in the alimentary tract during the colonial blastogenetic cycle of Botryllus schlosseri (Urochordata, Ascidiacea). Ital. J. Zool. 76: 28-42.

Cima, F., G. Basso, and L. Ballarin. 2003. Apoptosis and phosphatidylserinemediated recognition during the take-over phase of the colonial life-cycle in the ascidian Botryllus schlosseri. Cell Tissue Res. 312: 369-376.

Cima, F., A. Sabbadin, and L. Ballarin. 2004. Cellular aspects of allorecognition in the compound ascidian Botryllus schlosseri. Dev. Comp. Immunol. 28: 881-889.

Cima, F., L. Manni, G. Basso, E. Fortunato, B. Accordi, F. Schiavon, and L. Ballarin. 2010. Hovering between death and life: natural apoptosis and phagocytes in the blastogenetic cycle of the colonial ascidian Botryllus schlosseri. Dev. Comp. Immunol. 34: 272-285.

De la Fuente, M., and V. M. Victor. 2000. Anti-oxidants as modulators of immune function. Immunol. Cell Biol. 78: 49-54.

Delsuc, F., H. Brinkmann, D. Chourrout, and H. Philippe. 2006. Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature 439: 965-968.

Dickinson, D. A., and H. J. Forman. 2002. Cellular glutathione and thiols metabolism. Biochem. Pharmacol. 64: 1019-1026.

Ferro, D., N. Franchi, V. Mangano, R. Bakiu, M. Cammarata, N. Parrinello, G. Santovito, and L. Ballarin. 2013. Characterization and metal-induced gene transcription of two new copper zinc superoxide dismutases in the solitary ascidian Ciona intestinalis. Aquat. Toxicol. 140-141: 369-379.

Franchi, N., and L. Ballarin. 2013. Influence of cadmium on the morphology and functionality of haemocytes in the compound ascidian Botryllus schlosseri. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 158: 29-35.

Franchi, N., F. Boldrin, L. Ballarin, and E. Piccinni. 2011. CiMT-1, an unusual chordate metallothionein gene in Ciona intestinalis genome: structure and expression studies. J. Exp. Zool. A Ecol. Genet. Physiol. 315A: 90-100.

Franchi, N., D. Ferro, L. Ballarin, and G. Santovito. 2012. Transcription of genes involved in glutathione biosynthesis in the solitary tunicate Ciona intestinalis exposed to metals. Aquat. Toxicol. 114-115: 14-22.

Franchi, N., E. Piccinni, D. Ferro, G. Basso, B. Spolaore, G. Santovito, and L. Ballarin. 2014. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium. Aquat. Toxicol. 152: 47-56.

Franchi, N., L. Ballarin, and F. Cima. 2015. Insights on cytotoxic cells of the colonial ascidian Botryllus schlosseri. lnvertebr. Surviv. J. 12: 109-117.

Franchi, N., F. Ballin, L. Manni, F. Schiavon, G. Basso, and L. Ballarin. 2016. Recurrent phagocytosis-induced apoptosis in the cyclical generation change of the compound ascidian Botryllus schlosseri. Dev. Comp. Immunol. 62: 8-16.

Fridovich, I. 1986. Superoxide dismutases. Adv. Enzymol. Relat. Areas Mol. Biol. 58: 61-97.

Gasparini, F., L. Manni, F. Cima, G. Zaniolo, P. Burighel, F. Caicci, N. Franchi, F. Schiavon, F. Rigon, D. Campagna, and L. Ballarin. 2015. Sexual and asexual reproduction in the colonial ascidian Botryllus schlosseri. Genesis 53: 105-120.

Ghyselinck, N. B., I. Dufaure, J. J. Lareyre, N. Rigaudiere, M. G. Mattei, and J. P. Dufaure. 1993. Structural organization and regulation of the gene for the androgen-dependent glutathione peroxidase-like protein specific to the mouse epididymis. Mol. Endocrinol. 7: 258-272.

Griffith, O. W. 1999. Biologic and pharmacologic regulation of mammalian glutathione synthesis. Free Radic. Biol. Med. 27: 922-935.

Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696-704.

Hughes, S. L., J. G. Bundy, E. J. Want, P. Kille, and S. R. Sturzenbaum. 2009. The metabolomic responses of Caenorhabditis elegans to cadmium are largely independent of metallothionein status, but dominated by changes in cystathionine and phytochelatins. J. Proteome Res. 8: 3512-3519.

Jeppe, K. J., M. E. Carew, S. M. Long, S. F. Lee, V. Pettigrove, and A. A. Hoffmann. 2014. Genes involved in cysteine metabolism of Chironomus tepperi are regulated differently by copper and by cadmium. Comp. Biochem. Physiol. 162C: 1-6.

Kaloyianni, M., S. Dailianis, E. Chrisikopoulou, A. Zannou, S. Koutsogiannaki, D. H. Alamdari, G. Koliakos, and V. K. Dimitriadis. 2009. Oxidative effects of inorganic contaminants on haemolymph of mussels. Comp. Biochem. Physiol. 149C: 631-639.

Koutsogiannaki, S., S. Franzellitti, S. Kalogiannis, E. Fabbri, V. K. Dimitriadis, and M. Kaloyianni. 2015. Effects of cadmium and 17[beta]-estradiol on Mytilus galloprovincialis redox status. Prooxidantantioxidant balance (PAB) as a novel approach in biomonitoring of marine environments. Mar. Environ. Res. 103: 80-88.

Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez et al. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.

Lauzon, R. J., K. J. Ishizuka, and I. L. Weissman. 1992. A cyclical, developmentally regulated death phenomenon in a colonial urochordate. Dev. Dyn. 194:71-83.

Lauzon, R. J., C. W. Patton, 1. L. Weissman. 1993. A morphological and immunohistochemical study of programmed cell death in Botryllus schlosseri (Tunicata, Ascidiacea). Cell Tissue Res. 272: 115-127.

Lesser, M. P. 2006. Oxidative stress in marine environments: biochemistry and physiological ecology. Annu. Rev. Physiol. 68: 253-278.

Liu, J., Z. X. Zhou, W. Zhang, M. W. Bell, and M. P. Waalkes. 2009. Changes in hepatic gene expression in response to hepatoprotective levels of zinc. Liver Int. 29: 1222-1229.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the [MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII] method. Methods 25: 402-408.

Manni, L., G. Zaniolo, F. Cima, P. Burighel, and L. Ballarin. 2007. Botryllus schlosseri: a model ascidian for the study of asexual reproduction. Dev. Dyn. 236: 335-352.

Mugica, M., U. Izagirre, and I. Marigomez. 2015. Lysosomal responses to heat-shock of seasonal temperature extremes in Cd-exposed mussels. Aquat. Toxicol. 164: 99-107.

Puppel, K., A. Kapusta, and B. Kuczynska. 2015. The etiology of oxidative stress in the various species of animals, a review. J. Sci. Food Agric. 95: 2179-2184.

Rzhetsky, A., and M. Nei. 1992. Statistical properties of the ordinary least-squares, generalized least squares, and minimum-evolution methods of phylogenetic inference. J. Mol. Evol. 35: 367-375.

Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.

Sneath, A., and R. Sokal. 1973. Numerical Taxonomy: the Principles and Practice of Numerical Classification. Freeman, San Francisco, CA.

Snedecor, G. W., and W. G. Cochran. 1980. Statistical Methods, 7th ed. Iowa State University Press, Ames.

Sourdis, J., and M. Nei. 1988. Relative efficiencies of the maximum parsimony and distance-matrix methods in obtaining the correct phylogenetic tree. Mol. Biol. Evol. 5: 298-311.

Sunde, R. A., and W. G. Hoekstra. 1980. Structure, synthesis and function of glutathione peroxidase. Nutr. Rev. 38: 265-273.

Tamura, K., G. Stecher, D. Peterson, A. Filipski, and S. Kumar. 2013. MEGA6: Molecular Evolutionary Genetics analysis Version 6.0. Mol. Biol. Evol. 30: 2725-2729.

Tang, X., Y. Nakata, H. O. Li, M. Zhang, H. Gao, A. Fujita, O. Sakatsume, T. Ohta, and K. Yokoyama. 1994. The optimization of preparations of competent cells for transformation of E. coli. Nucleic Acids Res. 22: 2857-2858.

Tomanek, L. 2014. Proteomics to study adaptations in marine organisms to environmental stress. J. Proteomics 105: 92-106.

Toppo, S., S. Vanin, V. Bosello, and S. C. Tosatto. 2008. Evolutionary and structural insights into the multifaceted glutathione peroxidase (Gpx) superfamily. Antioxid. Redox Signal. 10: 1501-1514.

Voskoboynik, A., N. F. Neff, D. Sahoo, A. M. Newman, D. Pushkarev, W. Koh, B. Passarelli, H. C. Fan, G. L. Mantalas, K. J. Palmeri et al. 2013. The genome sequence of the colonial chordate, Botryllus schlosseri. Elife 2: e00569.

Zeeshan, H. M., G. H. Lee, H. R. Kim, and H. J. Chae. 2016. Endoplasmic reticulum stress and associated ROS. Int. J. Mol. Sci. 17: 327.

NICOLA FRANCHI, FRANCESCA BALLIN (*), AND LORIANO BALLARIN

Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35121 Padova, Italy

Received 25 July 2016; accepted 30 January 2017; Published online 3 April 2017.

(*) To whom correspondence should be received. E-mail: ballin.fra@gmail.com

Abbreviations: AG, adenine guanine (splicing consensus signal); ATG, start signal; CDS, coding sequences; Cu/Zn SOD, Cu-Zn superoxide dismutase; EST, expressed sequence tag; GCL, [gamma]-glutamyl-cysteine ligase; GCLC, catalytic subunit of y-glutamyl-cysteine ligase; GCLM, modulatory subunit of [gamma]-glutamyl-cysteine ligase; GPx, glutathione peroxidase; GS, glutathione synthase; GSH, glutathione; GSSG, oxidized glutathione; GT, guanine timine (splicing consensus signal); ISH, in situ hybridization; MC, mid-cycle; ME, minimum evolution; ML, maximum likelihood; MP, maximum parsimony; NADPH, nicotinamide adenine dinucleotide phosphate; NJ, neighbor-joining; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PO, phenoloxidase; RACE, rapid amplification of the cDNA ends; ROS: reactive oxygen species; SEC, selenocysteine; SECIS, selenocysteine insertion sequence; SOD, superoxide dismutase; SODb, type B SOD; TAG, stop codon; TGA, thymine, guanine, and adenine nucleotides (stop codon); TO, take-over; UPGMA, unweighted pair group with arithmetic mean; UTR, untranslated region.
Table I
PCR primers used and relative melting temperatures (Tm)

  Primer    Tm ([degrees]C)        Sequence 5'-3'

BsGCLF             53        GTTGGAAAGAATCGGTAGGG
BsGCLFR            57.4      GCTTGGAATGACTTCTCAGGGAG
BsGCLF-RT          53.9      CGAAAGCGTTGAGTGTATGG
BsGCLM-RT          56.9      CAAAATCAGTCACGCCGATGTG
BsGSF              55.2      CGAAGCCAACATCATCCGA
BsGSR              55        CTCGGTTCGCTCTCATCTG
BsGSF-RT           60        CATGCGATCAGTCAAGATCC
BsGSR-RT           60        TTGCCATTGCAGTCTTCTTG
BsGPx5F            57.8      CATTGCTTGTTGCGAGTGCC
BsGPx5R            57        GCCACCAGAGTGTCCCAATA
BsGPx5F-RT         60        GGAAATGGATGGACGCCGCA
BsGPx5R-RT         60        CCTAACTCTTCGGTGTATGCGGGAC
BsGPx3F            58        CGTCGCTACAAGACAAGGTGG
BsGPx3R            55        ACATCTCCAACGCAAGTCC
BsGPx3R-RT         59.3      GGAAGCCACGACACCTTGC
BsSODF             58.4      CCACGGGTTTCACATTCACGAG
BsSODR             60.9      AATCCAATCACGCCACACGCC
BsSODF-RT          60        CTGTGCAAGGACTGACTCCA
BsSODR-RT          60        CCGGCATGATCAACCTTAGT
BsACTF-RT          60        ACTGGGACGACATGGAGAAG
BsACTR-RT          60        GCTTCTGTGAGGAGGACAGG
M13F               55        TTGTAAAACGACGGCCAGT
M13R               50        CAGGAAACAGCTATGACC
dT Anchor          57        ACCACGCGTATCGATGTCG (dT)16
Anchor             57        ACCACGCGTATCGATGTCG

PCR, polymerase chain reaction.
COPYRIGHT 2017 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Franchi, Nicola; Ballin, Francesca; Ballarin, Loriano
Publication:The Biological Bulletin
Article Type:Report
Date:Feb 1, 2017
Words:7456
Previous Article:Genetic and morphological differentiation of the semiterrestrial crab Armases angustipes (Brachyura: Sesarmidae) along the Brazilian coast.
Next Article:Comparative molecular and morphological variation analysis of Siderastrea (Anthozoa, Scleractinia) reveals the presence of Siderastrea stellata in...
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |