Printer Friendly

Production of [gamma]-linolenic acid and stearidonic acid in seeds of marker-free transgenic soybean (1).

HUNDREDS OF fatty acid species have been identified in the plant kingdom and many of them have important commercial applications. Most of these fatty acids are only available from a relatively few plant species, in which cost-effective production is difficult. Two examples of high-value fatty acids are GLA and STA. [gamma]-Linolenic acid has been used as a general nutraceutical (Horrobin, 1990) and for pharmacological applications in the treatment of skin conditions such as eczema. In addition, studies have revealed the fatty acid to possess some antiviral and anticancer properties (Horrobin, 1990; Gill and Valivety, 1997). Stearidonic acid, like GLA, is also of interest to both the pharmaceutical and nutraceutical industries (Griffiths et al., 1996). Commercial sources for GLA and STA are herbal oils derived from evening primrose (Oenothera biennis L.), borage, and black currents (Ribes nigrum L.) (Goffman and Galletti, 2001). The yield potential of these herbs is rather limited and levels of GLA and STA in the seed storage lipids constitute [less than] 16 and 5%, respectively.

In plants, GLA is produced by the desaturation of linoleic acid via a [[DELTA].sup.6] desaturase (Sayanova et al., 1997). A cDNA clone of a [[DELTA].sup.6] desaturase from borage expressed in tobacco was capable of generating both GLA and STA in the transgenic plants at 12.9 and 8.5%, respectively, in young leaves (Sayanova et al., 1997). Accumulation of the novel fatty acids in the transgenic tobacco lines varied across tissue, with the highest levels of 27.2% GLA and 8.7% STA being observed in stem tissue (Sayanova et al., 1999). Introduction of a fungal (Mortierella alpina Peyronel) [[DELTA].sup.6] desaturase into canola (Brassica napus L.) resulted in accumulation of GLA in the seed to approximately 13%, while dual expression of the fungal [[DELTA].sup.12]- and [[DELTA].sup.6]-desaturase genes resulted in elevated levels of GLA in seeds, 43%, and production of STA levels of [approximately equal to] 2% (Liu et al., 2001). The combination of [[DELTA].sup.12]- and [[DELTA].sup.6]-desaturase genes was required to enhance GLA levels in canola since the predominate fatty acid in B. napus seed is oleic. Expression of the [[DELTA].sup.12] desaturase would shift the oleic acid pool to linoleic that, in turn, would be used as a substrate for the [[DELTA].sup.6] desaturase. On the other hand, soybean seed storage lipids contain linoleic acid and [alpha]-linolenic acid at levels of [approximately equal to] 55 and 10%, respectively. Hence, this major oilseed crop is the ideal target for cost-effective production of the two high-value fatty acids, GLA and STA.

Implementing plant genetic engineering protocols for the introduction of novel phenotypes into plant species necessitates the use of selectable marker genes to efficiently identify the relatively few cells that actually integrate foreign DNA elements. To this end, a number of selection systems are available including those for resistance toward antibiotics (Bevan and Flavell, 1983; Gritz and Davies, 1983) and herbicides (Thompson et al., 1987; Barry et al., 1992). The former are of no agronomic value, and may evoke negative connotations by the consumer. The latter class of marker genes can provide alternative approaches for effective weed control (Delannay et al., 1995). However, as additional traits are introduced into a crop germplasm through biotechnology by implementing the identical marker gene for selection, it would be prudent to avoid crossing strategies that will bring together duplicated transgenic elements so as to limit the probability of gene silencing (Cerutti, 2003; Vance and Vaucheret, 2001). It would clearly be useful to have in place a strategy for the efficient removal of the marker gene to permit breeders to pyramid novel transgenic traits, while limiting the potential of silencing one or all of the transgenic traits due to the duplicated transgenic alleles in the genome.

A number of strategies have been reported in the literature for the generation of marker-free transgenic plants (McKnight et al., 1987; Goldsbrough et al., 1993; Komari et al., 1996; Dale and Ow, 1991; Gleave et al., 1999; Lu et al., 2001; Zuo et al., 2001; Cotsaftis et al., 2002; Endo et al., 2002). To date, two systems tend to be more efficient in major crop plants, the multi-auto-transformation (MAT) (Endo et al., 2002), and the simultaneous delivery of two T-DNA elements (Komari et al., 1996; Daley et al., 1998; Xing et al., 2000; Miller et al., 2002). In these examples, only nonagronomic reporter genes have been used as a proof of concept. Herein, we report on the production of two high-value fatty acids in the seed storage lipids of marker-free elite transgenic soybean germplasm by the simultaneous delivery of a marker-gene T-DNA element and a T-DNA element carrying the borage [[DELTA].sup.6] desaturase, followed by elimination of the marker gene T-DNA in segregating progeny.

MATERIALS AND METHODS

Assembly of the Two T-DNA Binary Plasmid

A cDNA of the borage [[DELTA].sup.6] desaturase was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) from a pool of poly-(A) RNA derived from developing floral buds. The primers Bor-5:TTTTTCATCCATGGCTGCTC AAATCAAGAAATAC and Bor-3:TTTTTTCTAGATTA ACCATGAGTGTGAAGAGC were used in the RT-PCR reaction. The primers introduce an Ncol site and an XbaI site at the 5' and 3' end of the ORF for ease in subsequent subcloning. The PCR product was verified by sequence analysis. The [[DELTA].sup.6]-desaturase gene was fused to the tobacco etch virus translational enhancer element (TEV) (Carrington and Freed, 1990). The resultant element was subsequently cloned between the soybean embryo specific promoter [beta]-conglycinin and the 3' UTR of 35S CaMV transcript. The [[DELTA].sup.6]-desaturase expression cassette was cloned into the binary vector pPZP102 (Hajdukiewicz et al., 1994) and the resultant vector referred to as pPTN328. The T-DNA element from pPTN328 was subcloned as a ScaI fragment into the binary vector pPTN200, a derivative of pPZP202 (Hajdukiewicz et al., 1994) that harbors a bar gene (Thompson et al., 1987) cassette under the control of the Agrobacterium tumefaciens nos promoter. The resultant two T-DNA binary plasmid is referred to as pPTN331 (Fig. 1).

[FIGURE 1 OMITTED]

Soybean Transformations

The two T-DNA plasmid pPTN331 was mobilized into A. tumefaciens strain EHA101 (Hood et al., 1986) via triparental mating (Ditta et al., 1980). Soybean transformations were conducted with the resultant transconjugant as previously described (Zhang et al., 1999; Clemente et al., 2000). Soybean genotypes used in this study were A3237 (Asgrow Seed Co., Des Moines, IA), Thorne (Ohio State University, Columbus) and NE3001 (University of Nebraska, Lincoln).

Characterizations of Soybean Transformants

Primary transformants were established in the greenhouse and grown to maturity. Southern blot analysis was conducted on all the primary transformants and a subset of the progeny derived from selected lines. Total genomic DNA was digested with either HindIII, SstI, or EcoRI. The bar and borage [[DELTA].sup.6]-desaturase genes were used as probes in the hybridization analysis. Northern analysis was conducted on immature embryos as previously described (Buhr et al., 2002) using the borage [[DELTA].sup.6] desaturase as a probe.

Fatty acid analysis was conducted on cotyledon chips of either [T.sub.1] or [T.sub.2] generations. Fatty acid analysis was performed using gas chromatography following the procedure outlined by Butte et al. (1982). Fatty acid levels are reported as a percentage of total fatty acids. The remaining portion of the seed, with embryonic axis, was planted. Herbicide tolerance was ascertained by applying a 100 mg [L.sup.-1] solution of glufosinate with a cotton swab to the upper surface of a young leaflet approximately 20 d after planting.

RESULTS

Production of Transgenic Soybean Containing the B officinalis [[DELTA].sup.6] Desaturase

Gamma linolenic acid and STA are produced via desaturation of linoleic and [alpha]-linolenic, respectively (Sayanova et al., 1997). A cDNA clone of the B. officinalis [[DELTA].sup.6]-desaturase gene was generated via RT-PCR from poly-A RNA isolated from developing buds of the herb. The gene was fused to the tobacco etch virus translational enhancer element (Carrington and Freed, 1990) coupled with the soybean [beta]-conglycinin promoter. The resultant cassette was assembled into a two T-DNA binary vector designated pPTN331 (Fig. 1), in which T-DNA one harbored a bar (Thompson et al., 1987) gene cassette under the control of the nopaline synthase promoter (nos) from A. tumefaciens. The two T-DNA binary plasmid was mobilized into A. tumefaciens strain EHA101 (Hood et al., 1986) and the transconjugant was subsequently used to transform soybean.

Soybean transformations were conducted as previously described (Zhang et al., 1999; Clemente et al., 2000) employing glufosinate for selection. A total of 55 primary transgenic lines were established in the greenhouse. Southern blot analysis revealed that 29 of the primary transgenic lines carried both T-DNA elements (52.7% cotransformation).

Progeny Analyses on Cotransformed Soybean Lines

The 29 cotransformed lines were grown to maturity under greenhouse conditions and progeny analysis was conducted on the [T.sub.1] generation by monitoring for the four possible phenotypes of herbicide-tolerant/modified fatty-acid profile (HT/GLA/STA), herbicide-sensitive/ modified fatty-acid profile (HS/GLA/STA), herbicide-tolerant/wild-type fatty-acid profile (HT/WT), and herbicide-sensitive/wild-type fatty-acid profile (HS/WT). Fatty acid analysis was conducted on cotyledon chips from individual seeds and the remainder of the seed with its associated embryonic axis was subsequently planted. Twenty days after germination, the plantlets ([T.sub.1]) were monitored for herbicide tolerance with a leaf-painting assay as previously described (Zhang et al., 1999). The segregation data on the 29 lines is summarized in Table 1. Among the 29 cotransformed lines, 17 generated [T.sub.1] progeny with detectable levels of GLA and STA. The average GLA levels in the 17 coexpressing lines within the [T.sub.1] populations ranged from 3.4 to 28.7%, while average STA levels varied from 0.6 to 4.2% (Table 2. Data from line 402.5 not shown.).

Northern analysis was conducted on three developing [T.sub.2] embryos derived from a [T.sub.1] individual from line 404-1 in which GLA and STA levels were observed at 36.7 and 3.7%, respectively. The data revealed high [[DELTA].sup.6]-desaturase transcript levels in the transgenic immature seed and lack of a corresponding message in a wild-type control immature seed (Fig. 2). We further characterized one of the cotransformed lines, 400-1, in which the fatty-acid profile in the seed storage lipids was not altered (Table 1). Southern analysis revealed that two of the [T.sub.1] plants had the identical hybridization pattern as the parental ([T.sub.0]) when the blot was probed with the bar gene, while a third [T.sub.1] inherited only one of the three bar hybridizing elements. When the [[DELTA].sup.6] desaturase was used as a probe, an extra [[DELTA].sup.6]-desaturase T-DNA element that was not detectable in the parental plant (Fig. 3) was inherited by only one of the three [T.sub.1] individuals characterized. One of the other two [T.sub.1] individuals inherited the [[DELTA].sup.6]-desaturase T-DNA hybridizing element detected in the [T.sub.0] (Lane 2, Fig. 3), and the other inherited neither (Lane 3, Fig. 3). This observation suggested that in the parental line ([T.sub.0]), the second [[DELTA].sup.6]-desaturase integration event existed as a chimera, at a level below detection by southern analysis, that was inherited in a subset of the [T.sub.1] individuals. Moreover, the southern data also indicate that the [[DELTA].sup.6]-desaturase T-DNA alleles that were integrated in line 400-1 were probably truncated and/or rearranged, which would explain the wild-type fatty-acid profile observed in the [T.sub.1] individuals derived from the line. The probable truncation of the [[DELTA].sup.6]-desaturase T-DNA alleles that were inherited is reflected in the lack of the expected 1.3-kb HindIII (Fig. 1) southern blot hybridization signal when the A6 desaturase was used as a probe (Fig. 3). Likely, the [[DELTA].sup.6]-desaturase alleles were missing the 3' region of the gene or rearranged alleles were integrated.

[FIGURES 2-3 OMITTED]

Among the 29 cotransformed lines, eight produced seed with the phenotype of interest (HS/GLA/STA). However, only four of the eight lines that produced [T.sub.1] seed with the desired phenotype (HS/GLA/STA) were marker-free, lines 419-2 and 420-5 (Fig. 4A), 414-5 (Fig. 4B), and 414-2 (Fig. 4C. 414-9 data not shown. [T.sub.1] individuals harbor bar gene.). This frequency represents [approximately equal to] 7% of the total transgenic lines generated (4/55). The southern blot in Fig. 4C shows the data from four HS/ GLA [T.sub.1] individuals derived from line 414-2 and the one HS/GLA [T.sub.1] individual from line 414-3. The data reveal that three of the four HS/GLA [T.sub.1] individuals from line 414-2 were actually devoid of the bar T-DNA element, while the other [T.sub.1] from 414-2 and the single [T.sub.1] with the HS/GLA phenotype from 414-3 harbored the bar T-DNA element. Figure 4B displays analysis results from 411-5,414-5, and 418-6 [T.sub.1] individuals with the HS/ GLA phenotype. Included in Fig. 4B is a [T.sub.1] individual derived from line 418-6 that displayed some herbicide damage, but was categorized as HT/GLA [T.sub.1] in Table 1. The data show that from this set of [T.sub.1] individuals only one of the 414-5 [T.sub.1] plants was actually marker-free, while the [T.sub.1] individuals derived from the other lines (411-5 and 418-6) contained bar hybridizing sequences.

Molecular characterization of the [T.sub.1] HS/GLA individuals from the last two lines, 419-2 and 420-5, is shown in Fig. 4A along with a subset of HT/GLA [T.sub.1] individuals from these lines. Here, the molecular data correlated with the HS phenotype in that all [T.sub.1] individuals that were herbicide sensitive lacked bar hybridizing sequences, and vis-a-vis with respect to the HT [T.sub.1] individuals.

[FIGURE 4 OMITTED]

Stability of the novel fatty-acid profile in six of the coexpressing transgenic lines was ascertained by monitoring [T.sub.2] seed. [T.sub.2] seed derived from marker-free [T.sub.1] individuals representing lines 414-2, 419-2, and 420-5 were included in this analysis. The tabulated mean fatty acid levels are shown in Table 3. The data set in Table 3 does not include the null recessives. The [T.sub.1] individuals selected for the [T.sub.2] data analysis from lines 419-2, 414-2, and 404-7 were heterozygous, and the [T.sub.2] seed were segregating for the GLA/STA phenotype in ratios of 15:5, 20:2, and 26:5, respectively. The selected [T.sub.1] individuals from which [T.sub.2] seed were collected for lines 420-5, 398-6, and 411-5 all appeared to be homozygous for the novel fatty-acid profile. The mean GLA and STA levels in the [T.sub.2] populations (Table 3) from the selected lines were comparable with those observed within the respective [T.sub.1] samples analyzed (Table 2), reflecting the stability of the novel phenotype through meiosis. Southern blot analysis was conducted on six [T.sub.2] individuals (Fig. 5) derived from the marker-free [T.sub.1] plant recovered from line 420-5 (Fig. 4A). The data reveal a rather simple insert, one locus, with one to two copies at the site of integration and, as expected, remained marker-free (Fig. 5).

[FIGURE 5 OMITTED]

DISCUSSION

Linoleic acid and [alpha]-linolenic fatty acid pools in plants can be converted to GLA and STA, respectively, via the action of a [[DELTA].sup.6] desaturase (Griffiths et al., 1996; Sayanova et al., 1997; Sayanova et al., 1999; Liu et al., 2001). Sayanova et al. (1997) inserted the B. officinalis [[DELTA].sup.6]-desaturase gene down stream of the 35S CaMV promoter. Transgenic tobacco lines that harbored this constitutive [[DELTA].sup.6]-desaturase cassette produced significant levels of GLA and moderate levels of STA in vegetative tissues; however, relatively low levels of the novel fatty acids were produced in mature seed, <3.0% GLA and no detectable levels of STA (Sayanova et al., 1999). The authors speculated on a number of possibilities that can account for the lack of significant production of GLA and STA in mature tobacco seed, timing of expression of the transgene during seed development, substrate competition, or preferred specificities of the native fatty acids by the seed acyltransferases for incorporation into TAG. In canola, on the other hand, the lack of sufficient accumulation in the seed storage lipids of GLA and STA was overcome by dual, seed-specific, expression of fungal [[DELTA].sup.12]- and [[DELTA].sup.6]-desaturase genes (Liu et al., 2001). In this case, the combination of genes was required to first shift the relative high oleic acid pool to linoleic acid ([[DELTA].sup.12] activity) to provide a sufficient substrate for the [[DELTA].sup.6] desaturase. Importantly, this later work demonstrated that accumulation of these unusual fatty acids was not limited from lack of incorporation into the triacylglycerol backbone.

The fatty-acid profile in soybean is approximately 13% palmitic, 4% stearic, 18% oleic, 55% linoleic, and 10% [alpha]-linolenic acids. This is suggestive that a significant endogenous substrate pool for the [[DELTA].sup.6]-desaturase activity is present, making this commodity crop an ideal target for the production of these two novel fatty acids. The results presented here demonstrate that using a seed specific promoter to regulate expression of the borage [[DELTA].sup.6]-desaturase gent and implementing the two T-DNA binary system to simultaneously deliver two T-DNA elements, marker-free transgenic soybean lines can be recovered that produce significant levels of these novel fatty acids (Table 2).

Nutritional benefits have been attributed to diets supplemented with GLA. In addition, STA, the precursor to eicosapentaenoic acid and docosahexaenoic acid, may prove to be a more effective omega-3 fatty acid in diets than [alpha]-linolenic (Kris-Etherton et al., 2001). Moreover, STA may also serve as a substitute for fish oil as a route for long chain omega-3 fatty acids, which can augment stability and taste (Kris-Etherton et al., 2001).

Modulating seed metabolism in a major oil crop such as soybean can serve as a cost-effective route for the production of high-value molecules such as GLA and STA. This, in turn, provides the consumer an additional option to acquire the health benefits from these nutraceuticals without altering their dietary consumption (Knutzon and Knauf, 1998). The novel transgenic soybean lines described herein are the first report of a value-added trait introduced into a major crop plant free of a selectable marker gene. Field trials are underway to evaluate the agronomic performance of a population derived from the marker-free soybean line 420-5. The derived oil and meal from the field trails will subsequently be tested in animal feeding studies with pigs, chickens, and hamsters to monitor any potential beneficial effects of the novel soybean fatty-acid profile on the animals. Moreover, an attempt to enhance STA levels in soybean seed storage lipids is being pursued by dual expressing the borage [[DELTA].sup.6] desaturase with the Arabidopsis [[DELTA].sup.15] desaturase (FAD3). Here, we hope to convert a significant portion of the seed fatty acids to [alpha]-linolenic acid (FAD3 action), and thus provide a larger substrate pool for STA production.
Table 1. Segregation analysis ([T.sub.1]) on transgenic soybean lines.
GLA, [gamma]-linolenic acid; HT, herbicide tolerant, HS, herbicide
sensitive. ([dagger])

Line ([double dagger])    HT/GLA    HS/GLA    HT/WT   HS/WT

398-6 (A)                    4         0        1       1
400-1 (A)                    0         0       12       3
402-5 (N)                    1         0        0       1
404-1 (A)                   13         0        0       3
404-7 (A)                   13         0        0       3
404-11 (A)                   6         0        0       4
409-1 (A)                    0         0       12       1
411-5 (N)                   11         2        0       1
412-2 (T)                    3         0        0       0
412-4 (T)                    8         0        0       2
412-5 (T)                    0         0        4       0
413-1 (N)                    0         0        9       3
414-2 (T)                    9         4        0       0
414-3 (T)                    5         1        0       3
414-4 (T)                   12         0        0       1
414-5 (T)                    1         4        1       2
414-9 (T)                   10         3        2       0
416-4 (T)                    0         0       14       1
416-11 (T)                   0         0       15       0
418-5 (T)                    0         0        6       1
418-6 (T)                   10         3        1       2
419-2 (T)                    7         2        0       0
419-5 (N)                   11         0        6       0
419-12 (N)                   0         0        7       0
419-13 (N)                   0         0       11       4
420-5 (N)                    8         1        5       1
421-2 (T)                   12         0        2       0
423-1 (N)                    0         0        6       0
423-2 (N)                    0         0        9       8

([dagger]) Numbers within each column refer to the total number
of [T.sub.1], individuals with the respective phenotype.

([double dagger]) Letters in parenthesis refer to soybean
genotype: A, A3237; T, Thorne; and N, NE3001.

Table 2. Fatty-acid profiles of [T.sub.1] populations of coexpressing
transgenic soybean lines. GLA [gamma]-linolenic acid; STA, stearidonic
acid. ([dagger])

Line ([double dagger])        Palmitic            Stearic

398-6 (A)                11.9 [+ or -] 0.5    4.2 [+ or -] 0.4
404-1 (A)                12.1 [+ or -] 0.5    3.6 [+ or -] 0.2
404-7 (A)                11.7 [+ or -] 0.3    3.8 [+ or -] 0.2
404-11 (A)               11.8 [+ or -] 0.5    4.0 [+ or -] 0.3
411-5 (N)                11.3 [+ or -] 0.5    4.3 [+ or -] 0.2
412-2 (T)                11.4 [+ or -] 0.4    4.6 [+ or -] 0.4
412-4 (T)                11.8 [+ or -] 0.8    4.2 [+ or -] 0.4
414-2 (T)                11.6 [+ or -] 0.7    4.1 [+ or -] 0.3
414-3 (T)                11.3 [+ or -] 1.1    3.9 [+ or -] 0.4
414-4 (T)                11.7 [+ or -] 0.3    4.1 [+ or -] 0.2
414-5 (T)                11.4 [+ or -] 0.2    4.5 [+ or -] 0.2
414-9 (T)                11.6 [+ or -] 0.5    3.7 [+ or -] 0.2
418-6 (T)                11.7 [+ or -] 0.4    3.3 [+ or -] 0.2
419-2 (T)                11.7 [+ or -] 0.5    3.6 [+ or -] 0.2
420-5 (N)                11.7 [+ or -] 0.2    3.4 [+ or -] 0.2
421-2 (T)                11.9 [+ or -] 0.4    3.6 [+ or -] 0.3
WT (T)                   11.9 [+ or -] 0.3    3.6 [+ or -] 0.2

Line ([double dagger])          Oleic             Linoleic

398-6 (A)                13.4 [+ or -] 1.9   36.5 [+ or -] 4.5
404-1 (A)                12.2 [+ or -] 0.7   31.7 [+ or -] 3.9
404-7 (A)                13.9 [+ or -] 1.8   32.5 [+ or -] 3.8
404-11 (A)               12.9 [+ or -] 0.7   34.0 [+ or -] 2.1
411-5 (N)                13.8 [+ or -] 1.3   33.9 [+ or -] 4.4
412-2 (T)                14.2 [+ or -] 2.2   37.6 [+ or -] 3.7
412-4 (T)                14.2 [+ or -] 0.9   33.6 [+ or -] 4.4
414-2 (T)                15.4 [+ or -] 1.2   52.8 [+ or -] 3.5
414-3 (T)                15.5 [+ or -] 1.7   39.1 [+ or -] 7.6
414-4 (T)                12.6 [+ or -] 0.8   38.3 [+ or -] 5.1
414-5 (T)                13.2 [+ or -] 0.6   55.5 [+ or -] 3.4
414-9 (T)                13.0 [+ or -] 1.3   37.4 [+ or -] 4.8
418-6 (T)                15.5 [+ or -] 1.8   41.9 [+ or -] 5.0
419-2 (T)                15.7 [+ or -] 3.0   33.4 [+ or -] 8.8
420-5 (N)                13.4 [+ or -] 1.4   31.9 [+ or -] 3.8
421-2 (T)                14.5 [+ or -] 1.6   37.4 [+ or -] 5.1
WT (T)                   18.2 [+ or -] 1.8   55.9 [+ or -] 0.8

Line ([double dagger])          GLA              Linolenic

398-6 (A)                22.9 [+ or -] 5.3    7.6 [+ or -] 0.8
404-1 (A)                31.2 [+ or -] 4.2    5.6 [+ or -] 0.5
404-7 (A)                28.7 [+ or -] 4.3    5.9 [+ or -] 0.7
404-11 (A)               26.6 [+ or -] 1.4    7.1 [+ or -] 0.5
411-5 (N)                25.2 [+ or -] 4.9    7.7 [+ or -] 0.9
412-2 (T)                21.9 [+ or -] 4.6    7.3 [+ or -] 0.9
412-4 (T)                25.6 [+ or -] 5.3    6.9 [+ or -] 1.1
414-2 (T)                 6.1 [+ or -] 3.9    8.9 [+ or -] 0.8
414-3 (T)                19.1 [+ or -] 9.6    8.1 [+ or -] 2.9
414-4 (T)                23.3 [+ or -] 5.6    7.0 [+ or -] 0.7
414-5 (T)                 3.4 [+ or -] 3.4   11.5 [+ or -] 1.0
414-9 (T)                23.7 [+ or -] 5.1    7.3 [+ or -] 0.7
418-6 (T)                18.0 [+ or -] 5.7    7.2 [+ or -] 1.0
419-2 (T)                24.4 [+ or -] 9.5    7.4 [+ or -] 0.9
420-5 (N)                28.0 [+ or -] 4.3    7.4 [+ or -] 0.7
421-2 (T)                23.8 [+ or -] 5.3    6.1 [+ or -] 0.8
WT (T)                      0 [+ or -] 0.0   10.3 [+ or -] 1.2

Line ([double dagger])          STA

398-6 (A)                 3.4 [+ or -] 0.8
404-1 (A)                 3.6 [+ or -] 0.4
404-7 (A)                 3.4 [+ or -] 0.6
404-11 (A)                3.7 [+ or -] 0.6
411-5 (N)                 3.9 [+ or -] 0.6
412-2 (T)                 3.0 [+ or -] 0.6
412-4 (T)                 3.8 [+ or -] 0.6
414-2 (T)                 1.0 [+ or -] 0.5
414-3 (T)                 3.0 [+ or -] 1.2
414-4 (T)                 3.1 [+ or -] 0.7
414-5 (T)                 0.6 [+ or -] 0.6
414-9 (T)                 3.3 [+ or -] 0.7
418-6 (T)                 2.4 [+ or -] 0.7
419-2 (T)                 3.7 [+ or -] 1.6
420-5 (N)                 4.2 [+ or -] 0.6
421-2 (T)                 2.7 [+ or -] 0.7
WT (T)                      0 [+ or -] 0.0

([dagger]) Numbers within the respective fatty acid columns are the
mean percentage of the fatty acid [+ or -] SD. A total of 8 to 15
GLA/STA positive cotyledon chips were used in calculation or the
means. Note: Null recessive [T.sub.1] seed were not used in the
calculations.

([double dagger]) Line designation refers to the respective transgenic
soybean line. WT refers to wild-type seed, genotype Thorne. Letters
following the line designation refer to soybean genotype: A, A3237;
T, Thorne; and N, NE3001.

Table 3. Fatty-acid profiles on [T.sub.2] populations on a subset
of the transgenic soybean lines. GLA, [gamma]-linolenic acid; STA,
stearidonic acid. ([dagger])

Line ([double dagger])        Palmitic            Stearic

398-6 (A)                11.7 [+ or -] 0.4    4.6 [+ or -] 0.3
404-7 (A)                12.5 [+ or -] 0.5    3.4 [+ or -] 0.2
411-5 (N)                11.3 [+ or -] 0.2    4.1 [+ or -] 0.5
414-2 ([section]) (T)    11.6 [+ or -] 0.5    4.0 [+ or -] 0.5
419-2 ([section]) (T)    12.0 [+ or -] 0.4    3.9 [+ or -] 0.2
420-5 ([section]) (N)    12.0 [+ or -] 0.2    4.1 [+ or -] 0.2
WT (T)                   11.9 [+ or -] 0.3    3.6 [+ or -] 0.2

Line ([double dagger])         Oleic              Linoleic

398-6 (A)                11.5 [+ or -] 0.9   37.6 [+ or -] 4.1
404-7 (A)                12.2 [+ or -] 1.5   29.1 [+ or -] 4.9
411-5 (N)                16.0 [+ or -] 1.5   34.5 [+ or -] 2.8
414-2 ([section]) (T)    14.5 [+ or -] 1.7   48.1 [+ or -] 3.5
419-2 ([section]) (T)    13.1 [+ or -] 1.1   42.6 [+ or -] 3.7
420-5 ([section]) (N)    12.9 [+ or -] 0.6   34.1 [+ or -] 1.4
WT (T)                   18.2 [+ or -] 1.8   55.9 [+ or -] 0.8

Line ([double dagger])          GLA              Linolenic

398-6 (A)                24.6 [+ or -] 4.7    6.8 [+ or -] 0.8
404-7 (A)                33.1 [+ or -] 5.2    5.5 [+ or -] 0.8
411-5 (N)                25.1 [+ or -] 3.0    6.0 [+ or -] 0.4
414-2 ([section]) (T)    12.3 [+ or -] 3.2    7.9 [+ or -] 1.0
419-2 ([section]) (T)    19.1 [+ or -] 3.7    6.9 [+ or -] 0.7
420-5 ([section]) (N)    27.7 [+ or -] 1.4    5.8 [+ or -] 0.2
WT (T)                    0.0 [+ or -] 0.0   10.3 [+ or -] 1.2

Line ([double dagger])          STA

398-6 (A)                 3.2 [+ or -] 0.5
404-7 (A)                 4.2 [+ or -] 0.5
411-5 (N)                 3.0 [+ or -] 0.6
414-2 ([section]) (T)     1.6 [+ or -] 0.6
419-2 ([section]) (T)     2.5 [+ or -] 0.5
420-5 ([section]) (N)     3.4 [+ or -] 0.3
WT (T)                    0.0 [+ or -] 0.0

([dagger]) Numbers within the respective fatty acid columns are the
mean [+ or -] SE. A total of 10 to 18 GLA/STA positive cotyledon chips
were assayed per line. Note: Null recessive samples were not included
in the calculation of the means.

([double dagger]) The Line column refers to the transgenic soybean
designations (WT indicates wild type). The letters in parenthesis
indicate soybean genotype: A, A3237; T, Thorne; and N, NE3001.

([section]) Indicates a marker-free population.


ACKNOWLEDGMENTS

Funding for the research was provided by UNL's Center for Biotechnology and the Nebraska Research Initiative. Gratitude is extended to Samantha Link and Melissa Lindemann for greenhouse care of the plants. A special thanks is extended to R.A. Zimmerman for creative inputs to the laboratory.

Abbreviations: GLA, [gamma]-linolenic acid; HS, herbicide sensitive; HT, herbicide tolerant; RT-PCR, reverse transcriptase-polymerase chain reaction; STA, stearidonic acid.

REFERENCES

Barry, G., G. Kishore, S. Padgette, M. Taylor, K. Kolacz, M. Weldon, D. Re, D. Eichholtz, K. Fincher, and L. Hallas. 1992. Inhibitors of amino acid biosynthesis: Strategies for imparting glyphosate tolerance to crop plants, p. 139-145. In B.K. Singh et al. (ed.) Biosynthesis and molecular regulation of amino acids in plants. Am. Soc. of Plant Physiologists, Rockville, MD.

Bevan, M.W., and R.B. Flavell. 1983. A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature 304:184-187.

Buhr, T., S. Sato, F. Ebrahim, A. Xing, Y. Zhou, M. Mathiesen, B. Schweiger, A. Kinney, P. Staswick, and T. Clemente. 2002. Ribozyme termination of RNA transcripts down-regulate seed fatty acid genes in transgenic soybean. Plant J. 30:155-163.

Butte, W., J. Eilers, M. Kirsch. 1982. Trialkylsulfonium-and trialkylselenonium-hydroxides for the pyrolytic alklation of acidic compounds. Anal. Lett. 15(A10):841-50.

Carrington, J.C., and D.D. Freed. 1990. Cap-independent enhancement of translation by a plant potyvirus 5' nontranslated region. J. Virol. 64:1590-1597.

Cerutti, H. 2003. RNA interference: Traveling in the cell and gaining functions? Trends Genet. 19:39-46.

Clemente, T., A. Xing, X. Ye, S. Sato, B. Schweiger, and A. Kinney. 2003. Production of [gamma]-linolenic acid in seeds of transgenic soybean. p. 421-424. In I.K. Vasil (ed.) Plant biotechnology 2002 and beyond. Proc. of the 10th IAPTC&B Congr., Orlando, FL. 23-28 June 2002. Kluwer Academic Publ., Dordrecht, the Netherlands.

Clemente, T.E., B.J. LaValle, A.R. Howe, D.C. Ward, R.J. Rozman, P.E. Hunter, D.L. Broyles, D.S. Kasten, and M.A. Hinchee. 2000. Progeny analysis of glyphosate selected transgenic soybeans derived from Agrobacterium-mediated transformation. Crop Sci. 40:797-803.

Cotsaftis, O., C. Salluad, J.C. Breitler, D. Meynard, R. Greco, A. Pereira, and E. Guiderdoni. 2002. Transposon-mediated generation of T-DNA-and marker-free rice plants expressing a Bt endotoxin. Mol. Breed. 10:165-180.

Dale, E.C., and D.W. Ow. 1991. Gene transfer with subsequent removal of the selection gene from the host genome. Proc. Natl. Acad. Sci. (USA) 88:10558-10562.

Daley, M., V.C. Knauf, K.R. Summerfelt, and J.C. Turner. 1998. Co-transformation with one Agrobacterium tumefaciens strain containing two binary plasmids as a method for producing marker-free transgenic plants. Plant Cell Rep. 17:489-496.

Delannay, X., T.T. Bauman, D.H. Beighley, M.J. Buettner, H.D. Coble, M.S. DeFelice, C.W. Derting, T.J. Diedrick, J.L. Griffin, E.S. Hagood, F.G. Hancock, S.E. Hart, B.J. LaVallee, M.M. Loux, W.E. Lueschen, K.W. Matson, C.K. Moots, E. Murdock, A.D. Nickell, M.D.K. Owen, E.H. Paschal, L.M. Prochaska, P.J. Raymond, D.B. Reynolds, W.K. Rhodes, F.E. Roeth, P.L. Sprankle, L.J. Tarochione, C.N. Tinius, R.H. Walker, L.M. Wax, H.D. Weigelt, and S.R. Padgette. 1995. Yield evaluation of a glyphosate-tolerant soybean line after treatment with glyphosate. Crop Sci. 35:1461-1467.

Ditta, G., S. Stanfield, D. Corbin, and D. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351.

Endo, S., K. Sugita, M. Sakai, H. Tanaka, and H. Ebinuma. 2002. Single-step transformation for generating marker-free transgenic rice using the ipt-type MAT vector system. Plant J. 30:115-122.

Gill, I., and R. Valivety. 1997. Polyunsaturated fatty acids, Part 1: Occurrence, biological activities and applications. Trends Biotechnol. 15:401-409.

Gleave, A.P., D.S. Mitra, S.R. Mudge, and B.A. Morris. 1999. Selectable marker-free transgenic plants without sexual crossing: Transient expression of cre recombinase and use of a conditional lethal dominant gene. Plant Mol. Biol. 40:223-235.

Goffman, F.D, and S. Galletti. 2001. Gamma-linolenic acid and tocopherol contents in the seed oil of 47 accessions from several Rabes species. J. Agric. Food Chem. 49:349-354.

Goldsbrough, A., C. Lastrella, J. Yodel 1993. Transposition mediated re-positioning and subsequent elimination of marker genes from transgenic tomato. Bio/Technology 11:1286-1292.

Griffiths, G., E.Y. Brechany, F.M. Jackson, W.W. Christie, S. Stymne, and A.K. Stobart. 1996. Distribution and biosynthesis of stearidonic acid in leaves of Borago officinalis. Phytochemistry 43:381-386.

Gritz, L., and J. Davies. 1983. Plasmid-encoded hygromycin B resistance: The sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 26:179-188.

Hajdukiewicz, P., Z. Svab, and P. Maliga. 1994. The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25:989-994.

Hood, E.E., G.L. Helmer, R.T. Fraley, and M.-D. Chilton. 1986. The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J. Bacteriol. 168:1291-1301.

Horrobin, D.F. 1990. Gamma linolenic acid: An intermediate in essential fatty acid metabolism with potential as an ethical pharmaceutical and as a food. Rev. Contemp. Pharmacother. 1:1-45.

Knutzon, D.S., and V. Knauf. 1998. Manipulating seed oils for polyunsaturated fatty acid content, p. 287-304. In J. Harwood (ed.) Plant lipid biosynthesis: Fundamentals and agricultural applications. Cambridge Univ. Press, Cambridge.

Komari, T., Y. Hiei, Y. Saito, N. Mural, and T. Kumashiro. 1996. Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J. 10: 165-174.

Kris-Etherton, P.P., S.R. Daniels, R.H. Eckel, M. Engler, B.V. Howard, R.M. Krauss, A.H. Lichtenstein, F. Sacks, S. St. Jeor, and M. Stampfer. 2001. AHA scientific statement: Summary of the scientific conference on dietary fatty acids and cardiovascular health. J. Nutr. 131:1322-1326.

Liu, J.-W., S. DeMichele, M. Bergana, E. Bobik, Jr., C. Hastilow, L.-T. Chuang, P. Mukerji, and Y.-S. Huang. 2001. Characterization of oil exhibiting high [gamma]-linolenic acid from a genetically transformed canola strain. J. Am. Oil Chem. Soc. 78:489-493.

Lu, H., X. Zhou, and N. Upadhyaya. 2001. Generation of selectable marker-free transgenic rice using a double right-border (DRB) binary vectors. Aust. J. Plant Physiol. 28:241-248.

McKnight, T.D., M.T. Lillis, and R.B. Simpson. 1987. Segregation of genes transferred to one plant cell from two separate Agrobacterium strains. Plant Mol. Biol. 8:439-445.

Miller, M., L. Tagliani, N. Wang, B. Berka, D. Bidney, and Z.Y. Zhao. 2002. High efficiency transgene segregation in co-transformed maize plants using Agrobacterium tumefaciens 2 T-DNA binary system. Transgenic Res. 11:381-396.

Sayanova, O., G.M. Davies, M.A. Smith, G. Griffiths, A.K. Stobart, P.R. Shewry, and J.A. Napier. 1999. Accumulation of [[DELTA].sup.6]-unsaturated fatty acids in transgenic tobacco plants expressing a [[DELTA].sup.6]-desaturase from Borago officinalis. J. Exp. Bot. 50:1647-1652.

Sayanova, O., M.A. Smith, P. Lapinskas, A.K. Stobart, G. Dobson, W.W. Christie, P.R. Shewry, and J.A. Napier. 1997. Expression of a borage desaturase cDNA containing an N-terminal cytochrome [b.sub.5] domain results in the accumulation of high levels of [[DELTA].sup.6]-desaturated fatty acids in transgenic tobacco. Proc. Natl. Acad. Sci. USA 94:4211-4216.

Thompson, C.J., N.R. Movva, R. Tizard, R. Crameri, J.E. Davies, M. Lauwereys, and J. Botterman. 1987. Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. EMBO J. 6:2519-2523.

Vance, V., and H. Vaucheret. 2001. RNA silencing in plants-defense and counterdefense. Science (Washington, DC) 292:2277-2280.

Xing, A., Z. Zhang, S. Sato, P. Staswick, and T. Clemente. 2000. The use of the two T-DNA binary system to derive marker free transgenic soybean. In Vitro Cell. Dev. Biol. 36:456-463.

Zhang, Z., A. Xing, P. Staswick, and T. Clemente. 1999. The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell Tiss. Org. Cult. 56:37-46.

Zuo, J., Q.W. Niu, S.G. Moller, and N.-H. Chua. 2001. Chemical-regulated, site-specific DNA excision in transgenic plants. Nature Biotech. 19:157-161.

Shirley Sato, (2) Aiqiu Xing, (2) Xingguo Ye, Bruce Schweiger, Anthony Kinney, George Graef, and Tom Clemente *

S. Sato, Center for Biotechnology, and T. Clemente, Plant Science Initiative, Univ. of Nebraska, Lincoln, NE 68588; A. Xing, Stine-Haskell Research Center, DuPont Agricultural Products, Newark, DE 19714; X. Ye and G. Graef, Dep. of Agronomy and Horticulture, Univ. of Nebraska, Lincoln, NE 68583; B. Schweiger and A. Kinney, DuPont Exp. Stn., Wilmington, DE 19880. This publication is a contribution of the University of Nebraska Agricultural Research Division, Lincoln, NE, Journal Series No. 14166. Received 26 May 2003. * Corresponding author (tclemente1@unl.edu).

(1) Note: A preliminary report of this research has previously been published. See Clemente et al. (2003).

(2) These authors contributed equally to this work.
COPYRIGHT 2004 Crop Science Society of America
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Genomics, Molecular Genetics & Biotechnology
Author:Sato, Shirley; Xing, Aiqiu; Ye, Xingguo; Schweiger, Bruce; Kinney, Anthony; Graef, George; Clemente,
Publication:Crop Science
Date:Mar 1, 2004
Words:6247
Previous Article:Introgression in common bean x tepary bean interspecific congruity-backcross lines as measured by AFLP markers.
Next Article:Molecular diversity of a germplasm collection of squash (Cucurbita moschata) determined by SRAP and AFLP markers.

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters