Printer Friendly

Prion protein genotypes in Pakistani goats.

ABSTRACT : The PCR-amplified prion protein (PrP) gene was sequenced to determine the frequency of scrapie-associated as well as novel PrP genotypes in 72 healthy goats representing five breeds. A total of six genotypes were detected, resulting from the three reported 143 (H/R), 154 (R/H) and 240 (S/P) and the two novel 39 (S/R) and 185 (I/F) amino acid polymorphisms. Of the four silent mutations 42 (ag), 138 (c [right arrow] t), 231 (c [right arrow] a) and 237 (g [right arrow] c) detected in this study, 237 (g [right arrow] c) is novel. A genotype (SIP/RFP) harboring three amino acid polymorphisms 39 (S/R), 185 (I/F) and 240 (S/P) was found in few goats. Although both scrapie-associated genotypes with 143 (H/R) and 154 (R/H) polymorphisms and others with 39 (S/R), 185 (I/F) and 240 (S/P) polymorphisms were present in the studied Pakistani goats, their frequency was lower than that of the wild-type genotype SHRIS/SHRIS (34.7%). These results emphasize the need for further sequencing of the PrP gene in a large number of goats representing the five studied breeds, so that overall PrP variability can be assessed in these breeds in research addressing future concerns about scrapie. (Key Words : Prion Protein Genotypes, Scrapie, Goats, Pakistan)

INTRODUCTION

Prions are lethal mammalian pathogens composed of aggregated conformational isomers ([PrP.sup.Sc]) of a host-encoded normal 33-35 kDa glycoprotein ([PrP.sup.C]) and are believed to be the sole causative agents of Transmissible Spongiform Encephalopathies (TSEs) (Prusiner, 2004; Collinge and Clark, 2007). TSEs are a group of fatal neurodegenerative diseases, which include scrapie in sheep and goats, chronic wasting disease in elk and deer, transmissible mink encephalopathy (TME) and Creutzfeldt-Jakob Disease (CJD) in humans. Among TSEs, scrapie in sheep and goats is clinically diagnosed by behavioral changes, hypersensitivity to touch, ataxia of hind limbs, head tremor, teeth grinding, chronic wasting (loss of weight), pruritus, wool loss, lack of co-ordination and, at a later stage, paralysis and death (Hurtado et al., 2002; http://www.neurocenter-bern.ch/scrapie_e.shtml). However, the confirmed diagnosis of scrapie can only be made after performing immunohistochemistry and histopathology of CNS and lymphoid tissue of infected animals, which identifies in these tissues the PrPSc accumulation and spongiform lesions generated by a wide-spread vacuolisation of the neuropil (Prusiner, 1998; Vaccari et al., 2006).

The natural incidence of scrapie varies among animals indicating that the genotype of the host plays a role in modulating susceptibility to the disease (8). In sheep, genotypes based on the amino acid polymorphisms in codons 136 (A/V), 154 (R/H) and 171 (Q/R or H) of the prion protein (PrP) gene are associated with scrapie susceptibility. ARR/ARR is the most scrapie-resistant genotype; while VRQ/VRQ is the most scrapie-susceptible genotype (Baylis and Goldmann, 2004). In goats, the PrP genotypes based on the amino acid polymorphisms in codons 142 (I/M), 143 (H/R), 154 (R/H) and 222 (Q/K) are associated with scrapie susceptibility (Goldmannn et al., 1996; Billinis et al., 2002; Vaccari et al., 2006). In addition to scrapie-associated polymorphisms 142 (I/M), 143 (H/R), 154 (R/H) and 222 (Q/K), the following PrP polymorphisms have been reported for goats: 21 (V/A), 23 (L/P), 37 (G/V), 49 (G/S), 102 (W/G), 110 (T/N) or 110 (T/P), 127 (G/S), 133 (L/Q), 137 (M/I), 146 (N/S) or 146 (N/D), 151 (R/H), 168 (P/Q), 211 (R/Q), 218 (I/L), 220 (Q/H), 222 (Q/K) and 240 (S/P) (Goldmannn et al., 1996; Goldmannn et al., 1998; Wopfner et al., 1999; Agrimi et al., 2003; Billinis et al., 2002; Goldmannn et al., 2004; Zhang et al., 2004; Kurosaki et al., 2005; Acutis et al., 2006; Papasavva-Stylianou et al., 2007). Some silent mutations of the PrP gene in goats have also been reported: 42 (a [right arrow] g), 107 (g [right arrow] a), 138 (c [right arrow] t), 179 (g [right arrow] t), 181 (c [right arrow] t), 202 (c [right arrow] t), 207 (g [right arrow] a), 219 (c [right arrow] t) and 231 (a [right arrow] c) (Goldmannn et al., 1996; Billinis et al., 2002; Zhang et al., 2004; Acutis et al., 2006; Vaccari et al., 2006; Papasavva-Stylianou et al., 2007).

Pakistan has more than 50 million each of sheep and goats. These sheep and goats serve the Pakistani nation in terms of meat, milk and wool and add to the annual income of the poor community of farmers (GOP, 2006). Despite having a huge population, studies regarding genetic resistance to scrapie remain to be undertaken in Pakistani goats and sheep. So, the present study was conducted to determine scrapie-resistance in five goat breeds of Punjab, Pakistan.

MATERIALS AND METHODS

Animal source and sample collection

A total of 207 healthy goats representing five breeds: Pak-Angora (PA), Dera Din Panah (DDP), Teddy (T), Naachi (N) and Beetal (B) were sampled for blood collection. Forty nine blood samples were collected from PA, 46 from DDP, 56 from T, 36 from N and 20 from B. Most of the sampling was done on Government Livestock Farms set up in the Punjab province of Pakistan i.e. Government Livestock Experiment Station (LES) Kherawala, Layyah; Livestock Production Research Institute (LPRI) Bahadarnagar, Okara; Barani Livestock Production Research Institute (BLPRI) Kherimurat, Attock; Livestock Experiment Station (LES) Rakh Ghulaman, Bakkar and Government Livestock Farm Chak Katora, Hasilpur. Earlier these farms purchased purebred goats (except Pak-Angora) from a large number of villages to expand the genetic base of their existing breeds. Information regarding morphological and production parameters of the five selected breeds is given in Table 1. A few animals from these breeds were also sampled from village flocks. A 10 ml blood sample was taken from the jugular vein of each goat into a vacutainer, containing 100 [micro]l of 0.5 M (pH 8.0) EDTA, and immediately transferred to an icebox and stored at -20[degrees]C until further processing.

Number of animals selected per breed for sequencing

The PrP sequencing of 72 animals was done after analyzing genotyping results for the PrP codons 136 and 154 in four of the five PA, DDP, T, N and B breeds, which resulted in only one goat of the T breed being polymorphic for PrP codon 154 (R/H). Fourteen goats were selected from PA for sequencing of the PrP gene, 14 from DDP, 16 (with inclusion of the PrP polymorphic goat) from T, 14 from N and 14 from B breed that was not PrP genotyped. The purpose of sequencing was to determine PrP variability, additional to the amino acid polymorphism 154 (R/H).

PCR and sequencing

Extraction of genomic DNA was performed using frozen peripheral whole blood, according to the protocol of Grimberg et al. (1989). The PCR amplification of 876 bp containing the entire coding region in exon 3 of the PrP gene (GeneBank accession no, DQ346682) was carried out using forward (5'-1CTTTAAGTGATTTTTACGTGG21-3') and reverse (5'-854TGGCAAAGATTAAGAA GATA ATG876-3') primers. The PCR amplification reactions contained 50 ng genomic DNA, 10 mM Tris/HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 [micro]M dNTPs, 10 pM each primer and 1.5 units Ampli Taq Gold (Applied Biosystems, Foster City, CA) in a reaction volume of 25 [micro]l. Thermal conditions of the PCR program were set as initial denaturation at 94[degrees]C for 4 min, followed by 35 cycles of denaturation at 94[degrees]C for 45 s, annealing at 54[degrees]C for 45 s and extension at 72[degrees]C for 1 min. Then a 10 min final extension program was set at 72[degrees]C. The PCR products were purified by Exo SAP-IT (Amersham) according to the manufacturer's instructions and were used in the sequencing reactions. In addition to the above-mentioned primer pair, PrP7-U (5'-369AGCAGTGGTAGGGGGCC TTGGT391-3') and PrP-L2 (5'-430TTTGGCTTACTG GGCTTG TTCC451-3') primers were used in sequencing PCR reactions for bidirectional sequencing of the entire coding region of the PrP gene. The amplified products of sequencing PCR were washed with 70% ethanol and resolved on an ABI 3130 capillary DNA analyzer (Applied Biosystems, Inc., Foster City, CA). The results were analyzed using the Chromas Lite (2.01) software.

RESULTS

Pakistani goats revealed a single amino acid polymorphism (R/H) for the PrP codon 154 in only one T goat amongst 187 goats belonging to 4 different breeds (PA, DDP, T and N). The remaining 186 goats were monomorphic for the both RFLP (Restriction fragment length polymorphism)-analyzed PrP codons 136 and 154. After finding this low frequency of polymorphism, sequence analysis of the PrP gene was carried out to discover more polymorphism in this gene. The PrP sequence analysis in 72 goats, including 14 goats from each of the PA, DDP, N and B (a new breed) and 16 from the T breed, identified 4 more amino acid polymorphisms 39 (S/R), 143 (H/R), 185 (I/F) and 240 (S/P) in addition to 154 (R/H). The sequence analysis also identified 4 silent mutations 42 (a [right arrow] g; P/P), 138 (c [right arrow] t; S/S), 231 (c [right arrow] a; R/R) and 237 (g [right arrow] c; L/L) and an intronic nucleotide polymorphism on 38 nucleotide upstream (-38 (c [right arrow] t)) of the first PrP codon. Among these, two 39 (S/R) and 185 (I/F) Babar et al. (2008) Asian-Aust. J. Anim. Sci. 21(7):936-940 amino acid polymorphisms and a 237 (g [right arrow] c; L/L) silent mutation and -38 (c [right arrow] t) nucleotide polymorphism are novel to the best of our knowledge.

The five detected amino acid polymorphisms comprised 6 genotypes amongst which the wild-type genotype SHRIS/SHRIS was the most common (34.7%), followed by the genotype SHRIS/SHRIP (26.4%). Only 240 (S/P) polymorphism-harboring genotypes were present in all studied breeds with the exception of the wild-type genotype. The breeds T and B were the most PrP variable in terms of genotypes. N and B had a genotype SHRIP/RHRFP containing 3 polymorphisms (Table 2).

The silent mutations 42 (a [right arrow] g) and 138 (c [right arrow] t) were linked with 240 (S/P) dimorphism: 42a and 138c were linked with S240, while 42g and 138t were linked with P240. Although 138t was found to be linked with P240 in most of the PrP sequences, it was also detected in genotypes with S240 monomorphism. Other silent mutations 231 (c [right arrow] a) and 237 (g [right arrow] c) and an intronic nucleotide polymorphism -38 (c [right arrow] t) were present only in homozygous pattern i.e. 231 (a/a).

DISCUSSION

Although scrapie is currently an incurable disease, genetic resistance of sheep and goats to this disease can be increased through selection of resistant PrP genotypes to avoid scrapie incidence. We performed sequence analysis of the PrP gene to assess the presence of scrapie-associated and other genotypes in 72 goats from five breeds. A total of 6 genotypes were detected amongst which the wild-type genotype SHRIS/SHRIS was the most common (34.7%) (Table 2), indicating that the studied goat breeds harbor low genetic variability at the PrP locus.

Two genotypes (SHRIS/[SHH.sup.154]IS and SHRIS/ [SR.sup.143]RIS) carrying amino acid polymorphisms, which are reported to be associated with scrapie resistance (Billinis et al., 2002), were present in some goats. The SHRIS/ [SR.sup.143]RIS genotype was present in 3 (PA, T and B) out of the five breeds; while the SHRIS/[SHH.sup.154]IS genotype was detected in only one T goat, confirming the genotyping results which represented the same single goat as polymorphic for the PrP codon 154 (R/H). The other genotypes carrying 142 (I/M), 146 (N/S), 146 (N/D) and 222 (Q/K) polymorphisms, which have also been shown to be associated with scrapie resistance (Goldmannn et al., 1996; Acutis et al., 2006; Vaccari et al., 2006), were not detected in the present study. These results indicate that the studied goats are susceptible to contracting scrapie under conditions of inadvertent exposure to prions.

After the wild-type SHRIS/SHRIS, the more prevalent genotypes were SHRIS/SHRIP and SHRIS/SHRIP harboring 240 (S/P) polymorphism. Two contradictory statements about 240 (S/P) association with scrapie susceptibility have been documented: Goldmann et al. (1996) and Billinis et al. (2002) proposed that 240 (S/P) has no association with the disease due to its possible elimination during post-translational processing of the PrP protein; whereas Acutis et al. (18) favored the role of 240 (S/P) in scrapie susceptibility modulation through its interference at the mRNA level.

The genotype SHRIP/RHRFP harbors two novel 39 (S/R) and 185 (I/F) polymorphisms which may be specific for the Pakistani goats. These polymorphisms add to the existing pool of PrP variability, and the experimental inoculation of prions in goats with SHRIP/RHRFP genotype may help determine their role, if any, in scrapie susceptibility.

In accordance with previous studies (Goldmannn et al., 1996; Kurosaki et al., 2005; Acutis et al., 2006) 42 (a [right arrow] g) and 138 (c [right arrow] t) silent mutations were detected linked with 240 (S/P) dimorphism in most of the goats carrying SHRIS/SHRIP and SHRIS/SHRIP genotypes: 42a and 138c were linked with S240, whereas 42g and 138t were linked with P240. In contrast, genotypes carrying 138 (c [right arrow] t) mutations with 240 (S/S) monomorphism were also detected in some goats in this study, indicating that 138 (c [right arrow] t) occurred independent of 240 (S/P).

In brief, the present study provides information about scrapie resistance in the five goat breeds of Pakistan and suggests that further studies regarding the PrP variability in Pakistani goats should be undertaken to obtain true estimates of the frequency of scrapie-associated and novel genotypes in these breeds.

ACKNOWLEDGMENTS

We are thankful to Dr. Nawaz Saeed, Ex. Director Livestock Farms, Punjab, for giving permission to use the blood of the animals present at the Government Livestock Farms, Dr. Manzoor Ahmad, Ex. Vice Chancellor and Dr. Khushi Muhammad Department of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan, for their cooperation during this project.

Received August 27, 2007; Accepted February 27, 2008

REFERENCES

Acutis, P. L., A. Bossers, J. Priem, M. V. S. Riina, Peletto, M. Mazza, C. Casalone, G. Forloni, G. Ru and M. Caramelli. 2006. Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks. J. Gen. Virol. 87:1029-1033.

Agrimi, U., M. Conte, L. Morelli, M. A. Di Bari, G. Di Guardo, C. Ligios, G. Antonucci, G. M. Aufiero, N. Pozzato, F. Mutinelli, R. Nonno and G. Vaccari. 2003. Animal transmissible spongiform encephalopathies and genetics. Vet. Res. Commun. 27(Suppl. 1):31-38.

Baylis, M. and W. Goldmann. 2004. The genetics of scrapie in sheep and goats. Curr. Mol. Med. 4:385-396.

Billinis, C., C. H. Panagiotidis, V. Psychas, S. Argyroudis, A. Nicolaou, S. Leontides, O. Papadopoulos and T. Sklaviadis. 2002. Prion protein gene polymorphisms in natural goat scrapie. J. Gen. Virol. 83:713-721.

Collinge, J. A. R. 2007. A general model of prion strains and their pathogenicity. Sci. 318:930-936.

Goldmannn, W., A. Chong, J. Foster, J. Hope and N. Hunter. 1998. The shortest known prion protein gene allele occurs in goats, has only three octapeptide repeats and is non-pathogenic. J. Gen. Virol. 79:3173-3176.

Goldmannn, W., T. Martin, J. Foster, S. Hughes, G. Smith, K. Hughes, M. Dawson and N. Hunter. 1996. Novel polymorphisms in the caprine PrP gene: a codon 142 mutation associated with scrapie incubation period. J. Gen. Virol. 77: 2885-2891.

Goldmannn, W., M. Perucchini, A. Smith and N. Hunter. 2004. Genetic variability of the PrP gene in a goat herd in the UK. Vet. Rec. 155:177-178.

Govt of Pakistan, Economic survey of Pakistan, 2006.

Grimberg, J., S. Nawoschik, L. Belluscio, R. Mckee, A. Turk and A. Eiswenberg. 1989. A simple and efficient non-organic procedure for the isolation of genomic DNA from blood. Nucl. Acids Res. 17(16):8390.

Hurtado, A., A. L. Garc?a-P?rez, B. de Heredia, J. Barandika, A. Sanz-Parra, E. Berriatua and R. A Juste. 2002. Genetic susceptibility to scrapie in a population of Latsa breed sheep in the Basque country, Spain. Small Rumin. Res. 45:255-259.

Kurosaki, Y., N. Ishiguro, M. Horiuchi and M. Shinagawa. 2005. Polymorphisms of caprine PrP gene detected in Japan. J. Vet. Med. Sci. 67:321-323.

Papasavva-Stylianou, P., M. Kleanthous, P. Toumazos, P. Mavrikiou and P. Loucaides. 2007. Novel polymorphisms at codons 146 and 151 in the prion protein gene of Cyprus goats, and their association with natural scrapie. Vet. J. 173(2):459-462.

Prusiner, S. B. 2004. Prion biology and diseases. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Prusiner, S. B. 1998. Prions. Proc. Natl. Acad. Sci. USA. 95: 13363-13383.

Vaccari, G., M. A. Di Bari, L. Morelli, R. Nonno, B. Chiappini, G. Antonucci, S. Marcon, E. Esposito, P. Fazzi, N. Palazzini, P. Troiano, A. Petrella, G. Di Guardo and U. Agrimi. 2006. Identification of an allelic variant of the goat PrP gene associated with resistance to scrapie. J. Gen. Virol. 87(Pt 5): 1395-1402.

Wopfner, F., G. Weidenho, R. Schneider, A. von Brunn, S. Gilch, T. F. Schwarz, T. Werner and H. M. Schatzl. 1999. Analysis of 27 mammalian and 9 avian PrPs reveals high conservation of flexible regions of the prion protein. J. Mol. Biol. 289:1163-1178.

Zhang, L., N. Li, B. Fan, M. Fang and W. Xu. 2004. PRNP polymorphisms in Chinese ovine, caprine and bovine breeds. Anim. Genet. 35:457-461.

M. E. Babar *, M. Nawaz, A. Nasim (1), M. Abdullah, M. Imran, R. Jabeen S. A. Chatha, A. U. Haq, A. Nawaz, H. Mustafa and A. Nadeem

University of Veterinary and Animal Sciences, Lahore, Pakistan

(1) COMSTECH, Islamabad, Pakistan.

* Corresponding Author: Masroor Ellahi Babar. Tel: +92-42-9213653, Fax: +92-42-7117483, E-mail: drbabar@hotmail.com
Table 1. General description and morphological parameters of studied
goat breeds

 Average body
Breed Type Color Size weight (kg)

Dera Din Milk/meat Black Large 45-50
 Panah

Teddy Meat Cremy-white, Small 25-30
 brown black or
 patched with
 these colors

Nachi Milk/meat Black but Medium- 40-50
 black and large
 white spotted
 too

Beetal Milk/meat Golden Large 45-55

Pak-angora Wool/meat White - -

 Average wool
Breed yield/annum General description

Dera Din 1.5 kg/head Large head, Roman nose, hair on the
 Panah chin; long broad ears; cartilaginous
 appendages on sides of neck, long and
 thick spiraled horns; hairy body, tail
 medium covered with rough hair; udder
 and teats well-developed, milk yield 160
 liters in a 150 days lactation period; twin
 births common

Teddy Generally Compact body, small droopy ears,
 slightly prominent nose, horns may have
 spirals, both horned and polled
 specimens found; bucks often have
 beards; udder moderately developed,
 short conical teats, 65 liters milk in 130
 days; twin and triplet occur at about 50
 and 15%; early maturity and high
 prolificacy

Nachi 0.6 kg/head Medium head, Roman nose, small and
 thin horns, medium ears; udder well-
 developed, 150 liters milk in 100 days
 twin births common, dancing gait is a
 specific feature of this breed b/c of which
 it is so named

Beetal Smooth Massive head, Roman nose, long broad
 and pendulous ears; spiraled horns,
 longer in males; long stout legs; short
 tail; udder well-developed and long teats,
 milk yield 190 liters in a 150 days
 lactation; more than 50% twin or triplet
 births

Pak-angora 3 kg/head Pak Angora breed is kept at the
 Government Livestock Experiment
 Station Kherawala (Layyah). It is a
 composite of Angora and hair goat
 breeds and it produces soft Mohair.
 Adult males weigh on average 47 kg and
 females 27 kg with an average wither
 height of 75 cm and 65 cm respectively.
 The breed is reported to be heat tolerant
 and to have an unspecified disease
 resistance. This breed is raised
 exclusively on a few government farms
 and has not been propagated. Of females,
 100% are bred to males of the same
 breed.

Table 2. Percentage frequencies of genotypes in five goat breeds

 Number of genotypes/goat breed (% age
 frequency of genotype)

Genotype
 PA DDP T

(1)[S.sup.39][H.sup.143][R.sup.154]
[I.sup.185][S.sup.240]/SHRIS 2(14.3) 7(50) 7(43.8)
SHRIS/SHHIS - - 1(6.2)
SHRIS/SRRIS 6(42.8) - 2(12.5)
SHRIS/SHRIP 4(28.6) 4(28.6) 5(31.3)
SHRIP/SHRIP 2(14.3) 3(21.4) 1(6.2)
SHRIP/RHRFP - - -
Total 14 14 16

 Number of genotypes/goat
 breed (% age frequency
 of genotype)

 N B

(1)[S.sup.39][H.sup.143][R.sup.154]
[I.sup.185][S.sup.240]/SHRIS 2(14.2) 7(50)
SHRIS/SHHIS - -
SHRIS/SRRIS - 1(7.1)
SHRIS/SHRIP 4(28.6) 2(14.3)
SHRIP/SHRIP 4(28.6) 1(7.1)
SHRIP/RHRFP 4(28.6) 3(21.5)
Total 14 14

 Total number Overall % age
 of genotypes frequency
 goats

(1)[S.sup.39][H.sup.143][R.sup.154]
[I.sup.185][S.sup.240]/SHRIS 25 34.7
SHRIS/SHHIS 1 1.4
SHRIS/SRRIS 9 12.5
SHRIS/SHRIP 19 26.4
SHRIP/SHRIP 11 15.3
SHRIP/RHRFP 7 9.7
Total 72 100

(1) Superscripts over single-letter representing amino acids refer
to amino acid polymorphism/codon position.
COPYRIGHT 2008 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Babar, M.E.; Nawaz, M.; Nasim, A.; Abdullah, M.; Imran, M.; Jabeen, R.; Chatha, S.A.; Haq, A.U.; Naw
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:9PAKI
Date:Jul 1, 2008
Words:3581
Previous Article:Association of SNP haplotypes at the myostatin gene with muscular hypertrophy in sheep.
Next Article:Single-minded 1 gene mapping and its variants association with growth, carcass composition and meat quality traits in the pig.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters