Printer Friendly

Prevalencia de Encephalitozoon intestinalis y Enterocytozoon bieneusi en pacientes VIH positivos de Maracaibo, Venezuela.

Prevalence of Encephalitozoon intestinalis and Enterocytozoon bieneusi in HIV positive patients to Maracaibo, Venezuela.

INTRODUCCION

Clasificados antes dentro de los protozoos, los microsporidios se consideran ahora hongos degenerados en funcion de las secuencias [alfa] y [beta]-tubulina y los arboles de secuencia para el chaperon molecular hsp70. Evidencias adicionales de la naturaleza fungica de los microsporidios son las esporas con pared de quitina, ausencia de aparato de Golgi y un mecanismo mitotico indistinguible del que tienen los ascomicetos fungicos (1).

Se caracterizan por formar resistentes esporas que presentan en su interior una estructura peculiar denominada tubo o filamento polar, a traves del cual infectan las celulas susceptibles donde desarrollan su ciclo vital (2). Son ubicuos por naturaleza y se consiguen ampliamente distribuidos en el ambiente. Las especies y genotipos que infectan al hombre se han detectado tambien en el agua, alimentos y en animales salvajes, domesticos y de granja. Son microorganismos intracelulares obligados pertenecientes al phylum Microsporidia, compuesto por mas de 160 generos y 1.300 especies (3); en la actualidad son 7 los generos que se han identificado en las infecciones humanas: Enchephalitozoon, Enterocytozoon, Nosema, Pleistophora, Trachipleistophora, Anncaliia (Brachiola) y Vittaforma (4,5) y un "falso" genero Microsporidium, donde se ubican los microorganismos que aun no han podido ser clasificados. Solo dos especies tienen habitat intestinal: Enchephalitozoon intestinalis y Enterocytozoon bieneusi.

Enterocytozoon bieneusi fue la primera especie identificada en pacientes VIH-SIDA con diarrea, posteriormente, se reconoce a Encephalitozoon, tambien como causa de diarrea y de formas diseminadas de infeccion (6). La principal sintomatologia de la microsporidiosis intestinal es la diarrea cronica acuosa (hasta 6-8 deposiciones diarias), sin moco ni sangre y acompanada de malabsorcion. Puede presentarse ademas, anorexia, vomitos, fiebre, nauseas, deshidratacion, perdida de peso y a veces intensa caquexia (7).

Los pacientes con VIH-SIDA se caracterizan por presentar infecciones oportunistas secundarias que se originan como consecuencia de la perdida en el numero y la funcion de los linfocitos CD4, a causa de la infeccion con el Virus de la Inmunodeficiencia humana (VIH). Este puede infectar y alterar macrofagos, celulas presentadoras de antigenos como celulas dendriticas y de Langerhans; ademas de los linfocitos TCD8, importantes en la inmunidad celular, haciendolos mas susceptibles a infecciones por microorganismos oportunistas como Microsporidios, Cryptosporidium sp., Isospora belli y Cyclospora cayetanensis (8).

El diagnostico de la microsporidiosis intestinal humana, amerita la realizacion de tecnicas especiales diferentes a las que se utilizan comunmente para el estudio de la materia fecal, por tanto, los examenes microscopicos con solucion salina fisiologica y lugol no permiten identificar las esporas. Estas son sumamente pequenas, midiendo generalmente 1,5 a 2 micras de longitud (7). Se han propuesto diversas coloraciones para ellas, entre las que destacan: Tricromica modificada de Weber o de Ryan, Gram-cromotropo rapida caliente, tinciones con fluorocromos blanco calcofluor y Uvitex 2B. Aun asi, estas tecnicas no permiten la identificacion de microsporidios a nivel de especie, para ello se hace necesaria la realizacion de microscopia electronica, utilizacion de anticuerpos monoclonales o la reaccion en cadena de la polimerasa (PCR). La identificacion de la especie presente es importante, pues tiene implicaciones en el manejo clinico del paciente, tanto desde el punto de vista terapeutico como de las previsiones en relacion a una posible diseminacion del microorganismo fuera del intestino.

Con la finalidad de poder identificar las especies de microsporidios intestinales presentes en los pacientes VIH-SIDA de nuestra region, se realizo el presente estudio.

MATERIALES Y METODOS

Se analizaron las muestras fecales de 50 pacientes de la consulta VIH-SIDA del SAHUM, 40 de ellos con diarrea aguda o cronica, 4 con otros sintomas gastrointestinales y 6 asintomaticos. La seleccion del numero de pacientes a estudiar, se vio limitada por la capacidad del kit de extraccion de ADN (50 determinaciones). Las muestras fueron recolectadas durante el periodo Septiembre 2007-Octubre 2008. En dicho servicio, los pacientes se confirman como VIH positivos, mediante al menos dos tecnicas inmunologicas (ELISA y Western Blot). La informacion relacionada con datos personales, clinica del paciente y otros, se obtuvo de la historia del mismo, archivada en la consulta. Se solicito el consentimiento informado a cada uno de los individuos participantes en el estudio, para la realizacion del presente estudio. Se obtuvo una muestra fecal por individuo, recolectada en un envase plastico, limpio y seco, la cual se preservo congelada (-20[grados]C), hasta el momento de la realizacion de la PCR.

Reaccion en cadena de la polimerasa (PCR)

1. Extraccion y purificacion del ADN.

Para extraer el ADN de las muestras de heces, se utilizo la tecnica Fast DNA SPIN kit for Soil (kit de extraccion rapida de ADN para suelos) Bio 101 Systems de la casa comercial Q-Biogene, segun las instrucciones del fabricante. El Fast DNA SPIN kit for Soil, esta disenado para extraer ADN genomico de bacterias, hongos, plantas y parasitos.

2. Amplificacion del ADN. Se efectuaron reacciones de PCR individuales para cada una de las especies estudiadas, segun el protocolo de Botero y col. (9). Las regiones SSU-ARNr (subunidad pequena del ARN ribosomico) de los microsporidios se amplificaron utilizando cebadores especificos para Encephalitozoon intestinalis, SINTF 5'TTTCGAGTGTAAGGAGTCGA3', cuya posicion en la secuencia es de 362 a 382 y SINTR 5'CCGTCCTCGTTCTCCTGCCCG3', posicion 861 a 881, que amplifican un producto de 520 pb; y para Enterocytozoon bie neusi, EBIEF1 5'GAAACTTGTCC ACTCCTT ACG3', cuya posicion en la secuencia es 295 a 315 y EBIER1 5'CCATGCACCA CTCCTG CCATT3', posicion 881-901, con un producto de amplificacion de 607 pb. Asi mismo, se procesaron en paralelo los respectivos controles negativos y positivos de acuerdo a las especie de microsporidios investigados. Como controles positivos se utilizaron fragmentos clonados de E. bieneusi y E. intestinalis. La mezcla de reaccion se preparo en un volumen final de 50 [micron]L, conteniendo 10 [micron]L de buffer Taq DNA polimerasa 5X (Promega), 1,5 mM MgCl2, 200[micron]M de cada desoxirribonucleotido, 25 pmoles de cada oligonucleotido, 1,25 U de Taq DNA polimerasa y 400 ng de ADN extraido de la muestraenestudio. Elprogramadeamplificacion consistio en una desnaturalizacion inicial de 95[grados]C por 5 min y 35 ciclos de amplificacion consistentes en: 1 min de desnaturalizacion a 94[grados]C, 30 segundos de alineamiento a 45[grados]C (Encephalitozoon intestinalis) o 55[grados]C (Enterocytozoon bieneusi) y 90 segundos de extension a 72[grados]C. Se realizo una extension final a 72[grados]C por 8 minutos.

3. Analisis de productos de PCR por electroforesis. Los productos de PCR fueron analizados en geles de electroforesis de agarosa al 2%, tenidos con bromuro de etidio (5 [micron]g/mL), visualizados con lampara de luces ultravioleta y fotografiadas con sistema de foto documentacion Digi Doc UVP (USA).

Analisis estadistico

El analisis de los datos se efectuo a traves de la estadistica descriptiva, empleando valores absolutos y porcentajes, para lo cual se elaboraron tablas de los datos obtenidos en los resultados. Se utilizo para el analisis, el paquete estadistico SPSS version 10. Se realizo Ji cuadrado y correlacion de Spearman para realizar el analisis estadistico de las variables estudiadas. Para todos los analisis, un valor de p< 0,05 fue considerado como el nivel critico de significacion.

RESULTADOS

Colaboraron con su muestra fecal 50 individuos, con edades comprendidas entre 21 a 62 anos (promedio 34,94 [+ o -] 10,82 anos), de los cuales 21 eran mujeres y 29 hombres. Estos pacientes estaban diagnosticados como VIH positivos, desde hace 1 a 3 anos, con un promedio de 1,67 [+ o -] 0,75 anos. Al evaluar sus historias clinicas, se observo que 42 de ellos tenian resultados de CD4 relativamente recientes (uno a seis meses de emitidos) y presentaron valores de CD4 que variaban entre 4 y 716 celulas por mm3 (promedio 208,62 [+ o -] 166,24).

Segun su historia clinica, solo 6 individuos se encontraban totalmente asintomaticos al momento de ser solicitada la muestra fecal. El resto de los pacientes (44) refirieron como los sintomas mas frecuentes, diarrea (80%), perdida de peso (30%) y sintomas gastrointestinales que incluian dolor abdominal, colicos, vomitos y/o estrenimiento en 10%. Once pacientes presentaron conjuntamente candidiasis oral y neumocystosis, por lo que podia presumirse que se encontraban en etapa SIDA.

Mediante PCR se detecto ADN de microsporidios en 18 individuos (18/50), representando esta parasitosis, el 36% de prevalencia en individuos VIH positivos. Diez muestras amplificaron para E. intestinalis, cuatro para E. bieneusi y cuatro amplificaron para ambos microsporidios. Las Figs. 1 y 2 muestran resultados de la electroforesis horizontal en geles de agarosa para cada especie de microsporidio estudiada.

[FIGURA 1 OMITIR]

[FIGURA 2 OMITIR]

En la Tabla I pueden observarse los sintomas mas frecuentes manifestados por los pacientes infectados con E. bieneusi y/o E. intestinalis, donde destaca que 10 indivi duos manifestaron diarrea, 7 presentaron perdida de peso importante y 2 sindrome de desgaste.

El 42% de los individuos presento valores de CD4 dentro de lo normal, es decir, mayor a 200 cel/[mm.sup.3], los resultados de estas pruebas pueden observarse en la Tabla II. Alli mismo puede apreciarse que, al bajar la cifra de CD4 aumenta la probabilidad de presentar infeccion por E. bieneusi y/o E. intestinalis y viceversa. Esta situacion demostro ser estadisticamente significativa (p< 0,05).

En relacion a la presencia de sintomas o no en los pacientes estudiados y las cifras de CD4, los asintomaticos (6 individuos) presentaron en su mayoria (4/5) cifras mayores a 200 cel/[mm.sup.3]. No se pudo obtener el resultado de CD4 de uno de ellos.

DISCUSION

La epidemiologia de la microsporidiosis todavia esta siendo determinada y la prevalencia varia enormemente en diferentes partes del mundo. No existen estudios en el pais que revelen las prevalencias de E. bieneusi y/o E. intestinalis en especifico, solo prevalencias generales en base a la presencia de esporas del phylum Microsporidia en las muestras fecales (10-12).

Al analizar los resultados obtenidos, en relacion a las especies de microsporidios identificadas mediante PCR, se aprecia una mayor prevalencia de E. intestinalis que de E. bieneusi, situacion diferente a la informada por la mayoria de las investigaciones previas a nivel mundial (9, 13-15), en donde E. bieneusi es mas frecuente. Sin embargo, en un estudio realizado recientemente en pacientes VIH positivos en Francia, se refiere un mayor numero de casos de infeccion por E. intestinalis que por E. bieneusi (16). Esta situacion puede deberse a las variaciones epidemiologicas propias de cada region; pues aunque los mecanismos de transmision de estos parasitos no han sido total mente definidos, se proponen la transmision mediante aguas y alimentos contaminados, asi como la transmision zoonotica. La transmision hidrica es una de las vias mas estudiadas y existen informes de contaminacion de aguas con E. bieneusi y E. intestinalis en paises latinoamericanos (17, 18).

Es importante reconocer la especie de microsporidio presente, pues el comportamiento biologico de cada parasito es relativamente diferente. E. intestinalis tiene riesgo de ocasionar infeccion diseminada, principalmente en rinon, higado, vias biliares y aparato respiratorio (19). Generalmente E. bieneusi, se limita a infectar el tracto gastrointestinal y causar diarrea; este microorganismo en menor proporcion puede infectar el epitelio de la vesicula biliar, conductos biliares, higado, y aparato respiratorio alto (20). Por lo tanto, se requiere una mayor vigilancia clinica en el paciente infectado por E. intestinalis, situacion que debe ser tomada en cuenta en los pacientes del SAHUM, donde fue la especie de microsporidio mas prevalente. Se hace necesario conocer la prevalencia de la infeccion por microsporidios en la region, pues en muchos casos de diarreas cronicas en pacientes VIH positivos, no se llega a identificar algun patogeno enterico, por diversas razones; pero sobre todo porque no se solicita el descarte de estos parasitos en la muestra fecal. Ademas, existe el agravante de que en la mayoria de las instituciones de salud del estado y del pais no se cuenta con la metodologia necesaria, ni el personal entrenado para el diagnostico de la microsporidiosis, esta situacion debe ser atendida por los entes gubernamentales con prontitud.

La mayoria de los pacientes infectados por E. intestinalis y/o E. bieneusi presentaron diarrea y perdida de peso, en los pacientes inmunocomprometidos estas parasitosis provocan gastroenteritis secretorias con abundante perdida de liquidos y electrolitos, asi como sindrome de mala absorcion, caracterizado por perdida de peso, desnutricion e hipovitaminosis. Ademas se observo, que 2 de ellos presentaban sindrome de desgaste. El sindrome de desgaste o emaciacion suele ser uno de los primeros sintomas de SIDA, de acuerdo con la definicion utilizada por el CDC (21), el sindrome de desgaste asociado a la infeccion por VIH se caracteriza por una perdida de peso corporal (particularmente masa muscular) involuntaria y mayor del 10% respecto al peso normal de referencia, diarrea o debilidad cronica con fiebre durante un periodo superior a 30 dias. Tal condicion ha sido referida en pacientes VIH positivos infectados por microsporidios y/o coccidios intestinales con anterioridad (5, 22-24).

Aunque la mitad de los individuos estudiados presentaban contajes de CD4 dentro de los valores normales, en aquellos que tenian los valores mas bajos de estos linfocitos (< 100 cel/[mm.sup.3]) se demostro infeccion por alguna de las especies de microsporidios estudiadas. Esto resulto estadisticamente significativo, demostrando una relacion inversamente proporcional entre las cifras de CD4 y esta infeccion parasitaria. Tal situacion ha sido descrita en investigaciones previas (25-27), Chabchoub y col. (16) refieren 23,9% de prevalencia de microsporidiosis en pacientes con contajes de CD4< 200 cel/[mm.sup.3], en contraste con un 5,6% de prevalencia en los que tenian contajes de CD4 mas altos. Esto sugiere que el paciente VIH positivo que presente cifras de CD4 muy bajas y diarrea cronica, debe ser arduamente estudiado para la deteccion e identificacion de especies de microsporidios.

Efectivamente, en pacientes VIH positivos el mantener cifras de linfocitos CD4 superiores a 200 cel/[mm.sup.3], permite una mayor proteccion contra muchos patogenos oportunistas. Aunque se estudiaron pocos individuos asintomaticos en la presente investigacion, se evidencio que la mayoria de ellos poseian valores de linfocitos dentro de los limites normales, presentando E. intestinalis solo 2 de ellos.

Segun Abuin y Marino (28), el sistema inmune de la mucosa gastrointestinal juega un papel esencial en la fisiopatogenia de la infeccion por el VIH. Puede ser la puerta de entrada del virus VIH-1 y un sitio de infeccion y destruccion de linfocitos CD4. Se ha demostrado una marcada reduccion en el numero de celulas T CD4 de la poblacion linfocitaria de la mucosa, acompanada de un incremento de celulas T CD8, que en ocasiones supera a lo encontrado en sangre periferica. La inmunodepresion de los organos linfoides durante la infeccion cronica finalmente predispone al desarrollo de infecciones oportunistas, entre ellas las parasitarias. Aunque los factores de riesgo para la adquisicion de infecciones parasitarias son las mismas en individuos inmunocompetentes que para los inmunodeficientes, la situacion del sistema inmune define y modifica el establecimiento de la infeccion, controla la enfermedad una vez establecida (limitando la severidad y diseminacion) y colabora en la eliminacion o control del parasito.

Finalmente, es destacable la elevada prevalencia de especies de microsporidios observada en los pacientes VIH (considerando el bajo numero de pacientes estudiados), con un predominio de la especie E. intestinalis. Asi mismo, se observo una relacion inversamente proporcional entre las cifras de [CD.sub.4] y la presencia de las especies de microsporidios.

AGRADECIMIENTOS

Al Dr. Fernando Bornay Llinares, quien muy gentilmente obsequio el kit de extraccion de ADN y los primers de microsporidios necesarios para la presente investigacion.

Al Dr. Alexandre Dasilva del Center of Disease Control de Atlanta Estados Unidos (CDC/CCID/NCZVED), quien gentilmente obsequio los controles clonados de E. bieneusi y E. intestinalis, usados en las PCR de este estudio.

Recibido: 07-12-2012. Aceptado: 14-02-2013

REFERENCIAS

(1.) Murray P, Rosenthal K, Pfaller M. Microbiologia Medica. 6ta. edicion. Barcelona, Espana. Editorial Elsevier. 2009. p. 839.

(2.) Bornay F, Acosta B, Peman J, Moura H, Schwartz D, Da Silva A, Vivesvara G, Figueras M, Gobernado M, Pieniazek N. Mantenimiento en cultivo y caracterizacion de un microsporidio (Encephalitozoon hellem) aislado en un paciente con SIDA y neumonia. Parasitol dia 2000; 24:69-70.

(3.) Zhang X, Wang Z, Su Y, Liang X, Sun X, Peng S, Lu Hm jiang N, Yin J, Xiang M, Chen Q. Identification and genotyping of Enterocytozoon bieneusi in China. J Clin Microbiol 2011; 49:2006-2008.

(4.) Bedoya K, Montoya M, Botero J, Galvan A. Primer aislamiento de Encephalitozoon intestinalis a partir de muestra de material fecal de un paciente Colombiano con SIDA. Biomedica 2008; 28:441-447.

(5.) Stark D, Barratt J, van Hal S, Marriot D, Harkness J, Ellis J. Clinical significance of enteric protozoa in the immunosuppressed human population. Clin Microbiol Rev 2009; 22: 634-650.

(6.) Fernandez N, Combo A, Zanetta E, Acuna A, Gezuele E. Primer diagnostico de microsporidiosis humana en Uruguay. Rev Med Uruguay 2002; 18: 251-255.

(7.) Protozoarios Intestinales modulo Microporidiosis. disponible en: http://unsl.edu. ar/~fqbf/departamentos/BioqBiol_/apuntes_archivos/analisis_clinicos/parasito/ Modulo%204. doc

(8.) Botero J, Montoya M. Microsporidiosis intestinal: una vision integral. Infectio 2002; 6:213-225.

(9.) Botero J, Montoya M, Vanegas A, Diaz A, Martinez L, Bornay F, Izquierdo F, Del Aguila C, Agudelo S. Frecuencia de microsporidiosis intestinal en pacientes positivos para VIH mediante las tecnicas de Gram cromotropo rapido y PCR. Biomedi ca 2004; 24:375-384.

(10.) Baez E, Arcay L, Reverand S, Otero E. Microspora: Etiological agent in chronic diarrhoea. Rev Soc Ven Microbiol 2000; 20:53-56.

(11.) Cermeno J, Hernandez I, Uzcategui O, Paez J, Rivera M, Baliachi N. Parasitosis intestinal en pacientes infectados con el virus de inmunodeficiencia humana. Kasme ra 2004; 32:101-107.

(12.) Chacin-Bonilla L, Panunzio A, Monsalve F, Parra I, Matinez R. Microsporidiosis in Venezuela: Prevalence of intestinal microsporidiosis and its contribution to diarrhea in a group of Human Immunodeficiency Virus-infected patients from Zulia State. Am J Trop Med Hyg 2006; 74: 482-486.

(13.) Muller A, Bialek R, Kamper A, Fatkenheuer G, Salzberger B, Franzen C. Detection of microsporidia in travelers with diarrhea. J Clin Microbiol 2001; 39: 1630-1632.

(14.) Sarfati C, Bourgeois A, Menotti J, Liegeois F, Moyou-Somo R, Delaporte E, Derouin F, Ngole EM, Molina JM. Prevalence of intestinal parasites including Microsporidia in human immunodeficiency virus-infected adults in Cameroon: A cross-sectional study. Am J Trop Med Hyg 2006; 74:162-164.

(15.) Samie A, Obi C, Tzipori S, Weiss L, Guerrant R. Microsporidiosis in South Africa: PCR detection in stool samples of HIV-positive and HIV-negative individuals and school children in Vhembe district, Limpopo Province. Trans R Soc Trop Med Hyg 2007; 101:547-554.

(16.) Chabchoub N, Abdelmalek R, Issa S, Kanoun F, Ben T, Bouratbine A, Aoun K. Contribution of PCR for detection and identification of intestinal microsporidia in HIV-infected patients. Pathol Biol 2012; 60:91-94.

(17.) Dowd S, Gerba C, Pepper I. Confirmation of the human-pathogenic Microsporidia Enterocytozoon bieneusi, Encephalitozoon intestinalis, and Vittaforma corneae in water. App Environ Microbiol. 1998; 64: 3332-3335.

(18.) Dowd S, John D, Eliopolus J, Gerba Ch, Naranjo J, Klein R, Lopez B, De Mejia M, Mendoza C, Pepper I. Confirmed detec tion of Cyclospora cayetanensis, Encephalitozoon intestinalis and Cryptosporidium parvum in water used for drinking. J Water Health. 2003; 1:117-123.

(19.) Andrade R, Marcano M. Infecciones parasitarias en el paciente infectado por el virus de la inmunodeficiencia humana: Aspectos etiologicos, clinicos, diagnosticos, terapeuticos y profilaxis. Rev Soc Ven Microbiol 2003; 23:169-174.

(20.) Matos O, Lobo ML, Xiao L. Epidemiology of Enterocytozoon bieneusi Infection in Humans. J Parasitol Res. 2012; 2012: 981424. 19 pages.

(21.) Glosario de infoSIDA. Centro de Control de Enfermedades de los Estados Unidos (CDC). Disponible en: http://infosida.nih. gov/education-materials/glossary/4200/ sindrome-de-emaciacioacute;n

(22.) Basak S, Bose S, Mallick S, Ghosh A.In testinal parasitic infections in HIV seropositive patients-a study. J Clin Diag Res 2010; 4:2433-2437.

(23.) Raccurt C, Fouche B, Agnamey P, Menotti J, Chouaki T, Totet A, and Pape J. Short Report: Presence of Enterocytozoon bieneusi associated with intestinal coccidia in patients with chronic diarrhea visiting an HIV center in Haiti. Am J Trop Med Hyg 2008; 79: 579-580.

(24.) Endeshaw T, Kebede A, Verweij JJ, Zewide A, Tsige K, Abraham Y, Wolday D, Woldemichael T, Messele T, Polderman AM, Petros B. Intestinal microsporidiosis in diarrhoeal patients infected with the human inmunodeficiency virus-1 using PCR and Uvitex-2B stain in Abbis Ababa. Jpn J Infect Dis. 2006; 59:306-310.

(25.) Asmuth D, DeGirolami P, Federman M, Ezratty C, Pleskow D, Desai G. Clinical features of microsporidiosis in patients with AIDS. Clin Infect Dis 1994; 18:819-825.

(26.) Sucilathangam G, Velvizhi G. Palaniappan N, Anna T. The prevalence of coccidian parasites in and around Tirunelveli in HIV positive individuals and its correlation with the CD4 count. J Clin Diag Res 2011; 5: 1182-1186.

(27.) Pavie J, Menotti J, Porcher R, Donay J, Gallien S, Sarfati C, Derouin F, Molina J. Prevalence of opportunistic intestinal parasitic infections among HIV-infected patients with low CD4 cells counts in France in the combination antiretroviral therapy era. Int J Infect Dis 2012; 16:677-679.

(28.) Abuin J, Marino R. Diarreas de origen parasitario en pacientes HIV. Disponible en http://www.sasnac.org.ar/docs/cienciasclinicas/C/diarreas_de_origen_parasitario_en pacientes_hiv.pdf.

Zulbey Rivero-Rodriguez, Amparo Hernandez Sierra, Nailet Arraiz, Angela Bracho Mora y Rafael Villalobos Perozo.

[1] Escuela de Bioanalisis, Universidad del Zulia. Maracaibo, Venezuela

[2] Facultad de Salud, Programa de Microbiologia, Universidad Popular del Cesar, Valledupar. Cesar, Colombia

[3] Escuela de Medicina, Universidad del Zulia. Maracaibo, Venezuela.

Autor de correspondencia: Zulbey Rivero de Rodriguez. Escuela de Bioanalisis, Facultad de Medicina, Universidad del Zulia. Maracaibo, Venezuela. Telef. 58-261-7541650. Correo electronico: zulbeyrivero@gmail.com
TABLA I
SIGNOS Y SINTOMAS OBSERVADOS EN PACIENTES CON Encephalitozoon
Intestinalis Y/O Enterocytozoon bieneusi DE MARACAIBO, VENEZUELA

Sintoma o signo               Enterocytozoon   Encephalitozoon
                                 bieneusi       intestinalis

Diarrea                             2                 6
Perdida de peso                     3                 2
Sindrome de desgaste                2                 0
Sintomas gastrointestinales         1                 0

Sintoma o signo                Ambas     Total
                              especies

Diarrea                          2        10
Perdida de peso                  2         7
Sindrome de desgaste             0         2
Sintomas gastrointestinales      0         1

TABLA II
VALORES DE LINFOCITOS CD4 Y ESPECIES DE MICROSPORIDIOS
EN PACIENTES VIH POSITIVOS DE MARACAIBO, VENEZUELA

Contaje                          No.    %    E. intestinalis

Sin datos                          8    16          0
[menor que o igual a] 200 cel     21    42          3
  /[mm.sup.3]
> 200 cel                         21    42          1
  /[mm.sup.3]
Total                             50   100          4

Contaje                          E. bieneusi   Ambas Especies   Total

Sin datos                             2              1            3
[menor que o igual a]200 cel          6              2           11 *
  /[mm.sup.3]
> 200 cel                             2              1            4
  /[mm.sup.3]
Total                                10              4           18

* (p < 0,05).
COPYRIGHT 2013 Universidad del Zulia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Encephalitozoon intestinalis, Enterocytozoon bieneusi, microsporidios
Author:Rivero-Rodriguez, Zulbey; Hernandez Sierra, Amparo; Arraiz, Nailet; Bracho Mora, Angela; Villalobos
Publication:Investigacion Clinica
Date:Mar 1, 2013
Words:4069
Previous Article:La intoxicacion con cobre disminuye la sobrevida e induce alteraciones neurologicas en Drosophila melanogaster.
Next Article:Endocarditis infecciosa por Rhizobium radiobacter. Reporte de un caso.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters