Printer Friendly

Prospecting molecular markers to distinguish Cichla kelberi, C. monoculus and C. piquiti/Prospeccao de marcadores moleculares para distincao de Cichla kelberi, Cichla monoculus e Cichla piquiti.

Introduction

Fish of the genus Cichla belong to the order Perciformes and the family Cichlidae, popularly known in Brazil as peacock bass (Tucunare). The family is one of the main models of speciation in evolutionary biology due to its diversification on the Great Lakes of Africa, which led to the formation of species with different ecological adaptations in a relatively short period of geological time (JOYCE et al., 2011). Thus, it has been focused upon by many phylogenetic researches (LOPEZ-FERNANDEZ et al., 2010).

The genus Cichla, widely distributed in neotropical regions, derives from a monophyletic lineage and is considered the baseline genus for a divergence of neotropical cichlids (FARIAS et al., 2001). The genus has 15 described species which are native to Tocantins, Amazon and Orinoco river basins (KULLANDER; FERREIRA, 2006). Since genetic analysis has shown genetic introgression among some of the species, the validity of this classification has been questioned (WILLIS et al., 2012).

The introduction of species in the upper Parana River basin, developed by hydroelectric companies (ESPINOLA et al., 2010), is a strategy to increase fish stocks which started in the 1990s (AGOSTINHO et al., 2007). However, the origin of this genus in the Parana river basin is officially unknown, except for some reports of accidental tanks leaks involving Cichla monoculus (Block & Schneider, 1801) during the January 1997 flood in the Paranapanema and Tibagi rivers (ORSI; AGOSTINHO, 1999).

Other relevant aspects related to the illegal introduction of the species are related to its characteristics as sports fishing, due to its aggressiveness when caught with artificial baits, and to the commercial acceptance of its meat (WINEMILLER, 2001, AGOSTINHO et al., 2007; PELICICE; AGOSTINHO, 2009).

The genus Cichla is documented in the Upper Parana River floodplain since the 1990s with special reference to Cichla kelberi and C. piquiti (KULLANDER; FERREIRA, 2006; GRACA; PAVANELLI, 2007). Moreover, a third species, C. monoculus, has been documented in the Parana River upstream segment (BRINEZ et al., 2013).

The capture of a great number of juveniles of the genus in the above-mentioned environment has shown a high degree of the species' reproduction success in the Upper Parana River floodplain (ESPINOLA et al., 2010). The hybridization between C. kelberi and C. piquiti recorded by genetic researches is another important event that has occurred in the floodplain (ALMEIDA-FERREIRA et al., 2011; OLIVEIRA et al., 2008, 2006).

Combination analyses of molecular markers that identify regions which display different evolutionary rates are necessary to understand the complex evolutionary process in neotropical fish (FABRIN et al., 2014; BEHEREGARAY, 2008) and its hybridization dynamics (MIMS et al., 2010; STREELMAN et al., 2004). In fact, genetic studies are important to provide data that may be used in taxonomic characterization, supporting ecological studies aiming at the management of hybrid populations.

Current research prospects DNA sequences capable of distinguishing the three species C. kelberi, C. piquiti and C. monoculus.

Material and methods

Samples

Tissues preserved in alcohol 70% from the tissue bank of the Genetics Laboratory of The Research Center of Limnology Ichthyology and Aquaculture (NUPELIA), State University of Maringa, were used for DNA extraction. Cichla monoculus specimens from the Paranapanema River (n = 7) and Taquarucu reservoir (Upper Parana River basin), used by Brinez et al. (2013), were retrieved, coupled to Cichla kelberi (n = 6) and C. piquiti (n = 6) from Tocantins-Araguaia basin, used by Oliveira et al. (2006). Figure 1 demonstrates the sites from where the specimens were collected.

DNA amplification and sequencing

DNA extraction followed method by Prioli et al. (2002) and the Polymerase Chain Reactions (PCRs) were done in a total volume of 25 [micro]L containing Tris-KCl (20 mM Tris-HCl pH 8.4 with 50 mM KCl), 1.5 mM MgCl2, 2.5 [micro]M of each primer, 0.1 mM of each dNTP, 2.5 U of Taq DNA polymerase, 15 ng of DNA and Milli-Q water to complete the volume.

The nuclear locus tmo4c4 was amplified according to Schelly et al. (2006); primers described by Streelman et al. (1998) were used for locus tmo4c4; and primers described by Smith et al. (2008) were used for loci bmp4 and dlx2. The mitochondrial cytochrome oxidase I sequences (cox1) were amplified as described by Steinke et al. (2009) and the cytochrome b (cytb) region as described by Kocher et al. (1989).

Temperature conditions and time used in the amplification of the respective regions were appropriate and specified in Table 1. The amplified genes were sequenced individually in both directions using the primers already described (Table 2) with Big Dye Terminator kit. The nucleotide sequence determination was conducted in MegaBace automated sequencer (Amersham), according to the manufacturer's instructions.

Sequences analysis

Sequences were edited with BioEdit software while alignment (Clustal W) and distance p were determined with MEGA 6 software (TAMURA et al., 2013). Distance matrices were provided in the supplementary material.

Alignments were previously evaluated by the best-fit model test in MEGA 6 software to elaborate the phylogenetic reconstructions. Each was conducted through its bases substitution model by the maximum likelihood method. Each phylogeny used as a parameter 1000 bootstrap re-samplings with the presence of an outgroup (preferably of the same family and with closer phylogenetic analysis, considering the GenBank availability) and also conducted in MEGA 6. The phylogenetic analysis elucidated the clades, whilst bootstraps rates determined the validity of clades distinction. Table 3 provides the GenBank accession number of the sequences obtained in current study.

Results

The regions cox1 and cytb were individually evaluated for alignment. The number of variable sites was checked and evaluated according to the best evolutionary model. Sequences obtained from the region cox1 (544 bp) revealed 57 variable sites (10.47%). The Hasegawa-Kishino-Yano model with gamma distribution for the reconstruction of the mitochondrial phylogeny of the three species of Cichla from cox1 region was employed. Figure 2 provided the results of the phylogenetic reconstruction by the maximum likelihood method.

The second prospected mitochondrial region was related to cytochrome b (cytb) (464 bp) gene. Due to the low number of sequences obtained from the surveyed specimens, three sequences from GenBank (gi294471571, gi294471583 and gi294471565), one from each species, were included for comparison. Figure 2 shows the phylogenetic reconstruction of this region and was based on Hasegawa-Kishino-Yano model, performed by the maximum likelihood algorithm with 1000 bootstrap re-samplings.

Further, tmo4c4, dlx2 and bmp4 were the evaluated nuclear genome regions and the best evolution model, the number of variable sites and size of alignment were calculated for each region. After calculating the best evolution model for each region, the phylogenies were reconstructed with the maximum likelihood method, taking into consideration 1000 bootstrap re-samplings. Figure 3 demonstrates results for each region.

Among the smaller interspecific variation with less than 1%, the loci tmo4c4 and bmp4 were highlighted for all evaluated species. The accumulated variations at these loci do not appear to be enough for a sharp distinction since rates are close to the intraspecific variation ones.

Although the region with the highest intraspecific variation was cox1 (3.9%) for C. kelberi, it was less than or equal to interspecific rates discovered in this region for the combination with the other two species, perhaps due to the fact that the sequence of bases of specimen Ck12 differed a lot when compared to other specimens. The above may be observed in this group by the high standard deviation of the intrapopulational distance p (2.5%).

The lower intraspecific variations occurred in the species C. piquiti, in the cytb and tmo4c4 sequences (0 and 0.1%, respectively); tmo4c4 (0.1%) had the lowest rates for C. kelberi; whereas the greatest intraspecific distance rates (all greater than 4%) were from cox1 and cytb.

When interspecific and intraspecific average rates from the different prospected regions were compared, three loci showed lower internal species variations than the rate reported among the groups. Consequently, the three species could be differentiated. Although the mentioned regions were cytb, cox1 and dlx2, only cytb presented a significant difference among the maximum distance p values. cytb had the interspecific variation at least 2.15 times higher than the intraspecific variation rates. Differences between the rates of the maximum distance p were lower for regions cox1 and dlx2, with 1.07 and 1.125 times respectively.

However, other loci may be useful to distinguish the species and to evaluate the distances p between pairs of species. Species C. monoculus and C. piquiti could be segregated in the region cox1. The variation between the intra- and inter-specific distances p from these species is at least 2.12 times. However, it is still not possible to clearly distinguish C. kelberi from the others in this region since the intra- and inter-specific variations are very close to each other.

Among the nuclear loci evaluated, dlx2 seems to be the most promising when it comes to species differentiation. The variation of the groups' internal distance p was 0.7% for C. monoculus, 0.5% for C. kelberi and 1.6% for C. piquiti. When the genetic distances among the groups were compared, it could be perceived that they were at least 1.12 times different, if the smallest change that occurred in C. monoculus was considered with the other species. Table 4 shows the interspecific polymorphic sites between C. monoculus, C. kelberi and C. piquiti.

In the case of the nuclear region tmo4c4, low intraspecific variation is extant for C. piquiti, with low interspecific variation rates, and thus low variability in this region. The above indicates that the locus may not be suitable for the differentiation of these species. The evaluation of region bmp4 points in the same direction as the tmo4c4 analysis. Although the distance p variation for the region bmp4 indicates a distinction between C. piquiti and C. kelberi, a more precise evaluation shows the overlap of specimens of these species, which invalidates the use of this marker in the distinction.

Discussion

Although the cox1 region has been widely used to identify species and has even been used as the base sequence in the 'Barcodes of Life Data System Project' (BOLD) (RATNASINGHAM; HERBERT, 2003), the three species C. kelberi, C. piquiti and C. monoculus could not be identified by this region because the sequences failed to have enough variance to differentiate Cichla monoculus from Cichla kelberi. A similar result occurred for the cox1 region in the case of another cichlid genus (Oreochromis), in which the divergence was not significant to differentiate all the evaluated species (WU; YANG, 2012). Nevertheless, the region analysis could distinguish Cichla piquiti from the others.

The phylogeny based on the cytochrome b gene region (cytb) indicated the possibility of distinguishing specimens of the three species. Further, the spreading of specimens showed welldefined groupings for the three species. Since there is a clear divergence of species, the region's polymorphism seems to characterize them clearly.

The analysis of cytb region has been used in phylogenetic studies since it contains low and high variable regions, that is, more preserved regions and regions of wider domain. It may be thus considered a good marker for the study of molecular phylogeny in monophyletic families (FARIAS et al., 1999, 2001; GENNER et al., 2007; MUSILOVA et al., 2008; PUEBLA, 2009; SMITH et al., 2008). This region has also been used in biogeographical studies of the Cichla genus and demonstrated its potential for this purpose (WILLIS et al., 2007).

Although there is the distinction for the three species with locus dlx2, the region would be safer to distinguish between C. piquiti and C. kelberi. The gene is part of the group of 'dlx homeobox' gene family and is involved in the embryonic formation of the brain, jaws and teeth of vertebrates (PANGANIBAN; RUBESTEIN, 2002). In Lake Malawi's cichlids, the analysis of these sequences was able to distinguish two species with introgressive hybridization (MIMS et al., 2010). Further, it has been used for cichlids phylogeny in other research works (HULSEY et al., 2010; SMITH et al., 2008).

The nuclear locus tmo4c4 showed random and very low variability, preventing the species distinction process. The locus is known because of its low similarity to TINTIN proteins becoming an immunoglobulin domain. The region does not seem to be associated with positive selection (STREELMAN et al., 1998); for closely related species, the intraspecific diversity may be equal to interspecific differences.

The impossibility of 'bone morphogenic protein 4' (bmp4) gene usage may be due to its morphological differences among different species. The gene has been effective when used as a parameter for the study of the genetic relationships in other fish groups, such as the genus Scarus (SMITH et al., 2008). When East African cichlids were evaluated, the bmp4 gene could be found mainly associated with species that have undergone a rapid speciation and a high replacement rate (PUEBLA, 2009). This feature does not appear to be associated with the case of the genus Cichla, perhaps because the morphological characteristics of this group are not as diverse as African cichlids.

Phylogeny results show a greater proximity between C. kelberi and C. monoculus, which may be evidenced by the phylogenies presented to these loci. Results corroborate those reported by Willis et al. (2010) who, using the mitochondrial DNA controlling region, posited similarly the two species within the same cladze, whereas they placed C. Piquiti in another one.

When the mitochondrial regions were evaluated, although the positioning of the species evaluated for mitochondrial cox1 region was the same discovered for nuclear loci, it was possible to perceive an interesting difference in assessing the phylogeny of cytb locus. A greater proximity between C. monoculus and C. piquiti than C. monoculus and C. kelberi could be observed. The fact that there are discrepancies between the reconstructed phylogenies based on nuclear loci and mitochondrial is common (TOEWS; BRESFORD, 2012). However, in current study, the mitochondrial locus cox1 points at the same nuclear direction, while cytb points towards a discrepant one. Species closeness is another aspect that should be underscored.

Conclusion

Since the effectiveness of different loci in differentiating Cichla monoculus, C. kelberi and C. piquiti species is tested, the analysis foregrounds distinction between C. monoculus and C. kelberi from C. piquiti by cytb and dlx2 loci sequences, and the difference between C. piquiti from the other two species of the genus Cichla present in the upper Parana River basin by cox1.However, data rejected the use of bmp4 and tmo4c4 loci to identify these species.

References

AGOSTINHO A. A.; GOMES L. C.; PELICICE F. M. Ecologia e manejo de recursos pesqueiros em reservatorios no Brasil. Maringa: Eduem, 2007.

ALMEIDA-FERREIRA, G. C.; OLIVEIRA, A. V.; PRIOLI, A. J.; PRIOLI, S. M. A. P. Spar genetic analysis of two invasive species of Cichla (Tucunare) (Perciformes: Cichlidae) in the Parana river basin. Acta Scientiarum. Biological Sciences, v. 33, n. 1, p. 79-85, 2011.

BEHEREGARAY, L. B. Twenty years of phylogeography: the state of the field and the challenges for the Southern Hemisphere. Molecular Ecology, v.17, n. 17, p. 3754-3774, 2008.

BRINEZ, B; JULIO JR., H. F.; PRIOLI, S. M. A. P.; MANIGLIA, T. C.; PRIOLI, A. J. Molecular identification of Cichla (Perciformes: Cichlidae) introduced in reservoirs in Southern Brazil. Acta Scientiarum. Biological Sciences, v. 35, n. 2, p. 233-239, 2013.

ESPINOLA, L. A.; MINTE-VERA, C. V.; JULIO JR., H. F. Invasibility of reservoirs in the Parana Basin, Brazil, to Cichla kelberi Kullander and Ferreira, 2006. Biological Invasions, v. 12, n. 6, p. 1873-1888, 2010.

FABRIN, T. M. C.; SIMONE, I.; PRIOLI, S. M. A. P.; PRIOLI, A. J.; GASQUES, L. S. A utilizacao de marcadores na filogenia dos ciclideos (Teleostei: Perciformes): uma analise cienciometrica. Enciclopedia Biosfera, v. 10, n. 18, p. 3118-3128, 2014.

FARIAS, I. P.; ORTI, G.; SAMPAIO, I.; SCHNEIDER, H.; MEYER, A. Mitochondrial DNA phylogeny of the family Cichlidae: monophyly and fast molecular evolution of the neotropical assemblage. Journal of Molecular Evolution, v. 48, n. 6, p. 703-711, 1999.

FARIAS I. P.; ORTI G.; SAMPAIO I.; SCHNEIDER H.; MEYER A. The cytochrome b gene as a phylogenetic marker: the limits of resolution for analyzing relationships among cichlid fishes. Journal of Molecular Evolution, v. 53, n. 2, p. 89-103, 2001.

GENNER, M. J.; SEEHAUSEN, O.; LUNT, D. H.; JOYCE, D. A.; SHAW, P. W.; CARVALHO, G. R.; TURNER, G. F. Age of cichlids: new dates for ancient lake fish radiations. Molecular Biology and Evolution, v. 24, n. 5, p. 1269-1282, 2007.

GRACA, W. J.; PAVANELLI, C. S. Peixes da planicie de inundacao do alto rio Parana e areas adjacentes. Maringa: Eduem, 2007.

HULSEY, C. D.; MIMS, M. C.; PARNELL, N. F.; STREELMAN, J. T. Comparative rates of lower jaw diversification in cichlid adaptive radiations. Journal of Evolutionary Biology, v. 23, n. 7, p. 1456-1467, 2010.

JOYCE, D. A.; LUNT, D. H.; GENNER, M. J.; TURNER, G. F.; BILLS, R.; SEEHAUSEN, O. Repeated colonization and hybridization in Lake Malawi cichlids. Current Biology, v. 21, n. 3, p. R108-R109, 2011.

KOCHER, T. D.; THOMAS, W. K.; MEYER, A.; EDWARDS, S. V.; PAABO, S.; VILLABLANCA, F. X.; WILSON, A. C. Dynamics of mitochondrial DNA evolution in animals: amplification and Sequencing with conserved primers. Proceedings of the National Academy of Sciences, v. 86, n. 16, p. 6196-6200, 1989.

KULLANDER, S.; FERREIRA, E. A review of the South American cichlid genus Cichla, with descriptions of nine new species (Teleostei: Cichlidae). Ichthyological Exploration of Freshwaters, v. 17, n. 4, p. 289-398, 2006.

LOPEZ-FERNANDEZ, H.; WINEMILLER, K. O.; HONEYCUTT, R. L. Multilocus phylogeny and rapid radiations in Neotropical cichlid fishes (Perciformes: Cichlidae: Cichlinae). Molecular Phylogenetics and Evolution, v. 55, n. 3, p. 1070-1086, 2010.

MIMS, M. C.; HULSEY, D.; FITZPATRICK, B. M.; STREELMAN, J. T. Geography disentangles introgression from ancestral polymorphism in Lake Malawi cichlids. Molecular Ecology, v. 19, n. 5, p. 940-951, 2010.

MUSILOVA, Z.; RICAN, O.; JANKO, K.; NOVAK, J. Molecular phylogeny and biogeography of the Neotropical cichlid fish tribe Cichlasomatini (Teleostei: Cichlidae: Cichlasomatinae). Molecular Phylogenetics and Evolution, v. 46, n. 2, p. 659-672, 2008.

OLIVEIRA, V. F.; OLIVEIRA, A. V.; PRIOLI, A. J.; PRIOLI, S. M. A. P. Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes--Cichlidae), in Brazil. Acta Scientiarum. Biological Sciences, v. 30, n. 1, p. 83-89, 2008.

OLIVEIRA, A. V.; PRIOLI, A. J.; PRIOLI, S. M. A. P.; BIGNOTTO, T. S.; JULIO JR., H. F.; CARRER, H.; AGOSTINHO, C. S.; PRIOLI, L. M. Genetic diversity of invasive and native Cichla (Pisces: Perciformes) populations in Brazil with evidence of interspecific hybridization. Journal of Fish Biology, v. 69, n. sb, p. 260-277, 2006.

ORSI, M. L.; AGOSTINHO, A. A. Introducao de especies de peixes por escapes acidentais de tanques de cultivo em rios da Bacia do Rio Parana, Brasil. Revista Brasileira de Zoologia, v. 16, n. 2, p. 557-560, 1999.

PANGANIBAN G.; RUBESTEIN, J. L. R. Developmental functions of the Distal-less/Dlx homeobox genes. Development, v. 129, n. 19, p. 4371-4386, 2002.

PELICICE, F. M.; AGOSTINHO, A. A. Fish fauna destruction after the introduction of a non-native predator (Cichla kelberi) in a Neotropical reservoir. Biologial Invasions, v. 11, n. 8, p. 1789-1801, 2009.

PRIOLI, S. M. A. P.; PRIOLI, A. J.; JULIO JR, H. F.; PAVANELLI, C. S.; OLIVEIRA A. V.; CARRER, H.; CARRARO, D. M.; PRIOLI, L. M. Identification of Astyanax altiparanae (Teleostei, Characidae) in the Iguacu River, Brazil, based on mitochondrial DNA and RAPD markers. Genetics and Molecular Biology, v. 25, n. 4, p. 421-430, 2002.

PUEBLA, O. Ecological speciation in marine v. freshwater fishes. Journal of Fish Biology, v. 75, n. 5, p. 960-996, 2009.

RATNASINGHAM, S.; HEBERT, P. D. N. The barcode of life data system. Molecular Ecological Notes, v. 7, n. 3, p. 355-364, 2007.

SCHELLY R.; SALZBURGER W.; KOBLMULLER S.; DUFTNER N.; STURMBAUER C. Phylogenetic relationships of the lamprologine cichlid genus Lepidiolamprologus (Teleostei: Perciformes) based on mitochondrial and nuclear sequences, suggesting introgressive hybridization. Molecular Phylogenetics and Evolution, v. 38, n. 2, p. 426-438, 2006.

SMITH, L. L.; FESSLER, J. L.; ALFARO, M. E.; STREELMAN, J. T.; WESTNEAT, M. W. Phylogenetic relationships and the evolution of regulatory gene sequences in the parrotfishes. Molecular Phylogenetics and Evolution, v. 49, n. 1, p. 136-152, 2008.

STEINKE, D.; ZEMLAK, T. S.; BOUTILLIER, J. A.; HEBERT, P.D.N. DNA barcoding of Pacific Canada's fishes. Marine Biology, v. 156, n. 12, p. 2641-2647, 2009.

STREELMAN, J. T.; GMYREK, S. L.; KIDD, M. R.; KIDD, C.; ROBINSON, R. L.; HERT, E.; AMBALI, A. J.; KOCHER, T. D. Hybridization and contemporary evolution in an introduced cichlid fish from Lake Malawi National Park. Molecular Ecology, v. 13, n. 8, p. 2471-2479, 2004.

STREELMAN, J. T.; ZARDOYA, R.; MEYER, A.; KARL, S. A. Multilocus phylogeny of cichlid fishes (Pisces: Perciformes): evolutionary comparison of microsatellite and single-copy nuclear loci. Molecular Biology and Evolution, v. 15, n. 7, p. 798-808, 1998.

TAMURA, K.; STECHER, G.; PETERSON, D.; FILIPSKI, A.; KUMAR, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, v. 30, n. 12, p. 2725-2729, 2013.

TOEWS, D. P. L.; BRELSFORD, A. The biogeography of mitochondrial and nuclear discordance in animals. Molecular Ecology, v. 21, n. 16, p. 3907-3930, 2012.

WILLIS, S. C.; MACRANDER, J.; FARIAS, I. P.; ORTI, G. Simultaneous delimitation of species and quantification of interspecific hybridization in Amazonian peacock cichlids (genus Cichla) using multi-locus data. BMC Evolutionary Biology, v. 12, n. 96, p. 1-24, 2012.

WILLIS, S. C.; NUNES, M.; MONTANA, C. G.; FARIAS, P.; ORTI, G.; LOVEJOY, N. R. The Casiquiare river acts as a corridor between the Amazonas and Orinoco river basins: biogeographic analysis of the genus Cichla. Molecular Ecology, v. 19, n. 5, p. 1014-1030, 2010.

WILLIS, S. C.; NUNES, M. S.; MONTANA, C. G.; FARIAS, I. P.; LOVEJOY, N. R. Systematics, biogeography, and evolution of the Neotropical peacock basses Cichla (Perciformes: Cichlidae). Molecular Phylogenetics and Evolution, v. 44, n. 1, p. 291-307, 2007.

WINEMILLER, K. O. Ecology of peacock cichlids (Cichla spp.) in Venezuela. Journal of Aquaculture and Aquatic Sciences, v. 9, p. 93-112, 2001.

WU, L.; YANG, J. Identifications of captive and wild tilapia species existing in Hawaii by mitochondrial DNA control region sequence. PLoS One, v. 7, n. 12, p. e51731, 2012.

Received on December 8, 2014.

Accepted on August 25, 2015.

Doi: 10.4025/actascibiolsci.v37i4.25985

Luciano Seraphim Gasques (1) *, Thomaz Mansini Carrenho Fabrin (2), Daniela Dib Goncalves (3), Sonia Maria Alves Pinto Prioli (4) and Alberto Jose Prioli (4)

(1) universidade Paranaense, Praca Mascarenhas de Moraes, 4282, 87502-210, Umuarama, Parana, Brazil. (2) Programa de Pos-graduacao em Ecologia de Ambientes Aquaticos Continentais, Universidade Estadual de Maringa, Maringa, Parana, Brazil. (3) Programa de Pos-graduacao em Ciencia Animal, Universidade Paranaense, Umuarama, Parana, Brazil. (4) Programa de Pos-graduacao em Biologia Comparada, Universidade Estadual de Maringa, Maringa, Parana, Brazil. *Author for correspondence. E-mail: lsgasques@yahoo.com.br

Table 1. PCR reaction conditions for of mitochondrial
and nuclear Cichla DNA.

                                     PCR cicles conditions

             Initial denaturation    Denaturation

Amplified    Temp.           t       Temp.           t
region

tmo4c4       95[degrees]C    300 s   94[degrees]C    15 s
bmp4         95[degrees]C    60 s    95[degrees]C    30 s
dlx2         95[degrees]C    60 s    95[degrees]C    30 s
coxl         94[degrees]C    120 s   94[degrees]C    30 s
cytb         94[degrees]C    120 s   94[degrees]C    30 s

             PCR cicles conditions

             Annealing              Extension

Amplified    Temp.           t      Temp.           t
region

tmo4c4       48[degrees]C    5 s    72[degrees]C    30 s
bmp4         55[degrees]C    60 s   72[degrees]C    90 s
dlx2         55[degrees]C    60 s   72[degrees]C    90 s
coxl         52[degrees]C    40 s   72[degrees]C    60 s
cytb         52[degrees]C    40 s   72[degrees]C    60 s

                       Final ext.

Amplified    Cycles    Temp.            t
region

tmo4c4       40        72[degrees]C     300 s
bmp4         35        72[degrees]C     300 s
dlx2         35        72[degrees]C     300 s
coxl         35        72[degrees]C     300 s
cytb         35        72[degrees]C     300 s

Temp. is given in Celsius degrees and t indicates
the time in seconds.

Table 2. Primers used in the amplifications for the different
regions of mitochondrial and nuclear Cichla DNA.

Region            Primer                 Sequence (5'-3')

tmo4c4    tmo4c4 fl-5 tmo4c4 rl-3    CCTCCGGCCTTCCTAAAACCTCTC
                                     CATCGTGCTCCTGGGTGACAAAGT

bmP4         bmp4 2fb bmp4 2r          AACCTCACCAGCATTCCAGA
                                        ATCGCTGAAGTCCACGTAC

dlx2         dlx2 f760 dlx2 r2         GAAGAGAGYGAGCCAGAAATC
                                      AGTTTGCCAAAAACGACGACGAA

cytb          H15149 LI 4841         CCCCTCAGAATGATATTTGTCCTCA
                                    CCATCCAACATCTCAGCATGATGAAA

coxl          H7152 L6448-F2        CACCTCAGGGTGTCCGAARAAYCARAA
                                    TCGACTAATCATAAAGATATCGGCAC

Table 3. GenBank accession number of specimens
sequenced in current study.

             GenBank accession number of the sequences

Spp.      coxI       cytb       dlx2       bmP4      tmo4c4

Cml     KT382886   KT382901   KT382948   KT382915   KT382934
Cm2     KT382887   KT382902   KT382949   KT382916   KT382935
Cm3                KT382903   KT382950   KT382917   KT382936
Cm4     KT382888   KT382904   KT382951   KT382918
Cm5                KT382905   KT382952   KT382919   KT382937
Cm6     KT382889   KT382906   KT382953   KT382920
Cm7     KT382890              KT382954   KT382921
Ck8     KT382891   KT382907   KT382955   KT382922   KT382938
Ck9     KT382892   KT382908              KT382923   KT382939
CklO               KT382909   KT382956   KT382924   KT382940
Ckll    KT382893   KT382910   KT382957   KT382925   KT382941
Ckl2    KT382894                         KT382926   KT382942
Ckl3               KT382911   KT382958   KT382927   KT382943
CP14    KT382895   KT382912   KT382959   KT382928   KT382944
CP15    KT382896   KT382913   KT382960   KT382929
CP16    KT382897   KT382914   KT382961   KT382930   KT382945
CP17    KT382898              KT382962   KT382931   KT382946
CP18    KT382899              KT382963   KT382932   KT382947
Cpl9    KT382900              KT382964   KT382933

Table 4. Interspecific polymorphic sites of the cytb,
cox1 and dlx2 sequences.

                  cytb

                  1   1   2   5   6   8   9   1   1   1
Species           0   6   4   2   1   2   4   0   0   3
                                              3   6   3

CMa monoculus     T   A   G   A   A   A   G   T   G   G
Cichla kelheri    T   .   .   G   .   .   .   .   .   .
Cichla piquiti    A   G   A   .   G   G   A   C   T   A

                  cytb

                  1   1   1   1   2   2   2   2   2
Species           6   6   8   9   3   4   5   5   5
                  0   9   1   0   8   1   0   3   9

CMa monoculus     T   A   A   A   T   G   A   G   G
Cichla kelheri    .   G   .   .   .   A   .   .   T
Cichla piquiti    C   G   G   G   C   .   T   T   .

                  cytb        cox1        dlx2

                  2   2   3   1   4   3   2  22
Species           6   8   1   5   8   8   0  11
                  8   6   5   6   9       2  27

CMa monoculus     A   A   G   A   C   A   A G R
Cichla kelheri    .   .   A   G   G   T   G   C
Cichla piquiti    T   G   .   G   G   G   .   R
COPYRIGHT 2015 Universidade Estadual de Maringa
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:texto en ingles
Author:Gasques, Luciano Seraphim; Fabrin, Thomaz Mansini Carrenho; Goncalves, Daniela Dib; Prioli, Sonia Ma
Publication:Acta Scientiarum. Biological Sciences (UEM)
Date:Oct 1, 2015
Words:4310
Previous Article:Assessment of lipolytic activity of isolated microorganisms from the savannah of the Tocantins/Avaliacao da atividade lipolitica de microrganismos...
Next Article:Maternal and fetal effects after inhalation of the herbicide flumetralin/Efeitos maternos e fetais apos inalacao do herbicida flumetralin.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters