Printer Friendly

Prohexadione-calcium Modified Color Characteristics and Flavonoid Biosynthetic Genes Expression in Herbaceous Peony (Paeonia lactiflora) Flowers.

Byline: Yuhan Tang, Daqiu Zhao, Zhaojun Hao and Jun Tao

Abstract

Prohexadione-calcium (Pro-Ca), originally developed as a plant growth retardant, has recently been discovered it could modify floral color in several ornamental plants like petunia and rose. However, the underlying mechanism of Pro-Ca on the regulation of floral color is still elusive. In this study, a purple-red herbaceous peony (Paeonia lactiflora Pall.) cultivar with control and Pro-Ca treatment was used as the material. Their color indices were measured, flavonoid compositions and contents as well as its biosynthetic genes expression were analyzed. After Pro-Ca treatment, a remarkable rise in the color parameter lightness (L*) value along with an obvious fall in the color parameter red/green (a*) value indicated that the loss of red color was occurred.

In addition, total anthocyanin, anthoxanthin and flavonoid contents were all decreased significantly after Pro-Ca treatment, which was in accordance with the color indices. Furthermore, the expression patterns of most relative genes in flavonoid biosynthetic pathway expressed an overall decline after Pro-Ca treatment. Among the 2-oxoglutaric acid-dependent dioxygenase genes involved in the pathway, flavanone 3-hydroxylase gene (F3H) and anthocyanidin synthase gene (ANS) had the highest levels of expression, suggesting that the loss of red color might be the reason of the synergistic inhibitory effect of these enzymes especially F3H and ANS in response to Pro-Ca. These results would contribute to a theoretical foundation for the regulation of floral color in field P. lactiflora by Pro-Ca treatment.

Keywords: Herbaceous peony; Prohexadione-calcium; Flavonoids; Gene expression

Introduction

Prohexadione-calcium (Pro-Ca), originally developed as a plant growth retardant, has recently been used as a 2-oxoglutaric acid-dependent dioxygenase (2-ODD) inhibitor. It could lead to the inhibition of the activity of 2-ODDs for the reason that this competitive Pro-Ca to the 2-ODDs on the combination of substrates. Several 2-ODDs are involved in the late steps of gibberellins biosynthesis (Rademacher, 2000) and in the flavonoid biosynthesis (Halbwirth et al., 2006). Thus Pro-Ca could bring about inhibition in these biosyntheses and contribute to multiple positive biochemical effects. Besides, Pro-Ca is an environmental-friendly and eco-toxicological bioregulator with no health risk for users and consumers (Rademacher and Kober, 2003) and would be easily absorbed and utilized by plants though spraying. Until now, the studies on Pro-Ca have been mainly about fruits and vegetables.

For example, Pro-Ca had been used to take control of vegetative growth in apples (Duyvelshoff and Cline, 2013; Cetinbas et al., 2015) and eggplants (Ozbay and Ergun, 2015), induce resistance to fire blight in apples (McGrath et al., 2009) and mitigate postharvest chilling injury in tomato fruits (Aghdam, 2013). In ornamental plants, Pro-Ca could promote resistance to root parasitic weed in sunflowers (Fan et al., 2007) and affect the growth and gibberellins contents in Chrysanthemum morofolium (Kim et al., 2010). Otherwise, Pro-Ca would modify the floral color in petunia, impatiens and rose (Ilias and Rajapakse, 2005; Schmitzer et al., 2012). For example, after Pro-Ca treatment, the two rose cultivars with orange-red and dark-red colors turned into light pink and white. Also, the color loss was directly related to a decrease in anthocyanin content (Schmitzer et al., 2012).

Bizjak et al. (2012, 2013) found that the inhibition of Pro-Ca on enzyme activities of 2-ODDs flavanone 3-hydroxylase gene (F3H), flavonol synthase gene (FLS) and anthocyanidin synthase gene (ANS) in flavonoid biosynthesis pathway in the skin of apples might lead to a decrease in anthocyanin content. Up to now, few studies have focused on the effect of Pro-Ca treatment in ornamental plants, yet the detailed mechanism of how Pro-Ca would modify floral color is still not clear. Hence, a further study on the effect of Pro-Ca to explore its mechanism in flower coloration of ornamental plants is necessary.

Herbaceous peony (Paeonia lactiflora Pall.) is a perennial herb belonging to the family Paeoniaceae. It is a traditional famous flower in China, endowed with relatively high ornamental and landscape value mainly for its colorful blossom. The expression of floral color was primarily determined by the production of pigments, especially by flavonoids which included anthocyanins and anthoxanthins (Zhao and Tao, 2015). Also, flavonoid compositions and contents are different in varied flowers in P. lactiflora (Jia et al., 2008) and the accumulation of avonoids is determined by a series of genes in the avonoids biosynthesis pathway (Nakatsuka et al., 2005).

Previously, Zhao et al. (2012a) predicted and summarized the putative flavonoid biosynthesis pathway in P. lactiflora, including phenylalanine ammonialyase gene (PAL), chalcone synthase gene (CHS), chalcone isomerase gene (CHI), F3H, flavonoid 3'-hydroxylase gene (F3'H), dihydroflavonol 4-reductase gene (DFR), ANS, UDP-glucoside (UGT): flavonoid 3-O-glucosyltransferase gene (F3GT) as well as flavonoid 5-O-glucosyltransferase gene (F5GT) and methyl transferase gene (MT). In addition, FLS was also influenced the accumulation of flavonoids (Zhao et al., 2016). At present, few studies have been focused on the regulation of P. lactiflora floral color and its formation mechanism in the field. In order to explore the effect of Pro-Ca on floral color of P. lactiflora, in this study, firstly, a purple-red cultivar 'Luhong' with control and Pro-Ca treatment was used as the material. Next, their color indices were measured.

Then, qualitative and quantitative analysis of flavonoids was performed. Finally, the expression patterns of PlPAL, PlCHS, PlF3H, PlF3'H, PlFLS, PlDFR, PlANS and PlF3GT were analyzed. These results might establish a theoretical foundation for the regulation of floral color in P. lactiflora by Pro-Ca treatment.

Materials and Methods

Experimental Materials and Treatments

Experimental materials: Experiments were performed in the fields of the germplasm repository of Horticulture and Plant Protection College, Yangzhou University, China (32deg23'31" N, 119deg24'50" E) under nature state. A purple-red P. lactiflora cultivar 'Luhong' was selected. It was transplanted into eight rows (three plants per row) in the germplasm repository in 2009 and grown in a natural state ever since. The petals separated from the flowers were used as the experiment material.

Treatments: The pretest study was performed in 2014 and we received the most effective concentration at a 1,000 ppm solution of Pro-Ca (90% BR; Shanghai yuanye Bio-Technology Co., Ltd). In 2015, within all eight rows, four rows of plants were given solutions of Pro-Ca at 1000 ppm. Another four rows of plants received a spray of distilled water. Both two groups were sprayed weekly from March 30th to April 27th at dusk in total of five times. The flowers of each group at three developmental stage: stage 1 (S1), flower-bud stage; stage 2 (S2), initiating bloom stage; stage 3 (S3), bloom stage bloom stage were collected from May 8th to May 20th respectively. Petals were separated from the flowers as the samples after each collection.

Subsequently, ten random of petals were selected from each group in three developmental stages to measure the color indices - the color parameter lightness (L*) and red/green (a*) by a TC-P2A colorimeter (Beijing Optical Instrument Factory, China), and each petal were measured in the middle part to reduce errors. Then samples were quickly frozen with liquid nitrogen and stored at -80degC for further study.

Qualitative and Quantitative Analysis of Flavonoids

The method of qualitative and quantitative analysis of flavonoids was the same as the report of Zhao et al. (2014) with some modifications. In brief, the petal powder (1.0 g fresh weight) of each sample was extracted with 6 mL of acidic methanol solution (70: 0.1: 29.9; v/v/v, CH3OH: HCl: H2O) at 4degC for 24 h. The qualitative and quantitative analysis of flavonoids were performed by high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MSn, LCQ Deca XP MAX, Thermo) coupled with photodiode array and mass spectrometry detectors (HPLC-PDA-MS, Thermo company) with a three-dimensional quadrupole ion trap mass spectrometer. The HPLC column was TSK gel ODS-80Ts QA (4.6 mm x 250 mm) (Tosoh, Japan). Cyanidin-3-O-glucoside (Cy3G) and rutin were used as reference for the relative quantitative analysis. Additionally, total content of flavonoids was the sum of anthocyanins and anthoxanthins. Three extractions were made for each biological sample.

Gene Expression Analysis

The relative expression levels of genes were analyzed using real-time quantitative polymerase chain reaction (Q-PCR) with a BIO-RAD CFX Connect TM Real-Time System (Bio-Rad, USA). Total RNA was separately extracted from each sample under using Trizol Regent Kit (TaKaRa, Japan) according to the manufacturer's instructions with some modifications. All RNA samples purified with DNase I kit (TaKaRa, Japan). The cDNA was transcribed using a reverse transcription kit (TaKaRa, Japan) for real-time quantitative PCR. Finally, Q-PCR was performed using the Power SYBR(r) Green PCR Master Mix (Applied Biosystems, USA) with three replicates. All gene-specific primers in this study are shown in Table 1. The Q-PCR efficiency of each gene was obtained by analyzing the standard curve of a cDNA serial dilution. Relative abundance was calculated with the 2-CT method using P. lactiflora Actin (JN105299) for template normalization (Zhao et al., 2012b).

Statistical Analysis

The comparison were made between the two group plants (foliar sprayed with 1,000 ppm Pro-Ca solution and distilled water). Primers were designed using a Primer 5.0 program. Design of the experiments was completely randomized with three replications. All data were average values of three replicates at least with standard deviations to determine comparative responses of floral color with or without Pro-Ca spray. The results were statistically analyzed for variance using the SAS/STAT statistical analysis package (version 9.4, SAS Institute, Cary, NC, USA).

Results

Color Indices

The petals of 'Luhong' in plants with control and Pro-Ca treatment were selected as the materials in this study. Through comparative eyes, the floral color was turned lighter in plants with Pro-Ca treatment compared to the control (Fig. 1). To check the results more scientifically, a chroma meter was used. By measuring their color indices, the result of floral color was expressed as the color parameter L* and the color parameter a* values. As shown in Fig. 2, the parameter L* value of both petals with control and Pro-Ca treatment presented a gradually upward trend during flower development, while the parameter a* value presented a downward trend. In addition, after Pro-Ca treatment, the parameter L* value was significantly increased by nearly 50% compared to the control in each developmental stage. Correspondingly, the parameter a* value was markedly decreased after Pro-Ca treatment, especially in S3 that decreased to 55% compared to the control.

Identification of Flavonoid Compositions

Depending on the color indices, qualitative and quantative analysis of flavonoids was performed by HPLC-ESI-MSn. Flavonoid compositions could be detected unambiguously from their ultraviolet-visible absorption characteristics. Anthocyanin and anthoxanthin compositions were separated by their different absorption bands at 525 nm and 350 nm, respectively. According to the HPLC profiles (Fig. 3), similar compositions of flavonoid were found in both petals with control and Pro-Ca treatment, but the peak area of each composition was not the same. Comparing with the control, all the peaks were obviously lower after Pro-Ca treatment, except a few peaks of anthoxanthins. Subsequently, five anthocyanins and seven anthoxanthins compositions were separated and characterized (Fig. 4). At 525 nm, the maximum absorption wavelength (lmax) of the obvious peak a3 was 275 and 515 nm, [M+H]+ was at m/z 625.22 with fragment ions at m/z 463.01 and 301.24.

Fragments with an m/z of 301 represented a peonidin derivative and it was formed by m/z 625 that lost two fragment ions of 162 mass units. From the mass number of glucose 162, it was known that it was a peonidin derivative with two residues.

By comparing the HPLC retention time, spectral and reported mass spectrum data, it was identified as peonidin-3,5-di-O-glucoside (Pn3G5G).

Similarly, at 350 nm, the obvious peak f2 with lmax of 265 and 345 nm, [M+H]+ at m/z 611.15 with fragment ions at m/z 448.96 and 287.37, was detected as a kaempferol derivative. The neutral loss of two 162 mass units corresponded to two glucose molecules. By comparing the HPLC retention time, spectral and mass spectrum data with reported literatures, it was identified as kaempferol -3,7-di-O-glucoside (Km3G7G).

Using the same method, peaks a1 (lmax 275 and 515 nm, [M+H]+ (m/z) 611.18, MS2 (m/z) 448.99 and 287.29), a2 (lmax 275 and 500 nm, [M+H]+ (m/z) 595.21, MS2 (m/z) 432.99 and 271.28), a4 (lmax 275 and 515 nm, [M+H]+ (m/z) 463.21, MS2 (m/z) 301.27), a5 (lmax 275 and 515 nm, [M+H]+ (m/z) 711.21, MS2 (m/z) 549.03, 463.05 and 301.22), f1 (lmax 260 and 355 nm, [M+H]+ (m/z) 465.01, MS2 (m/z) 303.43), f3 (lmax 265 and 345 nm, [M+H]+ (m/z) 697.18, MS2 (m/z) 534.99, 448.96 and 287.33), f4 (lmax 265 and 355 nm, [M+H]+ (m/z) 465.28, MS2 (m/z) 303.15), f5 (lmax 265 and 355 nm, [M+H]+ (m/z) 465.04, MS2 (m/z) 303.11), f6 (lmax 270 and 350 nm, [M+H]+ (m/z) 601.29, MS2 (m/z) 449.03 and 286.95), f7 (lmax 265 and 365 nm, [M+H]+ (m/z) 449.12,

MS2 (m/z) 287.29) were characterized as cyanidin-3, 5-di-O-glucoside (Cy3G5G), pelargonidin-3, 5-di-O-glucoside (Pg3G5G), peonidin-3-O-glucoside (Pn3G), peonidin-3-O-malonylglucoside-5-O-glucoside (Pn3MloG5G), quercetin-3, 7-di-O-galactoside (Qu3G7G), kaempferol-3-O-malonylglucoside-7-O-glucoside (Km3MloG7G), quercetin-3-O-galloyglucoside (Qu3GloG), quercetin-3-O-galactoside (Qu3G), kaempferol-3-O-galloyglucoside (Km3GloG) and kaempferol-7-O-glucoside (Km7G), respectively.

Quantitative Analysis of Flavonoids

Based on the references of Cy3G and rutin, the relative quantity of anthocyanin anthoxanthin compositions were analyzed. As shown in Fig. 5, the content of tentative anthocyanin and anthoxanthin compositions in petals with control and Pro-Ca treatment all basically showed a download trend during flower development and reached their minimum in S3. Meanwhile, compared to control, the content of each composition was basically lower in each stage with Pro-Ca treatment, except for a2 in S2. Besides, Cy3G5G and Pn3G5G were identified as the two major anthocyanin compositions, which were averagely accounted for 18.85 and 51.90% of total anthocyanin contents in control, 21.91 and 54.66% in Pro-Ca treatment. Concerning total contents, total anthocyanins, anthoxanthins and flavonoids in both were all in decline during flower development (Fig. 5).

What's more, total contents, whether anthocyanins, anthoxanthins, were much lower in petals with Pro-Ca treatment, nearly fell up to average 50 and 70%. Taken together, total flavonoid content in control was approximately about average 2.8 times as much as those in Pro-Ca treatment.

Expression Analysis of Flavonoid Biosynthetic Genes

To explore major genes influencing the flavonoids formation due to Pro-Ca treatment, the expression patterns of its biosynthetic genes were analyzed by Q - PCR. The samples were the same in qualitative and quantative analysis of flavonoids, and the result was shown in Fig. 6. From the point of the overall expression level, the expression level of upstream PlCHS was the highest, upstream PlF3'H and downstream PlF3GT were the lowest and the rest were in between.

Table 1: Gene-specific primers used in Q-PCR analysis

Gene###Forward primer sequence (5'-3')###Reverse primer sequence (5'-3')

PAL###TGAGTCAAGTTGCCAAGAG###GCATTAAAGGGTAAGTAGCG

CHS###ATGACTGGAACTCGATACTCT###CTCACTCAAAACATGCCTAG

CHI###CAACTTTCCGAGGCTGTG###CTCCTTTGACCTTATCCATC

F3H###AAGGAAGCACTCACAAACG###GAAGACCACCCACCTGAT

F3'H###GGCGAGAAACCAAACATT###CCATCCGTAGCCCTAAACT

FLS###GCTATCTCATCCGCACAA###CTTCAAACTTTCCTCTACCAG

DFR###GCACTTTCTCCAATCACAG###CAAATGTAGCGACCCTCT

ANS###AGATTAGAACAAGAAGTCGGTG###GGAGGATGAAAGTGAGGG

Actin###GTTGCCCTTGATTACGAG###CAGCTTCCATTCCGATTA

Table 2: Retention time, ultraviolet-visible spectral properties, mass spectrometric data and tentative identification of the compounds detected in P. lactiflora petals with control and Pro-Ca treatment

Peak###Retention time###Mass spectrometry information###Tentative identification

###(min)###max (nm)###[M+H]+ (m/z)###MS2 (m/z)

a1###18.01###275; 515###611.18###448.99; 287.29###Cyanidin-3,5-di-O-glucoside

a2###22.10###275; 500###595.21###432.99; 271.28###Pelargonidin-3,5-di-O-glucoside

a3###25.47###275; 515###625.22###463.01; 301.24###Peonidin-3,5-di-O-glucoside

a4###35.23###275; 515###463.21###301.27###Peonidin-3-O-glucoside

a5###36.50###275; 515###711.21###549.03; 463.05; 301.27###Peonidin-3-O-malonylglucoside-5-O-glucoside

f1###19.19###260; 355###627.14###465.01; 303.43###Quercetin-3,7-di-O-glucoside

f2###25.12###265; 345###611.15###449.21; 287.37###Kaempferol-3,7-di-O-glucoside

f3###29.99###265; 345###697.18###534.99; 448.96; 287.33###Kaempferol-3-O-malonylglucoside-7-O-glucoside

f4###37.30###265; 355###617.21###465.28; 303.15###Quercetin-3-O-galloyglucoside

f5###45.73###265; 355###465.04###303.11###Quercetin-3-O-glucoside

f6###53.54###270; 350###601.29###449.03; 286.95###Kaempferol-3-O-galloyglucoside

f7###54.81###265; 365###449.12###287.29###Kaempferol-7-O-glucoside

Besides, the expression level of upstream PlF3H and downstream PlDFR, PlANS also achieved a higher level. In terms of the overall trend, the expression patterns of PlPAL, PlCHS, PlF3H, PlF3'H, PlDFR, PlANS and PlF3GT exhibited a similar downward trend during flower development and reached the lowest level, except PlF3GT in S2 in the control. Unlike the other genes, the expression patterns of PlFLS showed firstly a rise from S1 to S2 followed by a decline from S2 to S3 in both. After Pro-Ca treatment, the expression level of PlF3H, PlF3'H, PlDFR, PlANS and PlF3GT were significantly reduced compared to the control, except for PlF3H and PlF3GT in S2 which were not obviously changed. Also, the expression level of PlF3'H, PlDFR and PlANS fell down to nearly half or less in petals with Pro-Ca treatment. Although the expression levels of PlF3H and PlFLS in S2 were a little higher in petals with Pro-Ca treatment than in the control, there was no notable difference between the two.

Discussion

In this study, a chroma meter was used to determinate flower color for more accurate results. Also, a uniform color space was applied to chroma meter. In a uniform color space, the color parameter L* value represented lightness while the color parameter a* value represented a ratio of red/magenta and green. More specifically, a higher value of the L* indicated a lighter color but a bigger absolute value, while a* represented a darker color in red/magenta or green.

A positive value of the parameter a* was for red/magenta while a negative value was noted for green. After Pro-Ca treatment, nearly 50% increase of the parameter L* value together with an average 10% decrease of the parameter a* value were detected in petals with Pro-Ca treatment in each developmental stage compared to the control. This was in accordance with the results in petunia, impatiens and rose (Ilias and Rajapakse, 2005; Schmitzer et al., 2012), which could further prove that treatment with Pro-Ca could lead to a loss of red color in ornamental flowers. Moreover, the dilution was reflected not just in the final result, but at each developmental stage, which might indicate that the inhibition brought by Pro-Ca treatment had worked before it came to bloom. In addition, the parameter L* value was gradually increased along with the parameter a* value was gradually decreased during flower development in both.

This showed that the flower color was slightly faded during flower development, which was consistent with the results in other P. lactiflora cultivars by Zhong et al. (2012) and Zhao et al. (2012a, 2016) reports.

The expression of floral color was the result of internal factors combined with external factors, among these factors, floral color were primarily determined by the production of pigments, especially by the flavonoids which included anthocyanins and anthoxanthins (Jia et al., 2008; Zhao et al., 2012a). Previous study by Zhao et al. (2015) showed that the floral colors were related not only to the compositions but also the contents of flavonoid.

For example, in P. lactiflora, anthocyanins were responsible for red and purple petal color, whereas anthoxanthins were for yellow (Zhao et al., 2014). The content of anthoxanthins was much higher in red flowers than in white flowers (Zhao et al., 2016). Depending on HPLC-ESI-MSn, the quality and quantity of flavonoids were analyzed that the compositions of flavonoid were basically the same after Pro-Ca treatment, but the contents witnessed remarkable changes. After Pro-Ca treatment, a dramatic reduction was shown in individual and total anthocyanidin contents. It was consistent with the result in rose flowers (Schmitzer et al., 2012), which demonstrated that Pro-Ca treatment brought about a negative effect on individual and total anthocyanin contents in ornamental flowers. Meanwhile, the content of several components belonged to anthoxanthins, such as flavonols, was also reduced after treated with Pro-Ca in young grape flowers (Puhl et al., 2008).

It was mainly coincided with the result in our study that most individual and total anthoxanthins content decreased after Pro-Ca treatment. As a result, after Pro-Ca treatment, the accumulation of both anthocyanins and anthoxanthins were inhibited in this study. Also, the reduction of anthocyanin and anthoxanthin contents was due in large part to the dilution of floral color (Zhong et al., 2012). Furthermore, among the anthocyanins, Pn3G5G and Cy3G5G were identified as the two major anthocyanins in 'Luhong'. In P. lactiflora, Pn3G5G and Cy3G5G were responsible for red coloration by comparing anthocyanin compositions in 41 P. lactiflora cultivars (Jia et al., 2008). In our study, a remarkable decrease in Pn3G5G and Cy3G5G after Pro-Ca treatment would mainly cause a loss especially of red coloration.

However, it was worth noticing that compared to anthocyanins like Pn3G5G and Cy3G5G, anthoxanthins presented a negligible part of purple-red color definition as anthoxanthins were mainly responsible for yellow or evenly colorless in P. lactiflora (Zhao et al., 2014).

The accumulation of avonoids was determined by a series of genes in the avonoids biosynthesis pathway (Nakatsuka et al., 2005). Pro-Ca, a 2-ODD inhibitor, performed by blocking several 2-ODDs involved in the avonoids biosynthesis pathway (Rademacher, 2000). Earlier, Halbwirth et al. (2006) proposed that F3H and FLS, the two 2-ODDs genes, were inhibited in young grapevine leaves, flowers, and berries after Pro-Ca treatment. The inhibition of F3H had been proved in the skin of apples, while the expression levels of PAL, CHS, F3H, DFR, ANS and FGT were also reduced in varying degrees after treatment (Bizjak et al., 2013). In our study, we also noted that the expression of PlCHS, PlF3H, PlF3'H, PlDFR, PlANS and PlF3GT was lower levels in petals with Pro-Ca treatment. Mostly the expression of rest of the genes remained basically at consistent level. On the whole, a universal reduction of enzyme activities studied in this study was shown in flavonoid pathway except PlPAL after Pro-Ca treatment.

With the regular expressions of upstream PlCHS and downstream PlFLS, as well as lower expressions of PlF3H, PlF3'H and downstream PlDFR, PlANS, PlF3GT, fewer amount of anthocyanins and anthoxanthins was produced after Pro-Ca treatment. Furthermore, F3H, FLS and ANS were the 2-ODDs in the avonoids biosynthesis pathway (Halbwirth et al., 2006). Lower expression of PlF3H and PlANS might indicate that F3H and ANS were the possible enzymes inhibited by Pro-Ca treatment, while F3'H, DFR and UGT might also be suppressed (Fig. 6). Specifically, ANS was the major enzyme in anthocyanins biosynthesis. It played an important role in the accumulation of anthocyanins because it catalyzed the colorless leucoanthocyanidins to the colored anthocyanidins. In P. lactiflora, PlANS was directly associated with red petal pigmentation (Zhao et al., 2014; 2016).

For example, a higher expression level of PlANS was detected in purple-red flowers than in pink flowers, whereas in white or yellow flowers, it was all in a lower level (Zhao et al., 2016). In our study, after Pro-Ca application, the lower expressions of PlANS combined with PlDFR and PlF3GT were correlated with their anthocyanin contents and might eventually led to a loss of red color in P. lactiflora flowers.

Conclusion

A synergistic inhibitory effect of flavonoid biosynthesis genes especially PlF3H and PlANS after Pro-Ca treatment, might inhibit the accumulation of anthocyanins and anthoxanthins. The contents of anthocyanins, especially Pn3G5G and Cy3G5G, was a major factor in floral color and was mainly responsible for red and purple. A decrease in anthocyanins content eventually contributed to a loss of red color in P. lactiflora flowers after Pro-Ca treatment. These results would establish a theoretical foundation for the regulation of floral color in P. lactiflora by Pro-Ca treatment.

Acknowledgements

This work was supported by the Natural Science Foundation of China (31372097, 31400592), the Major Project of College Natural Science Research of Jiangsu Province (13KJA210005) and the Priority Academic Program Development from Jiangsu Government.

References

Aghdam, M.S., 2013. Mitigation of postharvest chilling injury in tomato fruit by prohexadione calcium. J. Food Sci. Technol., 50: 1029-1033

Bizjak, J., J. Jakopic, A. Slatnar, F. Stampar, K. Stich, H. Halbwirth, P. Zadravec and R. Veberic, 2012. Late prohexadione-calcium treatment on maturing apple cv. 'Braeburn' fruit reduces anthocyanins and alters the phenolic content. Europ. J. Hort. Sci., 77: 154-162

Bizjak, J., N. Weber, M.M. Petkovsek, Z. Alam, J. Thill, K. Stich, H. Halbwirth and R. Veberic, 2013. Polyphenol gene expression and changes in anthocyanins and polyphenols in the skin of 'Braeburn' apples after the autumn treatment of prohexadione-calcium. Plant Growth Regul., 71: 225-233

Cetinbas, M., S. Butar, A. Atasay, M. Isci and H. Kocal, 2015. Reduction of apple vegetative shoot growth cv. Starcrimson Delicious/MM 111 with prohexadione calcium treatment does not decrease fruit quality. J. Appl. Bot. Food Qual., 88: 259-263

Duyvelshoff, C. and J.A. Cline, 2013. Ethephon and prohexadione-calcium influence the flowering, early yield, and vegetative growth of young 'Northern Spy' apple trees. Sci. Hortic., 151: 128-134

Fan, Z.W., H. Buschmann and J. Sauerborn, 2007. Prohexadione-calcium induces sunflower (Helianthus annuus) resistance against the root parasitic weed Orobanche Cumana. Weed Res., 47: 34-43

Halbwirth, H., T.C. Fischer, K. Schlangen, W. Rademacher, K.J. Schleifer, G. Forkmann and K. Stich, 2006. Screening for inhibitors of 2-oxoglutarate-dependent dioxygenases: Flavanone 3b-hydroxylase and avonol synthase. Plant Sci., 171: 194-205

Ilias, I.F. and N. Rajapakse, 2005. Prohexadione-calcium affects growth and flowering of petunia and impatiens grown under photoselective films. Sci. Hortic., 106: 190-202

Jia, N., Q.Y. Shu, L.S. Wang, H. Du, Y.J. Xu and Z.A. Liu, 2008. Analysis of petal anthocyanins to investigate coloration mechanism in herbaceous peony cultivars. Sci. Hort., 117: 167-173

Kim, Y.H., A.L. Khan, M. Hamayun, J.T. Kim, J.H. Lee, I.C. Hwang, C.S. Yoon and I.J. Lee, 2010. Effects of Prohexadione Calcium on growth and gibberellins contents of Chrysanthemum morifolium R. cv Monalisa White. Sci. Hort., 123: 423-427

McGrath, M.J., J.M. Koczan, M.M. Kennelly and G.W. Sundin, 2009. Evidence that prohexadione-calcium induces structural resistance to fire blight infection. Phytopathology, 99: 591-596

Nakatsuka, T., M. Nishihara, K. Mishiba and S. Yamamura, 2005. Temporal expression of flavonoid biosynthesis-related genes regulates flower pigmentation in gentian plants. Plant Sci., 168: 1309-1318

Ozbay, N. and N. Ergun, 2015. Prohexadione calcium on the growth and quality of eggplant seedlings. Pesq. Agropec. Bras., 50: 932-938

Puhl, I., F. Stadler and D. Treutter, 2008. Alterations of flavonoid biosynthesis in young grapevine (Vitis vinifera L.) leaves, flowers, and berries induced by the dioxygenase inhibitor Prohexadione-Ca. J. Agric. Food Chem., 56: 2498-2504

Rademacher, W. and R. Kober, 2003. Efficient use of prohexadione-Ca in pome fruits. Eur. J. Hort. Sci., 68: 101-107

Rademacher, W., 2000. Growth retardants: effects on gibberellins biosynthesis and other metabolic pathways. Annu. Rev. Plant Physiol. Plant Mol. Biol., 51: 501-531

Schmitzer, V., R. Veberic and F. Stampar, 2012. Prohexadione-Ca treatment modifies flavonoid composition and color characteristics of rose (Rosa hybrida L.) flowers. Sci. Hort., 146: 14-20

Zhao, D.Q. and J. Tao, 2015. Recent advances on the development and regulation of flower color in ornamental plants. Front. Plant. Sci., 6: 1-13

Zhao, D.Q., J. Tao, C.X. Han and J.T. Ge, 2012a. Flower color diversity revealed by differential expression of avonoid biosynthetic genes and avonoid accumulation in herbaceous peony (Paeonia lactiora Pall.). Mol. Biol. Rep., 39: 11263-11275

Zhao, D.Q., J. Tao, C.X. Han and J.T. Ge, 2012b. Actin as an alternative internal control gene for gene expression analysis in herbaceous peony (Paeonia lactiflora Pall.). Afr. J. Agric. Res., 7: 2153-2159

Zhao, D.Q., M.R. Wei, D. Liu and J. Tao, 2016. Anatomical and biochemical analysis reveal the role of anthocyanins in ower coloration of herbaceous peony. Plant Physiol. Biochem., 102: 97-106

Zhao, D.Q., W.H. Tang, Z.J. Hao and J. Tao, 2015. Identification of flavonoids and expression of flavonoid biosynthetic genes in two coloured tree peony flowers. Biochem. Biophys. Res. Commun., 459: 450-456

Zhao, D.Q., Y. Jiang, C.L. Ning, J.S. Meng, S. Lin, W. Ding and J. Tao, 2014. Transcriptome sequencing of a chimera reveals coordinated expression of anthocyanin biosynthetic genes mediating yellow formation in herbaceous peony (Paeonia lactiflora Pall.). BMC Genomics, 15: 689

Zhong, P.X., L.S. Wang, S.S., Li, Y.J. Xu and M.L. Zhu, 2012. The changes of floral color and pigments composition during the flowering period in Paeonia lactiflora Pall. Acta Hortic. Sin., 39: 2271-2282
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Tang, Yuhan; Zhao, Daqiu; Hao, Zhaojun; Tao, Jun
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Apr 30, 2017
Words:5032
Previous Article:Influence of Strigolactone (GR24) as a Seed Treatment on Growth, Gas Exchange and Chlorophyll Fluorescence of Wheat under Saline Conditions.
Next Article:Comparison of Biochemical Components within White and Brown Cysts in the Cereal Cyst Nematode Heterodera avenae.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters