Printer Friendly

Promoter Analysis of Cold-responsive (COR) Gene from Capsella bursa-pastoris and Expression Character in Response to Low Temperature.

Byline: Ping Lin, Lihua Wu, Donghui Wei, Hu Chen, Mingqi Zhou, Xiaohua Yao and Juan Lin

Abstract

Capsella bursa-pastoris is well adapted to different environments, especially low temperature suggesting that it possesses relatively strong tolerance against cold stress. Cold tolerance ability is associated with the accumulation of several cold-induced transcripts. By using a cloning technology, we isolated and sequenced the corresponding COR15 gene from C. bursa-pastoris. The putative promoter of CbCOR15 contains cis-acting elements that have been shown to mediate expression of cold-responsive genes of Arabidopsis thaliana. In this study, we analyzed the CbCOR15a and CbCOR15b promoter sequence shown that there are two or one cis-acting elements in between -305 and -149, or -207 and -128, respectively. Deletion sequence of CbCOR15 promoter region were fused to the GUS reporter gene and introduced into A. thaliana plants.

The analysis of independent transgenic lines using histochemical GUS staining method indicated that the CbCOR15a promoter sequences from -305 to -149, CbCOR15b promoter sequences from -207 to -128 is as necessary for gene expression of low temperature regulated. CbCOR15 promoter displayed a slight activity in seedlings, mature rosette leaves, stem leaves, flowers and mature siliques, and after cold treatment, the promoter activity increased greatly in all tissues. CbCOR15a being more sensitive to cold than CbCOR15b. After cold treatment, the AtCOR15 promoter activity was greatly induced in leaves, flowers and siliques, but not roots. In comparison with character of AtCOR15 promoter indicated that CbCOR15 being more sensitive to cold. The character may be related to strong cold acclimation ability of C. bursa-pastoris.

Keywords: Capsella bursa-pastoris; Cold Regulated (COR) gene; Promoter; Histochemical staining experiments

Introduction

Chilling stress has negative impact on plant growth and development. Based on plant tolerance, cold can be divided into freezing (less than 0C) and chilling (0-15C) temperatures (Zhou et al., 2011). During the evolution history, plants have developed some adaptability to resist cold stress. These abilities known as cold acclimation which increase the response of tolerance to low non-freezing temperatures (Thomashow, 1999) and modify variety of carbohydrate composition including in lipid, protein during cold acclimation (Steponkus and Lynch, 1989; Guy, 1990; Thomashow, 1990). Among these adaptive changes, Cold Regulated (COR) and Dehydrin (DHN) proteins have a key structural role to stabilize membrane structure (Thomashow 1999; Koag et al., 2009) or these proteins may have important roles in the acclimation process (Thomashow, 1990).

In Arabidopsis thaliana, five pairs COR genes have been found, including COR6.6 (Kurkela and Borg-Franck, 1992), COR15 (Lin and Thomashow, 1992; Wilhelm and Thomashow, 1993), COR47 (Gilmour et al., 1992), COR78 (Horvath et al., 1993) and COR413 (Hajela et al., 1990). Each gene pair has a high identity of nucleic acid sequence and is physically tandem linked array. In addition, the individual members of each gene pair showed some differences in gene regulation level. Among these proteins, COR15 was the first to be found and provides the first direct evidence for cold tolerance which is associated with constitutive and continued expression of cold-induced genes. The COR15a and COR15b from A. thaliana is a chloroplast- targeted protein, its molecular weight is 15 kDa (Wilhelm and Thomashow, 1993). The COR15a and COR15b homologs gene are present in tandem on the chromosome 2, but their expression level response to cold stresses is differ temporally or spatially (Wilhelm and Thomashow, 1993).

Similarly, COR15 two copies have been discovered in the Brassica napus species (Weretilnyk et al., 1993), Hordeum vulgare (Cattivelli and Bartels, 1990; Crosatti et al., 1996), Triticum aestivum (Shimamura et al., 2006), Chorispora bungeana (Si et al., 2009), Cucurbita moschat and Citrullus lanatus (Kang et al., 2009), B. oleracea (Hadi et al., 2011), Capsella bursa pastoris (Zhou et al., 2012; Wu et al., 2012). COR15a and COR15b protein are necessary for Arabidopsis to attain comprehensive freezing tolerance during cold acclimation; its function in A. thaliana seems to protect chloroplast membranes through binding and folding during freezing (Artus et al., 1996; Thalhammer et al., 2014). After exposing plants to low temperature, a number of COR genes transcript levels increase dramatically and remain elevated for as long as remain plants in the low temperature environments. In spite of this, studies have shown that expression changes indeed occur during cold acclimation in plants (Guy, 1990).

But character of gene expression is different in various plants specific, such as, the COR15a gene promoter is inactive (or only low active) in many plants grown organs or tissues, exception anther, at 22C temperatures using gene fusion experiments. When plant moved to cold temperature, these genes become activated in grown tissues and organs, exception in the roots (Baker et al., 1994). In addition, the regulated pattern of CORl5b and CORl5a is different (Wilhelm and Thomashow, 1993). BnCOR25 gene from B. napus was weakly expressed in leaves or roots and strong expressed in flowers, stems, hypocotyls and cotyledons using RT-PCR analysis. BnCOR25 gene transcripts were highly accumulated in roots during cold treatment (Chen et al., 2011).

In comparison with A. thaliana, C. bursa-pastoris possesses relatively strong tolerance ability to cold. However, cold tolerance ability associated with the accumulation of COR15 cold-induced transcript is not well understood. In C. bursa-pastoris, some COR genes, such as CbCOR15a, CbCOR15b have been characterized and are found to be low temperature induced gene (Wu et al., 2012; Zhou et al., 2012). In order to clarify the possible mechanisms involved in cold expression regulation of COR gene, which demonstrated the low temperature induced of COR15a/b gene requires the CRT/DRE/LTRE element. We investigated the induced and tissue specific expression of COR15a/b from C. bursa-pastoris using the promoter-reporter gene (GUS) fusions in transgenic A. thaliana. The results show that the CRT/DRE/LTRE element is a key element of CbCOR15a and CbCOR15b to cold response. The results confirm that the cis-acing regulatory element is essential to adjust the expression of cold-regulated gene.

Further, to investigate the different transcript regulation of COR15a/b from A. thaliana or C. bursa-pastoris, we carried out some transgenic lines using COR15a/b promoter from A. thaliana or C. bursa-pastoris using b-glucuronidase (GUS) fusions, respectively. Under the cold treatments, the increase in GUS activity was found in transgenic plant lines, which indicate that cold induction of COR15a and COR15b from C. bursa-pastoris occurs at the transcriptional level.

Materials and Methods

Plants Growth and Treatments with Low Temperature

The generations of C. bursa-pastoris seeds was purchased from Shanghai Baiyulan Vegetable Seed Ltd. and were grown in the greenhouse. The conditions of greenhouse contain 16-h-light/8-h-dark cycle long photoperiod, 140 to 150 umol*m-2*s-1 cool-white fluorescent illumination and 70% relative humidity at 22C. Before germination, the seeds of A. thaliana (ecotype Columbia) were treated for 3 days at 4C. The seeds were grown in growth chambers under at 100umol*m-2*s-1 constant light and 50% relative humidity. To imposelow temperature treatments, C. bursa-pastoris and A. thaliana seedlings were grown on MS solidified medium at 22C, 2-week-old seedlings were transferred to a cold room (4C; 8/16 h light/dark) and plants collected after 2 d. Unless otherwise specified, three seeding constituted experimental unit.

Construction of the Plant Expression Vectors and Transformation of Plant

The total genomic DNA from C. bursa-pastoris and A. thaliana was isolated using the improve CTAB program (Murray and Thompson, 1980). The Cbcor15a or Cbcor15b promoter sequences were reported in our previous study reports (Wu et al., 2012; Zhou et al., 2012). The AtCOR15a or AtCOR15b promoter sequences from A. thaliana were reported in NCBI databases under gene number At2g42540 (AtCOR15a) or At2g42520 (AtCOR15b). To clone the CbCOR15a, CbCOR15b, AtCOR15a, AtCOR15b promoter sequence, four pair specific primers listed in Table 1 were used to amplify the four promoter sequence from C. bursa-pastoris or A. thaliana by PCR. To facilitate cloning into the vector pCAMBIA1301, a restriction enzyme site of PstI was incorporated into a forward primer, whereas a BglII site was flanked with a reverse primer.

The PCR was performed using genomic deoxyribonucleic acid (DNA) isolated from young leaves of C. bursa-pastoris or A. thaliana as template under the following condition: The template was denatured 5 min at 94C followed by amplification 30 cycles, 1 min at 94C, 30 s at 60C, and 1 min at 72C for program followed by 10 min at 72C. After digestion with PstI and BglII, the CaMV35S promoter of pCAMBIA1301 (CAMBIA, Australia) be replaced by the amplified fragment. The plasmid was named pCbCOR15aP:: GUS, pCbCOR15bP:: GUS, pAtCOR15aP: GUS or pAtCOR15bP: GUS. Construction of vector model is shown in Fig. 1. To clone the -459 to +97 bp, -335 bp to +97 bp, -149 to +97 bp fragments of CbCOR15a or -207 to +97 bp, -128 to +97 bp fragments from CbCOR15b, five specific primers listed in Table 1 were used to amplify the five sequences by PCR. To facilitate cloning into the vector pCAMBIA1301, a restriction enzyme site of PstI was incorporated into a forward primer. Construction diagram is shown in Fig. 1.

Agrobacterium LBA4404 strain was transformed with these plant expression vectors by the freeze-thaw program and A. thaliana transformation by the floral dip program (Clough and Bent, 1998).

Molecular Analysis of Transgenic Plants

The transgenic T0 seeds were selected on hygromycin (20 mg L-1) and further were tested using PCR program to detect the specific fragment of the various constructs vector. After genomic DNA of leave was isolated, the gene-specific primers, hygromycin-specific primers or GUS-specific primers were used to amplify a specific fragment, hygromycin gene fragment GUS fragment, respectively, which demonstrated the presence of the CbCOR15a or CbCOR15b fragments, the hygromycin gene or GUS gene. These primers were listed in table 1.

RT-PCR Method

Total RNA was isolated from leave tissues of 200 mg, treated with the deoxyribonuclease I to remove any DNA contamination, was reversely transcribed using Plant RNA Mini Kit (Watson Biotechnologies, Inc, China), DNase I Kit (Promega, Madison, WI, USA), or PrimeScript(r) RT Master Mix Perfect Real Time Kit (TaKaRa, China), respectively. For PCR amplifications, first cDNA strand was used as template using specific GUS primers described in table 1. The A. thaliana tublin gene (Genbank number: M17189) was used as the control.

Histochemical Staining

GUS staining program was carried out as described by Jefferson et al. (1987). Briefly, various tissues were incubated in staining solution and vacuum infiltrated for 15 min. The staining buffer containing 7.2 mM ethylene diamine tetraacetic acid (EDTA), 3 mM potassium ferrocyanide, 42.3 mM sodium phosphate, 57.7 mM disodium phosphate, 0.005% Triton X-100 and 0.075% 5-bromo-4-chloro-3-indolyl-b-D-glucuronic acid (X-Gluc).

Afterward the tube was put in incutabor overnight at 37C and de-stained using 75% ethanol for five times at 60C until their chlorophyll were clear. The GUS activity was observed using microscope (Zeiss Scope A1, Zeiss, Germany).

Statistical Analysis

The effects of the tissue type and treatments were analyzed with the analysis of variance (ANOVA). P values less than 0.05 were considered significant.

Result

Sequence Analysis of CbCOR15a and CbCOR15b Promoters

The gene expression was driven by its promoter. There weresome regulatory elements in their promoter's sequences that control these gene expressions. Several genes to the freezing- or cold-induced responsive contain one or more cis-element in their promoter region (Wang and Hua, 2009). These elements contain C-repeat element (CRT), DRE (dehydration responsive element) or LTRE (low temperature responsive element) (Baker et al., 1994). The CCGAC sequence, conserved core sequence is the binding region to the cold specific CBFs/DREBs transcriptional activators (Stockinger et al., 1997) that enhance the expression level of cold responsive COR genes which subsequently increase plants cold resistance (Mantas et al., 2010). To examined whether CbCOR15a and CbCOR15b gene is induced by low temperature through the CRT/DRE/LTRE element in the promoter, we analysis the cis-element by the PLANTCARE database (http: // bioinformatics.psb.ugent.be/webtools/plantcare/html/).

These results showed that CbCOR15a and CbCOR15b promoter sequences contain two or one CRT/DRE/LTRE elements, respectively. We analyzed a series of transgenic positive plants to test whether, this CRT/DRE/LTRE element is also involved in low temperature induction of CbCOR15a and CbCOR15b. Lines CbCOR15aP, CbCOR15aP3, CbCOR15aP2 and CbCOR15aP1 contain -939/+97, -459/+97, -335/+97 and -149/+97 of the CbCOR15a promoter sequences from transcription initiation site, respectively. Lines CbCOR15bP, CbCOR15bP2 and CbCOR15bP1 contain -1037/+97, -207/+97 and -128/+97 of the CbCOR15b promoter sequences from transcription initiation site, respectively (Fig. 2). These plants were grown on plates for about 14 days at 22C, and then seedlings were shifted to 4C. To GUS activity sufficiently detection, we stain the tissue in a longer induction time (2 days). There was no GUS activity in any of these lines grown at 22C.

However, CbCOR15aP, CbCOR15aP2, CbCOR15aP3 and CbCOR15bP and CbCOR15bP2, but not CbCOR15aP1 and CbCOR15bP1, showed GUS activities at 4C (Fig. 3). The sequence of CbCOR15aP and CbCOR15aP3 contain two CRT/DRE/LTRE elements, the sequence of CbCOR15bP and CbCOR15bP2 contain one CRT/DRE/LTRE element, respectively. CbCOR15aP1 and CbCOR15bP1 do not contain any CRT/DRE/LTRE element. CbCOR15aP2, CbCOR15aP3 contain one CRT/DRE/LTRE element, both are not active at room temperature, but active at at low temperature. CbCOR15aP contain two CRT/DRE/LTRE elements, which are less active at room temperature, but activation was induced by low temperature. The active CbCOR15aP was high than CbCOR15aP2 and CbCOR15aP3 in low temperature. These results show that the CRT/DRE/LTRE element is a key element of CbCOR15a and CbCOR15b cold response.

Table 1: Primers used in this work

Primers###Sequence(5'---3')

CbaP-Pst###TActgcagGTGAACATGGGGAGAGTGTA

CbaP-Bgl###CGagatctACCATCGCCATGAGTTATCTCTTTTAAGTTTTTTTGGGTGCA

CbbP-Pst###CGctgcagGATCAGTCTGTTGTAATGA

CbbP-Bgl###CGagatctACCATCGCCATGAGAGATATG

Atap-Sac###CGCTGCAACTTTTCAGAGCTCGC

Atap-Nco###CCCATGGGAGAGAGATCTTTAAGATGTGA

Atbp-Sac###GTTTAAGTGCTTGAAATTGAGCTCGC

Atbp-Nco###CCCATGGGAGGACTCTTAAAGATGTT

CbaP1-Sac###GCgagctcCACGTGGCCAAAA

CbaP2-Sac###GCgagctcCACGTGAAGAGAATGAG

baP3-Sac###GCgagctcATTTACGGACCAATGTT

CbbP1-Sac###GCgagctcAACGAACAAAAACTCTT

CbbP2-Sac###GCgagctcTGGCCGACCTCTTTT

GUS-F###GCTCTACACCACGCCGAACACCTG

GUS-R###TCTTCAGCGTAAGGGTAATGCGAGGTA

tublin-F###ATGCGTGAGATTCTTCACATCC

tublin-R###TGGGTACTCTTCACGGATCTTAG

Comparing Analysis of COR15 Promoters from C. bursa-pastoris and A. thaliana

Previous experiments about histochemical staining indicated that the COR15a promoter at normal temperature can be stained deeply blue only in anther of plants, in contrast, in the leaves, at cold-treated can be stained deeply blue in stem, leave and apical meristem. However, the roots and mature ovules of these seedlings were detected no blue (Baker et al., 1994). The nucleic acid sequence of COR15b has a high degree identity to COR15b, but different in regulation (Wilhelm and Thomashow, 1993). In the study, four expression vectors, including CbCOR15aP:: GUS, CbCOR15bP:: GUS, AtCOR15aP:: GUS and AtCOR15bP:: GUS, were constructed and transferred into A. thaliana in order to analyze the promoter tissue-specific expression activity in normal temperature or cold treatment. Seeds of T2 lines (transgenic CbCOR15aP, CbCOR15bP, AtCOR15aP and AtCOR15bP positive Arabidopsis plants) were plants in MS0 solid medium.

For the histochemical GUS staining assay, the 6-week-old seedlings were collected at 22C and 4C treatment for 2 d, respectively. The results showed that CbCOR15a promoter displayed a slight activity at 22C in seedlings, mature rosette leaves, stem leaves, flowers and mature siliques, and after 4C cold treatment, the activity increased greatly in all tissues. CbCOR15b promoter was detected inactive at 22C, but after 4C cold treatment, the activity was greatly induced in leaves, flowers, siliques and roots. The active of AtCOR15b promoters are same to AtCOR15a, after 4C cold treatment, the promoter activity was no induced in roots (Fig. 4). This result is consistent with RT-PCR analysis (Zhou et al., 2012). At the same time the transcript levels of the GUS genes were determined in transgenic plants using low temperature treatment and control by RT-PCR method, the result is shown in Fig. 4.

The results showed the GUS fusions containing AtCOR15aP, AtCOR15bP, CbCOR15aP and CbCOR15bP were strongly responsive to cold. To cold-treated plants, GUS transcripts accumulation was high than the control plants. In contrast, the lever of GUS expression is higher containing CbCOR15aP or CbCOR15bP than containing AtCOR15aP or AtCOR15bP (Fig. 5). The result shown that the COR15 genes differ in their cold sensitivity: COR15 from C. bursa-pastoris being more sensitive to cold than COR15 from A. thaliana; COR15b from C. bursa-pastoris is being more sensitive to cold than COR15a.

Discussion

The COR gene has been described from many plants, little is known about the gene expression patter from various species and its multiple members. The promoters of many COR genes such as COR15a/b (Wilhelm and Thomashow, 1993; Baker et al., 1994), RAB18 (Lang and Palva, 1992), COR78 (Yamaguchi-Shinozaki and Shinozaki, 1993), KIN1/2 (Kurkela and Franck, 1990; Kurkela and Borg-Franck, 1992) from A. thaliana contain highly conserved cis-elements such as CRT, DRE or LTRE element (Stockinger et al., 1997), and consequently, expressions of COR genes are mediated by cold.

Under cold stress, the upstream regulators named inducers of CBF expression (ICE) act as a positive regulator of CBFs, while CBFs regulate the cold responsive (COR) genes by binding to the CRT/DRE element (Lissarre et al., 2010). Our promoter-fusion experiments found that CbCOR15a contain two cis-acting CRT/DRE elements between nucleotides -939 and +97 and CbCOR15b contain one cis-acting CRT/DRE element between nucleotides -1037 and +97 that can drive strong cold regulated gene expression. This evidence confirms that CbCOR15 genes contain a cold-regulatory element in their promoter. Previous study shown expression in almost all plants tissues about AtCOR78-gus (Horvath et al., 1993) and AtRD29a-gus gene (Yamaguchi-Shinozaki and Shinozaki, 1993) was either very low or undetectable in non-acclimated condition. However, relatively high expression in the AtCOR15a-gus can be detected in the anther of control plants.

Our result showed relatively high expression levels of the CbCOR15a-gus that can be detected in the anthers at 22C. The molecular basis for lack of expression of the COR promoter in some tissues at normal growth temperature is unclean. In addition, these results indicated that the expression level of various COR gene is up-regulated by cold in most plant tissues, but not whole. Such as, after 4C cold treatment, the activity of AtCOR15a promoter was greatly induced in leaves, flowers and siliques, but not roots (Baker et al., 1994). But, the activity of AtCOR78 promoter was greatly induced in the flower sepals, leaves, stems, roots of plants by cold-treated. However, no activity was observed in some plants tissue, such as stigmas, anthers, styles of flowers or ovaries (Horvath et al., 1993). Our study showed that activity of CbCOR15 promoter can be induced greatly in all tissues, which includes seedlings, rosette leaves, cauline leaves, inflorescence and siliques.

The results indicated that different cis-acting elements are responsible for the different expression patterns under conditions of normal or low temperature.

The main function of COR15a protein in plant is stabilizing thylakoid membranes against freezing-induced damage, and as a result, constitutive overexpression of the COR15 gene resulted in a significant increase in cell freezing-tolerance of plant (Artus et al., 1996). It was indicated that the accumulation of COR proteins is related with plant frost resistance. Under field conditions, plant accumulated more COR proteins in winter than spring (Grossi et al., 1998). So COR15 are necessary for plant to attain full freezing tolerance during cold acclimation. Our study showed that activity of CbCOR15 can be induced greatly in all tissues by cold, the CbCOR15 gene plays a positive role in conferring freezing/cold tolerance, suggesting that it may function in C. bursa-pastoris response and tolerance to cold stress. Our findings for increasing the freezing tolerance of crop species have potential application using transgenic technology.

It is favorable to drive those genes expression by use plant endogenous stress-inducible promoter instead of the 35S promoter to prevent the 35S promoter leading to side effect, such as dwarfism or delay flowering. The cold inductive activities of CbCOR15a/b promoter provide a potential element in improvement of cold resistance crops using transgenic technology.

Conclusion

The ability of plants to tolerate cold stress is associated with the expression of COR gene. The cis-acting element is necessary for cold-regulated gene expression. This study showed that the 5' region of CbCOR15a and CbCOR15b contains two and one cis-acting element, respectively. The CbCOR15 promoter displayed a slight activity in seedlings, mature rosette leaves, stem leaves, flowers and mature siliques, and after cold treatment, the promoter activity increased greatly in all tissues. But after cold treatment, the AtCOR15 promoter activity was greatly induced in leaves, flowers and siliques, but not in roots. The C. bursa-pastoris COR15 is more sensitive to cold than A. thaliana COR15 and C. bursa-pastoris COR15b is more sensitive to cold than C. bursa-pastoris COR15a. The character may be related to strong cold acclimation is ability of C. bursa-pastoris.

Acknowledgements

We thank the financial support from the Natural Science Foundation of China (31170287), the National Key Technology RandD Program (2009BADA8B04), the National High Technology Research and Development Program of China (2008AA10Z105).

References

Artus, N.N., M, Uemura, P.L. Steponkus, S.J. Gilmour, C. Lin and M.F. Thomashow, 1996. Constitutive expression of the cold regulated Arabidopsis thaliana COR15a gene affects both chloroplast and protoplast freezing tolerance. Proc. Natl. Acad. Sci. USA, 93: 13404-13409

Baker, S.S., K.S. Wilhelm and M.F. Thomashow, 1994. The 5'-region of Arabidopsis thaliana COR15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression. Plant Mol. Biol., 24: 701-713

Cattivelli, L. and D. Bartels, 1990. Molecular cloning and characterization of cold-regulated genes in barley. Plant Physiol., 93: 1504-1510

Chen, L., H. Zhong, F. Ren, Q.Q. Guo, X.P. Hu and X.B. Li, 2011. A novel cold-regulated gene, COR25, of Brassica napus is involved in plant response and tolerance to cold stress. Plant Cell Rep., 30: 463-471

Clough, S.J. and A.F. Bent, 1998. Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J., 16: 735-743

Crosatti, C., E. Nevo, A.M. Stanca and L. Cattivelli, 1996. Genetic analysis of the accumulation of COR14 proteins in wild (Hordeum spontaneum) and cultivated (Hordeum vulgare) barley. Theor. Appl. Genet., 93: 975-981

Gilmour, S.J., N.N. Artus and M.F. Thomashow, 1992. cDNA sequence analysis and expression of two cold-regulated genes of Arabidopsis thaliana. Plant Mol. Biol., 18: 13-21

Grossi, M., E. Giorni, F. Rizza, A.M. Stanca and L. Cattivelli, 1998. Wild and cultivated barleys show differences in the expression pattern of a cold-regulated gene family under different light and temperature conditions. Plant Mol. Biol., 38: 1061-1069

Guy, C.L., 1990. Cold acclimation and freezing stress tolerance: role of protein metabolism. Annu. Rev. Plant Physiol. Plant Mol. Biol., 41: 187-223

Hadi, F., M. Gilpin and M.P. Fuller, 2011. Identification and expression analysis of CBF/DREB1 and COR15 genes in mutants of Brassica oleracea var. botrytis with enhanced proline production and frost resistance. Plant Physiol. Biochem., 49: 1323-1332

Hajela, R.K., D.P. Horvath, S.J. Gilmour and M.F. Thomashow, 1990. Molecular cloning and expression of cor (cold regulated) genes in Arabidopsis thaliana. Plant Physiol., 93: 1246-1252

Horvath, D.P., B.K. McLarney and M.F. Thomashow, 1993. Regulation of Arabidopsis thaliana L. (Heyn) cor78 in response to low temperature. Plant Physiol., 103: 1047-1053

Jefferson, R.A., T.A. Kavanagh and M.W. Bevan, 1987. GUS fusions: beta- glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J., 6: 3901-3907

Kang, G.Z., Z.H. Zhu, T.C. Guo and J.P. Ren, 2009. Isolation and expression pattern of COR15b and KIN1 genes in watermelon and pumpkin. Afr. J. Biotechnol., 8: 5666-5672

Koag, M.C., S. Wilkens, R.D. Fenton, J. Resnik, E. Vo and T.J. Close, 2009. The K-segment of maize DHN1 mediates binding to anionic phospholipid vesicles and concomitant structural changes. Plant Physiol., 150: 1503-1514

Kurkela, S. and M. Borg-Franck, 1992. Structure and expression of kin2, one of two cold- and ABA-induced genes of Arabidopsis thaliana. Plant Mol. Biol., 19: 689-692

Kurkela, S. and M. Franck, 1990. Cloning and characterization of a cold- and ABA-inducible Arabidopsis gene. Plant Mol. Biol., 15: 137-144

Lang, V. and E.T. Palva, 1992. The expression of a rab-related gene, rab 18, is induced by abscisic acid during the cold acclimation process of Arabidopsis thaliana (L.) Heyn. Plant Mol. Biol., 20: 951-962

Lin, C. and M.F. Thomashow, 1992. DNA sequence analysis of a complementary DNA for cold-regulated Arabidopsis gene cor15 and characterization of the COR15 polypeptide. Plant Physiol., 99: 519-525

Lissarre, M., M. Ohta, A. Sato, and K. Miura, 2010. Cold-responsive gene regulation during cold acclimation in plants. Plant Signal Behav., 5: 948-952

Mantas, S., H. Pekka and P.E. Tapio, 2010. Genes and gene regulation for low temperature tolerance. In: Genes for Plant Abiotic Stress, pp: 187-209. Mathew, A.J. and J.W. Andrew (eds.). Willey-Blackwell Publishing, UK

Murray, M.G. and W.F. Thompson, 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res., 8: 4321-4325

Shimamura, C., R. Ohno, C. Nakamura and S. Takumi, 2006. Improvement of freezing tolerance in tobacco plants expressing a cold responsive and chloroplast- targeting protein WCOR15 of wheat. J. Plant Physiol., 163: 213-219

Si, J., J.H. Wang, L.J. Zhang, H. Zhang, Y.J. Liu and L.Z. An, 2009. CbCOR15, a cold-regulated gene from alpine Chorispora bungeana, confers cold tolerance in transgenic tobacco. J. Plant Biol., 52: 593-601

Steponkus, P.L. and D.V. Lynch, 1989. The behavior of large unilamellar vesicles of rye plasma membrane lipids during freeze/thaw-induced osmotic excursions. Cryo. Lett., 10: 43-50

Stockinger, E.J., S.J. Gilmour and M.F. Thomashow, 1997. Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. USA, 94: 1035-1040

Thalhammer, A., G. Bryant, R. Sulpice and D.K. Hincha, 2014. Disordered cold regulated 15 proteins protect chloroplast membranes during freezing through binding and folding, but do not stabilize chloroplast enzymes in vivo. Plant Physiol., 166: 190-201

Thomashow, M.F., 1990. Molecular genetics of cold acclimation in higher plants. Adv. Genet., 28: 99-131

Thomashow, M.F., 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol., 50: 571-599

Wang, Y. and J. Hua, 2009. A moderate decrease in temperature induces COR15a expression through the CBF signaling cascade and enhances freezing tolerance. Plant J., 60: 340-349

Weretilnyk, E., W. Orr, T.C. White, B. Iu and J. Singh, 1993. Characterization of three related low-temperature-regulated cDNAs from Brassica napus. Plant Physiol., 101: 171-177

Wilhelm, K. and M.F. Thomashow, 1993. Arabidopsis thaliana corl5b, an apparent homologue of corl5a, is strongly responsive to cold and ABA, but not drought. Plant Mol. Biol., 23: 1073-1077

Wu, L.H., M.Q. Zhou, C. Shen, J. Liang and J. Lin, 2012. Transgenic tobacco plants expressing CbCOR15b from Capsella bursa-pastoris show enhanced accumulation and tolerance to cold. J. Plant Physiol., 169: 1408-1416

Yamaguchi-Shinozaki, K. and K. Shinozaki, 1993. Characterization of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol. Gen. Genet., 236: 331-340

Zhou, M.Q., C. Shen, L.H. Wu, K.X. Tang and J. Lin, 2011. CBF-dependent signaling pathway: A key responder to low temperature stress in plants. Crit. Rev. Biotechnol., 31: 186-192

Zhou, M.Q., L.H. Wu, J. Liang, C. Shen and J. Lin, 2012. Expression analysis and functional characterization of a novel cold-responsive gene CbCOR15a from Capsella bursa-pastoris. Mol. Biol. Rep., 39: 5169-5179
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lin, Ping; Wu, Lihua; Wei, Donghui; Chen, Hu; Zhou, Mingqi; Yao, Xiaohua; Lin, Juan
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Apr 30, 2016
Words:4756
Previous Article:Aloe vera Polysaccharides as Biological Response Modifiers in Chickens.
Next Article:A Novel Hydroxymethyldihydropterin Pyrophosphokinase-dihydropteroate Synthase (HPPK-DHPS) Gene from a Nutraceutical Plant Seabuckthorn, Involved in...
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters