Printer Friendly

Preventive and protective effects of silymarin on doxorubicin-induced testicular damages correlate with changes in c-myc gene expression.

ABSTRACT

This study aimed to investigate the preventive and protective effects of silymarin (SMN) on doxorubicin (DOX)-induced damages in the testis. Wistar rats were divided into six groups (n = 8), including: control (C), DOX-treated (DOX, 15 mg/kg, i.p.), DOX- and SMN-treated and SMN-treated animals (SMN, 50 mg/kg, orally). Those groups, which received either compounds, were sub-grouped based on the preventive (PVT), protective (PIT) and/or therapeutic regimens (TPT) of SMN administration. The antioxidant status analyses, hormonal assay, and histopathological examinations in the testis were conducted. The expression of c-myc at mRNA level also was analyzed. SMN in preventive and protective forms significantly (p <0.05) improved the DOX-induced weight loss and lowered the alkaline phosphatase level. Pretreatment and co-treatment with SMN attenuated the DOX-induced carbonyl stress. The DOX-induced histopathological damages including negative TDI and IR were significantly (p <0.05) improved with SMN pretreatment and co-administration. SMN in preventive and protective forms prevented from DOX-induced DNA fragmentation in the testis. SMN ameliorated the DOX-reduced serum level of sexual hormones including testosterone, inhibin B, LH and FSH in PVT and PTT groups. The c-myc expression at mRNA level was completely and relatively down regulated in the testis of animals that received SMN as pretreatment and concurrent administration, respectively. Our data suggests that the DOX-induced biochemical and histopathological alterations could be prevented and/or protected by SMN. Moreover, the SMN protective and preventive effects attribute to its capacity in the reduction of DOX-induced carbonyl stress and DNA damage, which may be mediated by c-myc expression.

[c] 2012 Elsevier GmbH. All rights reserved.

ARTICLE INFO

Keywords: Carbonyl stress c-myc expression DNA fragmentation Doxorubicin Silymarin Testis

Introduction

Doxorubicin (DOX) as an anthracycline is one of the widely used antineoplastic agents against tumors such as Hodgkin disease, childhood leukemia and testicular cancer. There are few mechanisms of action for DOX anticancer effect including: the blockage in the G2 phase of cell cycle, inhibition of the activity of DNA and RNA polymerase and DNA-topoisomerase II, interfering with the DNA methyl-transferase 1 and ultimately inducing apoptosis (Yokochi and Robertson, 2004). A perfect chemotherapeutic agent must have a selective potency to destroy the tumor cells with no or minimum toxicity to other cells. However such an ideal compound hitherto has not yet been introduced. Although DOX has been recognized as a potent and effective anticancer compound, however there are plenty of reports indicating its toxicity against the heart, liver and testis, which hampers its clinical use (Damani et al., 2002).

There are many mechanisms of toxicity caused by DOX in mammalian tissues and among them the increase of free radical formation and oxidative stress seems to be plausible. It has been reported that one-electron redox cycling of anthracyclins resulted in an increase in intracellular level of [H.sub.2][0.sub.2] and the generation of further active free radical species (Srdjenovic et al., 2010). At the same time there is an increasing number of studies offering a combinational therapy with chemotherapeutic compounds to reduce their toxic effects. For example co-administration of captoperil to reduce the DOX-induced nephrotoxicity and amifostine to attenuate the DOX-induced cytotoxicity in the semniferous epithelial have been demonstrated (Mansour et al., 1999; Vendramini et al., 2010)

Silymarin (SMN) is a flavonoids complex extracted from seeds of the milk thistle (Silybum marianum). Silibinin (SBN) is the major active substituent of silymarin. Despite of SMN traditional usage as a hepatoprotective compound, in current medicine it is used successfully as a modern remedy for the liver disorders and also as anticancer and anti-inflammatory agent (Mata-Santos et al., 2010). Silymarin not only acts as a potent antioxidant compound by reacting with the reactive oxygen species (ROS), but also potentiates the effects of the physiological antioxidants such as glutathione and superoxide dismutase (El-Shitany et al., 2008; Nencini et al., 2007). Recently published preclinical reports indicate that SMN increased the uptake and provoked the action of chemotherapeutic chemicals of daunomycin and doxorubicin, respectively. Moreover, SMN inhibited the efflux of anticancer drugs from the cancer cells (Colombo et al., 2011). Previous reports have also shown the protective effect of SMN on DOX-induced cardio- and hepato-toxicity in rat (Raskovic et al., 2011).

c-myc is the nuclear proto-oncogene and encodes a transcription factor, which acts in cellular proliferation, differentiation, apoptosis and tumorgenesis (GrassiIli et al., 2004). c-myc has dual capacity as it is involved in cellular apoptosis and also triggers cell proliferation. The over-expression or deregulation of c-myc has been reported in response to various factors such as hypoxia, DNA damage, glucose deprivation and anticancer agents (Sears and Nevins, 2002).

Since DOX is used widely in oncology protocols against malignancies such as testicular cancer and increasing concerns have been raised about the DOX-induced long and short term male infertility, therefore we aimed to highlight primarily the DOX-induced histopathological damages and biochemical alterations in the testicular tissues and secondly to investigate the preventive, protective and therapeutic effects of SMN on DOX-induced histopathological, biochemical and molecular changes in the testis. Moreover, various studies reported the role of c-myc in DOX-induced impact on different tissues and cell culture models: hence the effect of SMN on the c-myc expression at mRNA level in the testis was also investigated.

Materials and methods

Chemicals

SMN standard (S 0292, containing 80% silibin), guanidine hydrochloride, and 5,5'-dithiobis-2-nitrobenzoic acid (DTNB), were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Thio-barbituric acid, phosphoric acid (85%), trichloroacetic acid (TCA), dimethyl sulfoxide (DMSO) and ethanol were obtained from Merck (Germany). N-butanol was obtained from Carl Roth, GmbH Co. (Germany). TRI reagent was purchased from Applied Biosystems, by Life Technologies (Nieuwerkerk, The Netherlands). Commercially available standard kit was used for the determination of alkaline phosphatase (ALP, 744, Man Inc., Tehran, Iran). All other chemicals were commercial products of analytical grade.

Animals and experimental design

Forty eight adult male Wistar rats (200-220g) were obtained from the animal resource of the Faculty of Veterinary Medicine, Urmia University. The rats were in good health conditions. The animals were acclimatized for one week and had free access to food and water. The experimental protocols were approved by the ethical committee of Urmia University in accordance with principles of laboratory animal care. Animals were assigned into control and test groups (n = 8). Animals in the test group were subdivided to following groups:

A DOX group; animals in this group received DOX (15 ml/kg, b.w., interaperitoneally).

B SMN-pretreatment group (nominated as preventive group, PVT); animals in this group received SMN (50 mg/kg/day) one week prior the DOX (15 mg/kg) administration.

C SMN and DOX concurrently received group (nominated as protective group, PTT); animals in this group received SMN (50 mg/kg/day) and DOX (15 mg/kg) concurrently.

D SMN therapeutic group (nominated as therapeutic group, TPT); animals in this group received SMN (50 mg/kg/day) 3 weeks after DOX (15 mg/kg) administration.

E SMN group; rats in this group received only 50 mg/kg SMN for 4 weeks.

The control group received only normal saline (0.9%, 5 ml/kg) containing the same amount of the test compound solvent during the experiment. All test groups received SMN and DOX for 4 weeks.

Before the experimental procedures, all animals were weighed individually and this procedure was repeated at the end of the study to evaluate any treatment-related changes in body weight gain.

Serum preparation and tissue samples collection

On day after the last test compound administration, blood samples were obtained by cardiac puncture under light anesthesia, which was provided by using diethyl ether. After 1 h at room temperature, the samples were centrifuged at 3000 x g for 10 min to obtain the serum. The serum samples were then stored at -20[degrees] until further analysis.

The anesthetized animals were ultimately euthanized by using [CO.sub.2] gas. The testis specimen were immediately removed and rinsed with chilled normal saline. One of the testis samples from each individual rat was snap frozen in liquid nitrogen and kept in -70[degrees]C until further biochemical analyses and another testis were fixed in Bouin's solution for histopathological examinations.

Determination of the serum level of alkaline phosphates (ALP)

The serum level of ALP was measured using commercially available standard kit according to manufacturer's instructions.

Protein carbonylation assay

To determine the carbonyl content of the tissue homogenates, the reaction between 2,4-dinitrophenylhydrazine (DNPH) and protein carbonyls was measured (Levine et al., 1994). Briefly, 0.2-0.3 g of the samples were homogenized in ice-cooled phosphate buffer (50 mM, pH 6.7 and containing 1 mM EDTA), and then the mixture was centrifuged at 10,000 x g for 10 min at 4C. For each individual sample (0.2 ml supernatant), a test (T) and a control samples (C) were prepared and then 0.8 ml of DNPH arid 2 M HCI solution were added to the test and control samples, respectively. The samples were kept in dark at room temperature for 1 h, with vortex mixing for every 15 min. Thereafter, 0.5 ml trichloroacetic acid (30%) were added in each sample and vortex mixed for 30s. All samples were centrifuged at 10,000 x g for 3 min, the supernatant was discarded and the precipitate re-suspended for 15 min in 1 ml of (1:1) ethanol/ethyl acetate solution. After centrifugation at 10,000 x g for 3 min and discarding the supernatant, the above step was repeated. Following the last wash, the precipitates were dissolved with 0.6 ml guanidine hydrochloride solution (6M) at 37[degrees]C for 15 min. After dissolving the precipitate, the samples were centrifuged at 10,000 x g for 3 min, to get rid of any left over debris. For each sample, T and C, the optical density (OD) was measured against 6M guanidine hydrochloride solution, at a wavelength of 370 nm.

The carbonyl content was determined as follows:

Carbonyl (nmol/m1) = [CA/0.011[mM.sup.-1]] (600[micro]l/200[micro]l),

where CA is the corrected absorbance and computed as the average OD for each control sample was subtracted from average OD of test sample at 370 nm. The extinction coefficient for DNPH at 370 nm is 22,000 [M.sup.-1] [cm.sup.-1]. In order to determine the carbonyl content per mg of protein, the protein levels were measured at 280 nm in each sample.

Histopathological examinations and histomorphometric studies

Previously fixed testicular samples in Bouin's solution (containing 10% formaldehyde, 5% acetic acid, 5% methanol and 0.5% picric acid) were subjected for histological examinations. The samples embedded in paraffin and sections (5-6 [micro]m) were stained with hematoxylin and eosin and were analyzed under light microscope by multiple magnifications.

To estimate the tubular differentiation index (TDI), the percentage of seminiferous tubules (STs) that were showing more than three layers of differentiated germinal cells from spermatogonia type A, 20 sections (6 [micro]m) were prepared from one sample and the STs which showed more than three and/or four layers considered as TDI positive (Porter et al., 2009).

To evaluate the effect of SMN on DOX induced damages on spermatocytogenesis, the repopulation index (RI) was determined. The repopulation index is the percentage of tubules populated with germ cells that had clearly reached the intermediate spermatogonial stage or later. The RI, as the ratio of active spermatogonia (spermatogonia type B with light nucleus) to inactive spermatogonia (spermatogonia type A with dark nucleus), in STs was calculated in 20 prepared sections as described earlier (Meistrich and Van Beek, 1993).

The number of total and hypertrophied leydig cells per 1 [mm.sup.2] of interstitial connective tissue was also counted.

DNA laddering assay

To examine any damage to DNA, the qualitative DNA fragmentation assay was performed on the frozen testis samples as described previously (Patel et al., 2010). Briefly, 0.2-0.3 g (pooled from at least 4 rats) from frozen testis samples of each individual group was homogenized in 3 ml lyses buffer (0.1 M Tris-HCl/1 0 mM EDTA containing 0.5% Triton X100, pH 8.0). Following a short centrifugation (1200 x g, 5 min at 4[degrees]C), the pellets were treated with a mixture containing buffer-saturated phenol, chloroform and isoamyl alcohol (25:24:1, v/v/v). After centrifugation (1500 x g, 10 min at 4[degrees]C), the supernatants were treated with chloroformisoamyl alcohol mix (49:1, v/v) to remove protein and fatty materials. Thereafter, to precipitate DNA the solution was mixed with pre-chilled ethanol (absolute) and sodium acetate (3.5M, pH 4.0) respectively. DNA samples were washed with ethanol (66%) and re-dissolved in buffer containing Tris-HCI (0.1 M), EDTA (20 mM). The DNA fragmentation was analyzed by loading the extracted DNA samples onto agarose gel (1.6%) containing ethidium bromide and electrophoresis was conducted at 60V for 75 min. DNA fragmentation was imaged using Gel Doc 2000 system (Bio-Rad).

Hormonal assays

The serum level of testosterone, inhibine B, LH, and FSH were determined by using the radio immunoassay (RIA) method according to the manufacturer's structures. The standard kits of WHO.IRP:78/542, WHO.IRP:62/125, WHO.80/552 and WHORP78/549 were used for testosterone, inhibine B, LH, and FSH determination, respectively. The intra-assay coefficient variances for testosterone, inhibine B, LH and FSH were 5.9, 4.12, 2.16 and 3.56 for 10 times measurement, respectively and inter-assay coefficient variances of 8.98, 7.12, 6.8 and 7.52 for 10 times assessments were found for testosterone, inhibine B, LH and FSH, respectively.

RNA isolation and RT-PCR

To evaluate the effect of SMN on mRNA level of c-myc in DOX-treated animals, total RNA was isolated from the testis samples using the standard TRIZOL method (Chomczynski and Sacchi, 2006). To avoid genomic DNA contamination extra care was taken when the colorless aqueous phase collected after chloroform extraction. The RNA amount was determined spectrophotometrically (260 nm and A260/280 = 1.8 - 2.0), and the samples were stored at -70[degrees]C. For RT-PCR, cDNA was synthesized in a 20 [micro]l reaction mixture containing 1 pg RNA, oligo(dT) primer (1 [micro]l), 5x reaction buffer (4 [micro]l), RNAse inhibitor (1 [micro]l), 10 mM dNTP mix (2 [micro]l) and M-MuLV Reverse Transcriptase (1 [micro]I) according to the manufacturer's protocol (Fermentas, GmbH, Germany). The cycling protocol for 20 [micro]l reaction mix was 5 min at 65 followed by 60 min at 42[degrees]C, and 5 min at 70[degrees]C to terminate the reaction.

Second strand cDNA synthesis

The RT-PCR reaction was carried out in a total volume of 25 [micro]l containing PCR master mix (12.5 [micro]l), FWD and REV specific primers (each 0.75 [micro]l) and cDNA as a template (1 [micro]1) and nuclease free water (10 ill). PCR conditions were run as follows: general denaturation at 95 [degrees]C for 3 min, 1 cycle, followed by 40 cycles of 95[degrees]C for 20s; annealing temperature (63 -C for GAPDH and 59[degrees]C for c-myc) for 30 s; elongation: 72[degrees]C for 1 min and 72 'C for 5 min.

The products of RT-PCR were separated on 1.5% agarose gel containing ethidium bromide and visualized using Gel Doc 2000 system (Bio-Rad). The specific primers for Ratus c-myc and GAPDH were designed (Tao et al., 2002; Shibata et al., 1999) and manufactured by CinnaGen (CinnaGen Co. Tehran, Iran). Primers pairs for RT-PCR were as depicted in Table 1.

Table 1
Nucleotide sequences, annealing temperatures and products size for
primers used in RT-PCR.

Target gene   Primer sequence (5' - 3')   Product size (bp)  AT

c-myc        FWD: TCACGAGACCTTCGTGAAGA                  479  59
             RVS: ATTCATATTTACACTTAAGGGT
GAPDH        FWD: GTTACCAGGGCTGCCTTCT                   167  63
             RVS: GGGTTTCCCGTTGATGACC


Statistical analyses

For all results, numerical mean and standard deviation of the measured parameters were calculated. The results of three independent experiments for each assessment were analyzed using Graph Pad Prism Software (version 2.01, Graph Pad software Inc., San Diego, CA, USA). The comparisons between groups were made by analysis of variance (ANOVA) followed by Bonferroni post hoc test.

Results

SMN changed the DOX-induced body weight loss and lowered the serum level of ALP

Determination of body weight before and after the experiment revealed that 28 day SMN administration although slightly increased the body weight gain (BWG), however it was not significant compared to the control group. By contrast, DOX-treated animals lost the body weight drastically and the SMN pretreatment and co-treatment resulted in a significant (p < 0.05) recovery of DOX-reduced body weight (Fig. 1A). Administration of SMN in therapeutic form could not recover the DOX-induced body weight loss significantly (p > 0.05). Four weeks of DOX administration resulted in a significant elevation of the serum level of ALP in comparison to the control animals, while ALP level in the SMN pretreated and SMN and DOX co-treated animals showed remarkable decline when compared to DOX-received animals. Those animals that received SMN two weeks after DOX administration did not show any significant differences in comparison to DOX received animals. SMN administration alone did not result in any significant changes in the serum level of ALP compared to the control group (Fig. 1B).

SMN reversed the DOX-increased level of protein carbonyl groups

The carbonyl stress was measured in various groups and results showed that the DOX administration resulted in a significant (p < 0.01) increase in the protein carbonyl groups in the testis, while pretreatment and co-treatment with SMN lowered remarkably the carbonyl stress (Fig. 2). The DOX-induced carbonyl stress was not improved in the animals, which received the SMN in therapeutic phase. The rats that received SMN for 28 days showed no significant (p > 0.05) changes in protein carbonyl groups level in comparison with the control group.

SMN in pretreatment and co-treatment forms improved the DOX-induced histopathological impact in the testis

The histopathological examination revealed a normal structure in the testis of the control group and the rats, which received SMN (Fig. 3A and B), while DOX-treated rats showed arrested spermatogenesis, severe edema in interstitial tissue and depleted seminiferous tubules (Fig. 3C). The SMN pretreatment and co-treatment with DOX resulted in a remarkable improvement in the DOX-induced depletion of the seminiferous tubules and reduction in interstitial edema. Comparing the two groups of rats, which received SMN as preventive and protective forms, indicate that the pretreatment regimen seems effective than that the protective form, as in protective form there are histopathological signs such as first step of tubular depletion (sertoli cells take off) and negative TDI (Fig. 3D and E). By contrast, when SMN with same dose level but after DOX-induced clinical signs was administered, the severity of testicular damages was substantiated and severe tissue fibrosis alongside with complete tubular depletion and spermatogenesis arrest were observed (Fig. 3F). The morphometrical findings of the histopathological examinations are depicted in Table 2.

Table 2
Effect of SMN in preventive, protective and therapeutic forms on
histornorphornetrical parameters in the testis of DOX-treated rats.

Groups         Control     SMN     DOX     PVT         PIT
TDi (%)       7.5 [+ or  8.8 [+    33.1    22.5   27.0 [+ or -]
                 -] 1.8   or -]   [+ or   [+ or  [1.7.sup.[PHI]
                            1.4      -]  -] 1.8
                                  3.5 *       #

RI (%)        6.4 [+ or  4.7 [+    36.7    14.3   16.7 [+ or -]
                 -] 0.5   or -]   [+ or   [+ or             1.3
                            1.2      -]      -]
                                    3.9     1.7

HLC              1.1 4-  0.9 [+  5.2 [+  1.4 [+    1.2 [+ or -]
([mm.sup.2])        0.4   or -]   or -]   or -]             1.5
                            0.3     0.8     1.1

TLC             21.7 [+    19.8  8.5 [+    16.3   12.0 [+ or -]
([mm.sup.2])      or -]   [+ or   or -]   [+ or             1.4
                    1.2      -]     1.0      -]
                            1,7             1.6

HLC/TLC(%)            5     4.5      61     8.6              10

Groups                TPT

TDi (%)             81.6 [+ or -]
              [1.95.sup.[section]

RI (%)          54.0 [+ or -] 4.3

HLC              2.6 [+ or -] 0.9
([mm.sup.2])

TLC              3.8 [+ or -] 1.7
([mm.sup.2])

HLC/TLC(%)                     68

Stars are representing significant (p < 0.05) differences between
the control and DOX-treated groups. #, [PHI] and [section],
significant differences between the DOX-received and SMN-treated
groups in various forms of administration. Data is given as mean
[+ or -] SD(n = 8). HLC, hypertrophied leydig cells; TLC, total
leydig cells.


SMN prevented/protected from DOX-induced DNA fragmentation

The agarose gel electrophoresis was performed to examine the apoptotic DNA laddering. An accumulative dose of DOX after 28 days resulted in a degradation of DNA, which characterized by a smear shape (Fig. 4). Comparing the bands in the control group (lane I, with two relatively high molecular weight bands) with those in the DOX-treated group indicates that in the DOX-received animals there is no proper high molecular weight DNA (lane 3). Those rats that in addition of DOX, received SMN as preventive and/or protective forms show two high molecular weight bands (lanes 4 and 5 respectively). SMN administration after DOX-induced clinical symptoms resulted in a situation similar to that of DOX alone (lane 6), while two distinct high molecular weight DNA bands are observed in the testis of rats which received SMN alone (lane 2). Lane 7 represents the positive control with completely fragmented DNA bands and smear form of the light molecular weight DNA from apoptotic U937 cells (Roche Diagnostics GmbH, Mannheim, Germany).

SMN recovered the DOX-reduced hormones level in serum

The effect of SMN on serum level of testosterone, inhibine B, LH and FSH in various groups of study was evaluated and the results showed that the administration of SMN in intact animals resulted in no significant differences between the control group and those animals which received 50 mg/kg SMN for 28 days (Table 3). The DOX-treated animals however, showed a significant decline in serum level of all measured hormones and the maximum reduction was found in the testosterone level. A significant (p <0.05) increase in the serum level of all measured hormones was found in the both groups of PVT and PTT, which received SMN as pretreatment or co-treatment with DOX. We found that dosing of SMN in a therapeutic form (2 weeks after DOX administration) was not able to recover the DOX-induced impact on serum level of hormones.

Table 3

Effect of SMN in preventive, protective and therapeutic forms on serum
level of testosterone, inhibine B. LH and FSH (ng/ml).

Groups         Control    SMN     DOX      PVT     PTT      TPT

Testosterone  4.1 [+ or     3.6  1.1 [+  2.8 [+  2.8 [+  0.93 [+
                 -] 0.2   [+ or   or -]   or -]   or -]    or -]
                         -] 0.4   0.1 *   0.1 #   0.3 #      0.2

Inhibine B    6.4 [+ or     5.7  2.8 [+  4.2 [+  3.8 [+   1.6 [+
                 -] 0.6   [+ or   or -]   or -]   or -]    or -]
                         -] 0.3   0.4 *   0.3 #   0.2 #      0.4

LH            2.0 [+ or     1.7  0.8 [+  1.8 [+  1.6 [+   0.7 [+
                 -] 0.1   [+ or   or -]   or -]   or -]    or -]
                         -] 0.2   0.1 *   0.2 #   0.3 #      0.2

FSH           3.9 [+ or     3.6  1.8 [+  3.4 [+  3.0 [+   1.4 [+
                 -] 0.5   [+ or   or -]   or -]   or -]    or -]
                         -] 0.3   0.2 *   0.3 #   0.3 #      0.1

Stars are representing significant (p < 0.05) differences between the
control and DOX-treated groups and #s are showing significant
differences between the DOX-received and SM N-treated groups.


The SMN pre- and co-treatment with DOX down regulated the c-myc expression in the testis

The mRNA level of c-myc was determined using a semiquantitative real time PCR technique and the results were normalized against the mRNA level of GAPDH gene serving as a house keeping gene. We found that c-myc is expressed in the testis of adult and healthy rats and four weeks DOX administration did not change the mRNA level of c-myc significantly. The mRNA level of c-myc in the animals, which received only SMN (50 mg/kg for 28 days) showed a slight but significant reduction (p < 0.05). The expression of c-myc in those groups of rats, which received DOX and SMN as pre-treatment or co-treatment was silenced or remarkably down regulated respectively. The mRNA level of c-myc in the animals that received SMN after DOX-induced clinical signs (hair and body weight loss), were down regulated (Fig. 5a). Fig. 5b shows the results of the densitometric analyses, which were performed by using the software of Molecular Analyst (Bio-Rad, The Netherlands).

Discussion

This study reports for the first time that SMN in preventive and protective forms of application is able to attenuate the DOX-induced detrimental impact in the testis. The preventive and protective effects of SMN were shown in the DOX-induced protein oxidation, testis related hormonal status, histopathological changes and in the expression of c-myc at mRNA level. SMN in therapeutic form of application was not able to recover the DOX-induced histopathological, biochemical and molecular alterations.

In clinical evaluations, DOX-induced hair and weight loss were observed, which may attribute to the reduction of feed intake and consequently protein synthesis. Similar to our finding, there are numerous reports indicating the DOX-induced weight loss both in human and animals (Abd Elbaky et al., 2010).

The biochemical assessments revealed that the serum level of ALP elevated in the DOX-received group. The reason for such elevation could be related to DOX-induced inflammatory reactions including a massive accumulation of inflammatory cells in the liver and other sources of ALP producing organs such as the intestinal tract and bone. DOX-induced inflammatory reactions have been reported in both in vitro and in vivo systems (Krysko et al., 2011; El-Sayyad et al., 2009; Saad et al., 2001). Our finding about the effect of SMN on ALP level confirms its hepatoprotective and anti-inflammatory properties (Angeli et al., 2010; Mata-Santos et al., 2010)

The high amount of unsaturated fatty acids in cell membrane following the peroxidation leads to the formation of reactive carbonyl species (RCS). RCS are electrophiles, which react with cellular nucleophilic sites such as proteins and the resultant damages are called as carbonyl stress (Catala, 2009; Grimsrud et al., 2008). Among the other factors such as age, diabetes, inflammation, and metabolic diseases, drug-induced increase of carbonylation have been reported in various conditions in the liver (Venkatraman et al., 2004: Sharma et al., 2006). In the current study we demonstrated that one of the pathways, which DOX may cause pathological damages in the testis, could be carbonylation. At the same time we showed that SMN administration in pre-treatment form and/or concurrently with DOX was able to reduce remarkably the DOX-induced carbonylation, suggesting that SMN exerts its antioxidant effect partly via lowering the formation of reactive carbonyl species and consequently reducing protein damages. SMN administration after DOX-induced clinical symptoms does not seem a useful regimen as DOX-induced protein oxidation at clinical phase seems irreversible. This finding is supported by histopathological and hormonal findings. The hormonal assays revealed that the DOX administration resulted in a significant reduction of testosterone, inhibine B, LH and FSH. This remarkable reduction of sexual hormones might be explained by severe damages, which DOX exerted on leydig and sertoli cells. As it has been well documented leydig and sertoli cells are producing testosterone and inhibine B, respectively.These hormones in a feedback reaction regulate the release of LH and FSH hormones. The DOX administration in a relatively long term resulted in suppression of upper axis (hypophysis-testis) and the reduction of both testosterone and inhibine B did not up regulate the LH and FSH release. The hormonal changes, which were found in the current study, are supported by our histopathological findings as we showed an abnormal decrease of leydig and sertoli cells alongside with remarkable edema in DOX-administered animals, suggesting a significant suppression in sertoli cell's function as supportive cells. The sertoli cells reduction likely resulted in a negative TDI and RI. SMN pre- and co-treatment with DOX resulted in improvement of DOX-induced hormonal and histological alterations. It seems SMN as a known antioxidant, prevent the pro-oxidant effects of DOX which in turn in addition of improving the structural changes, leads to returning the hormonal situation to approximately normal level.

We found that DOX administration resulted in a severe DNA fragmentation. Although this study does not clarify how and based on which mechanism(s) the DNA fragmentation has occurred, however it is indicating that DOX-induced cell death which confirmed by histopathological findings, is likely taken place by apoptosis. DOX-induced apoptosis and DNA degradation has been reported in various tissues and cell culture model (Singh et al., 2011; Kumagai et al., 2011). Reduced genomic DNA degradation with SMN-pretreatment and/or SMN administration concurrently with PDX suggests that SMN exert anti-apoptotic effect. Our results also emphasize on the proper time of SMN application to attenuate the PDX-induced negative impact on the testis tissue as it appears that PDX-induced tissue damages are irreversible. SMN anti-apoptotic capacity has been demonstrated in the prevention of UV-induced (Katiyaretal., 2011) and protection from arsenic-induced apoptosis (Soria et al., 2010).

Our results showed that an accumulative dose of DOX did not change the c-myc expression significantly and this finding is not supported by some previous reports as there are few studies indicating that DOX declined the c-myc expression in the cell culture model and in a few early hours of exposure. These reports indicated that the down regulation of c-myc was related to its role in the cell proliferation and reported a closed regression between c-myc down regulation and cell death due to exposure to DOX (Fornari et al., 1994). These controversial results rnay indicate the dual capacity of c-myc as it is also involved in anticancer-triggered apoptosis. Previous studies demonstrated the main role of c-myc in DOX-induced apoptosis (Ballabeni et al., 2004). Moreover, it has been documented that the c-myc mediated apoptosis is related to a death protease cascade consisting of caspases and serine proteases (Kagaya et al., 1997). There is scarce data about the effect of SMN on c-myc expression in various tissues; however few reports in this issue indicate that SMN administration resulted in an increase of c-myc expression in the liver as a physiologic response to natural antioxidant. Although apparently this report is in contrary with our findings, it should however be noted that SMN alongside with DOX, resulted in down regulation of c-myc, suggesting c-myc role in DOX-induced apoptosis in one hand and on the other hand the chemopreventive and chemoprotective capacities of SMN.

Conclusion

Our findings in the current study clearly showed that DOX administration could affect the testis structure and function as we found dismantled structure of testis and disorders in sexual hormones status. We also found that these DOX-induced disorders at least partly are mediated via DOX-induced carbonyl stress and DNA damages. SMN in pretreatment and protective but not therapeutic forms of application could fairly reduce the DOX-induced injuries and showed a remarkable down-regulation of c-myc in the testis.

References

Abd Elbaky, N.A., Ali, A.A., Ahmed, R.A., 2010. Cardioprotective effect of simvastatin on doxorubicin induced oxidative cardiotoxicity in rats. Journal of Basic and Applied Sciences 6 (1), 29-38.

Angeli, J.P., Barcelos, G.R., Serpeloni, J.M., Barbosa, F., Nersesyan, A., Mantovani, M.S., 2010. Evaluation of the genotoxic and anti-genotoxic activities of silybin in human hepatoma cells (HepG2). Mutagenesis 25, 223-229.

Ballabeni, A., Maellaro, E., Del Bello, B., Helin, K., Grassilli, E., 2004. Loss of MYC confers resistance to doxorubicin-induced apoptosis by preventing the activation of multiple serine protease- and caspase-rnediated pathways. Journal of Biological Chemistry 279 (20), 21318-21326.

Catala, A., 2009. Lipid peroxidation of membrane phospholipids generates hydroxy-alkenals and oxidized phospholipids active in physiological and/or pathological conditions. Chemistry and Physics of Lipids 157, 1-11.

Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nature Protocols 1,581-585.

Colombo, V., Lupi, M., Falcetta, F., Forestieri, D., D'Incalci, M., Ubezio, P., 2011. Chemotherapeutic activity of silymarin combined with doxorubicin or paclitaxel in sensitive and multidrug-resistant colon cancer cells. Cancer Chemotherapy and Pharmacology 67,369-379.

Damani, M.N., Masters, V., Meng, M.V., Burgess, P., Turek, M., Oates, R.D., 2002. Postchemotherapy ejaculatory azoospermia: fatherhood with sperm from testis tissue with intracytoplasmic sperm injection. Journal of Clinical Oncology 20(4), 930-936.

El-Sayyad, HI, Ismail, M.F., Shalaby, F.M., Abou-El-Magd, R.F., Gaur, R.L., Fernando, A., Raj, M.H.G., Ouhtit, A., 2009. Histopathological effects of cisplatin, doxoru-bicin and 5-flurouracil (5-F1.1) on the liver of male albino rats. International Journal of Biological Sciences 5 (5), 466-473.

El-Shitany, N.A., El-Haggar, S., EI-Desoky, K., 2008. Silymarin prevents adriamycin-induced cardiotoxicity and nephrotoxicity in rats. Food and Chemical Toxicology 46, 2422-2428.

Fornari, F.A., Jarvis, W.D., Grant, S., Orr, M.S., Randolph, J.K., White, F.K.H., Mumaw, V.R., Lovings, E.T., Freeman, R.H., Gewirtz, D.A., 1994. Induction of differentiation and growth arrest associated with nascent (nonoligosomal) DNA fragmentation and reduced c-myc expression in MCF-7 human breast tumor cells after continuous exposure to a sublethal concentration of doxorubicin. Cell Growth and Differentiation 5, 723-733.

Grassilli, E., Ballabeni, A., Maellaro, E., Del Bello, B., Helin, K., 2004. Loss of MYC confers resistance to doxorubicin-induced apoptosis by preventing the activation of multiple serine protease- and caspase-mediated pathways. Journal of Biological Chemistry 279 (20), 1318-21326.

Grimsrud, P.A., Xie, H., Griffin, T.J., Bernlohr, D.A., 2008. Oxidative stress and covalent modification of protein with bioactive aldehydesiournal of Biological Chemistry 283,21837-21841.

Kagaya. S., Kitanaka, C., Noguchi, K., Mochizuki, T., Sugiyama, A., Asai, A., Yasuhara, N., Eguchi, Y., Tsujimoto, Y., Kuchino, Y., Kagaya, S., 1997. A functional role for death proteases in s-Myc- and c-Myc-mediated apoptosis. Molecular and Cellular Biology 17(11), 6736-67345.

Katiyar, S.K., Mantenal S.K., Meeran, S.M., 2011. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism. PLoS One, http://dx.doi.org/10.1371/journal.pone.0021410.

Kiysko, D.V., Kaczmarek, A., Krysko, 0., Heyndrickx, L, Woznicki, J., Bogaert, P., Cauwels, A., Takahashi, N., Magez, S., Bachert, C., Vandenabeele, P., 2011. TLR-2 and TLR-9 are sensors of apoptosis in a mouse model of doxorubicin-induced acute inflammation. Cell Death Differentiation 18(8), 1316-1325.

Kumagai, K., [mai, S., Toyoda, F., Okumura, N., Isoya, E., Matsuura, H., Matsusue, Y., 2011. 1713-Estradiol inhibits the doxorubicin-induced apoptosis via block of volume-sensitive Cl(-) current in rabbit articular chondrocytes. British Journal of Pharmacology, http://dx.doi.org/10.1111/j.1476-5381.2011.01802.

Levine, R.L, Williams, J.A., Stadtman, E.R., Shacter, E., 1994. Carbonyl assays for determination of oxidatively modified proteins. Methods in Enzymology 233, 346-357.

Mansour, M.A., El-Kashef, FLA., Al-Shabanah, 0.A., 1999. Effect of captopril on doxorubicin induced nephrotoxicity in normal rats. Pharmacological Research 39, 233-237.

Mata-Santos, H.A., Lino, F.G., Rocha, C.C., Paiva, C.N., Castelo Branco, M.T., Pyrrho Ados, S., 2010. Silymarin treatment reduces granuloma and hepatic fibrosis in experimental schistosomiasis. Parasitology Research 107, 1429-1434.

Meistrich, M.L., Van Beek, M.E.A.B., 1993. Spermatogonial stem cells: assessing their survival and ability to produce differentiate cells. Methods Toxicology 3, 106-123.

Nencini, C., Giorgi, G., Micheli, L., 2007. Protective effect of silymarin on oxidative stress in rat brain. Phytomedicine 14, 129-135.

Patel. N., Joseph, C., Corcoran, G.B., Ray, S.D., 2010. Silibinin modulates doxorubicin-induced oxidative stress Bc1-xL and p53 expression while preventing apoptotic and necrotic cell death in the liver. Toxicology and Applied Pharmacology 245, 143-152.

Porter, K.L. Shetty, G., Shuttlesworth, G.A., Weng, C.C.Y., Huhtaniemi, I., Pakarinen, P., Meistrich, M.L., 2009. Estrogen enhances recovery from radiation-induced spermatogonial arrest in rat testes. Journal of Andrology 30(4), 440-451.

Raskovic, A., Stilinovic, N., Kolarovie, J., Vasovie, V., Vukmirovie, S., Mikov, M., 2011. The protective effects of silymarin against doxorubicin-induced cardiotoxicity and hepatotoxicity in rats. Molecules 16,8601-8613.

Saad, SX., Najja, T.A., Af-Rikabi, A.C., 2001. The preventive role of deferoxamine against acute doxorubicin-induced cardiac, renal and hepatic toxicity in rats. Pharmacological Research 43,211-218.

Sears, R.C., Nevins, J.R., 2002. Signaling networks that link cell proliferation and cell fate. Journal of Biological Chemistry 277,

11617-11620.

Sharma, R., Nakamura, A., Takahashi, R., Nakamoto, H., Goto, S., 2006. Carbonyl modification in rat liver histones: decrease with age and increase by dietary restriction. Free Radical Biology and Medicine 40, 1179-1184.

Shibata, M., Hariya, T., Hatao, M., Ashikaga, T., Ichikawa, H., 1999. Quantitative poly-rnerase chain reaction using an external control mRNA for determination of gene expression in a heterogeneous cell population. Toxicological Sciences 49, 290-296.

Singh. K.K., Shukla, P.C., Quan, A., Desjardins, J.F., Lovren, F., Pan, Y., Garg, V., Gosal, S., Garg, A., Szmitko, P.E., Schneider, M.D., Parker, T.G., Stanford, W.L., Leong-Poi, H., Teoh, H., Al-Omran, M., Verma, S., 2011. BRCA2 deficiency exaggerates doxorubicin-induced cardiomyocyte apoptosis and cardiac failure. Journal of Biological Chemistry, http://dx.doi.org/10.1074/jbc.M111292664.

Soria, E.A., Eynard, A.R., Bongiovanni, G.A., 2010. Cytoprotective effects of silymarin on epithelial cells against arsenic-induced apoptosis in contrast with quercetin cytotoxicity. Life Sciences 87(9-10), 309-315.

Srdjenovic, B., Milic-Torres, V., Grujic, N., Stankov, K., Djordjevic, A., Vasovic, V., 2010. Antioxidant properties of fullerenol C60(OH)24 in rat kidneys, testes, and lungs treated with doxorubicin. Toxicology Mechanisms and Methods 20 (6), 298-305.

Tao, L., kramer, M., Wang, P., Yang, W.S., Lubet, A.R., Steele, E.V., Pereira, A.M., 2002. Altered expression of c-myc, p16 and p27 in rat colon tumors and its reversal by short-term treatment with chemopreventive agents. Carcinogenesis 23 (9), 1447-1454.

Vendramini, V., Sasso-Cerri, E., Miragfia, S.M., 2010. Amifostine reduces the seminiferous epithelium damage in doxorubicin-treated prepubertal rats without improving the fertility status. Reproductive Biology and Endocrinology 8, 3.

Venkatrarnan, A., Landar, A., Davis, A.J., Ulasova, E., Page, G., Murphy, M.P., Darley-Usmar, V., Bailey, S.M., 2004. Oxidative modification of hepatic mitochondria protein thiols: effect of chronic alcohol consumption. American Journal of Physiology, Gastrointestinal and Liver Physiology 286, 521-527.

* Corresponding author at: Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, P.O. Box 1177, Urmia University, Urmia, Iran.

Tel.: +98441 279 2608; fax: +98441 2771926.

E-mail address: hamedjanbaz@ymail.com (H. Janbaz-Acyabar).

0944-7113/$ - see front matter 0 2012 Elsevier GmbH. All rights reserved.

http://dx.doi.org/10.1016/j.phymed.2012.06.011

Yokochi, T., Robertson, K.D., 2004. Doxorubicin inhibits DNMT1, resulting in conditional apoptosis. Molecular Pharmacology 66(6), 1415-1420.

H. Malekinejad (a), H. Janbaz-Acyabar (a), *, M. Razi (b), S. Varasteh (a)

(a.) Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran

(b.) Department of Histology and Embryology, Faculty of Veterinary Medicine, Urmia University, Urmia, lran
COPYRIGHT 2012 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Malekinejad, H.; Janbaz-Acyabar, H.; Razi, M.; Varasteh, S.
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:7IRAN
Date:Sep 15, 2012
Words:6418
Previous Article:The sterols isolated from Evening Primrose oil modulate the release of proinflammatory mediators.
Next Article:Curcumin suppresses the TPA-induced invasion through inhibition of PKC[alpha]-dependent MMP-expression in MCF-7 human breast cancer cells.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters