Printer Friendly

Presencia del elemento genetico transponible dTdic1 en Dianthus caryophyllus con flores variegadas y no variegadas.

Presence of the transposable genetic element dTdic1 in Dianthus caryophyllus with variegated and no variegated flowers

Introduccion

El clavel Dianthus caryophyllus (Cariophyllaceae) es un importante componente de la floricultura nacional e internacional (Asocolflores, 2009). Debido a su importancia comercial, se hacen esfuerzos permanentes de mejoramiento que incluyen, entre otros, la produccion de nuevas coloraciones florales (Holley y Baker, 1991). El descubrimiento de EGTs (Elementos Geneticos Transponibles) presentes en genes de regulacion o biosintesis de antocianinas ha despertado gran interes por su potencial uso biotecnologico en la generacion de nuevos genotipos florales (Liu et ai, 2001; To y Wang, 2006). El efecto de EGTs en la coloracion de las flores ha sido estudiado en varias especies como Nicotiana tabacum (Liu et al., 2001), Ipomea sp. (Lida et al., 2004) y Petunia sp (Van Houwelingen et al., 1998). Los EGTs se emplean en tecnicas biotecnologicas de mejoramiento como mutagenesis insercional y "transposon tagging" (Chuck et al., 1993; Babiychuk et ai, 1997). Recientemente, el elemento dTdic1 fue usado como herramienta de mejoramiento vegetal a traves de la tecnica de "Tagging" (Patent Abstracts of Japan, 2007).

Los elementos geneticos transponibles (EGTs) descubiertos en plantas de maiz por Barbara McClintock en 1951, son fragmentos de DNA que pueden insertarse en nuevos lugares cromosomales y generalmente hacen copias de si mismos en el proceso (Feschotte et ai, 2002). Los EGTs se clasifican de dos formas, de acuerdo al grado de autosuficiencia (autonomos y no autonomos) y segun el mecanismo de transposicion (Clase I y Clase II) (Galun, 2003). Los elementos de la clase II o elementos de DNA, se subdividen en familias que incluyen la superfamilia hAT en donde se encuentra el elemento dTdic1 (superfamilia Ac/Ds, grupo II) (Itoh et ai, 2002), el Activator (Ac) en maiz y Tam3 en Boca de Dragon (Itoh et ai, 2002; Galun, 2003; Huang et ai, 2009).

En un estudio reciente en clavel cultivar "Rhapsody", se observo variegacion del color de los petalos caracterizada por flecos rojos de patron azaroso sobre un fondo blanco, la cual se cree que es causada por una reversion de la actividad del gen DFR (Dihidroflavonol reductasa) tras la escision del EGT dTdic1 (Itoh et ai, 2002). De igual forma en flores de clavel amarillas con flecos y sectores blancos, los genes CHI (Chalcona isomerasa) y DFR tambien presentaron actividad de dTdic1 asociada con patrones de variegacion en los petalos (Itoh et ai, 2002, Yoshida et al., 2004).

Los principales pigmentos involucrados en la coloracion floral son los carotenoides, flavonoides y betalainas, aunque otros pigmentos como clorofilas, fenilfenalenonas y quinochalconas tambien intervienen en la coloracion de los petalos (Davies, 2009). Las antocianinas son la base para casi todas las flores rosadas, rojas, anaranjadas, escarlatas, purpuras y azules (Davies, 2009) y en el clavel son las responsables de los colores rojos (Itoh et ai, 2002). En el clavel, las chalconas estan asociadas con el color amarillo de las flores debido a que en flores de clavel con petalos amarillos se ha identificado el glucosido 2'-O de chalcona como el principal flavonoide, pigmento tambien conocido como isosalipurposido (narigenin-chalcon-2'-glucosido) (Itoh et ai, 2002, Yoshida et ai, 2004, Ogata et ai, 2004). Para que esta chalcona se acumule, las plantas deben ser deficientes en la actividad de la enzima chalcona isomerasa (Gatt et al., 1998).

El grupo de investigacion en fitopatologia molecular de la Universidad Militar Nueva Granada, ha venido desarrollando un programa de mejoramiento genetico de clavel en busqueda de materiales tolerantes al ataque de Fusarium oxysporum. En el proceso de mejoramiento, se han generado materiales que se caracterizan por presentar patrones de variegacion inestable en sus petalos (Fernandez y Filgueira, 2006). El objetivo de este trabajo fue la busqueda del EGT dTic1 dentro de los genes CHI y DFR de la ruta de biosintesis de antocianinas, en seis lineas hibridas de clavel con flores variegadas y una linea no variegada provenientes de este programa de mejoramiento y tres cultivares comerciales, con el fin de caracterizar este fenomeno y determinar si la variegacion se asocia con la presencia de este EGT. Este trabajo partio de la hipotesis que las lineas variegadas poseian el EGT dTic1 activo, mientras que las no variegadas carecian de este.

Materiales y metodos

Material vegetal

Se utilizaron plantas de clavel con flores no variegadas y con flores variegadas. En la figura 1 se presenta un ejemplo de una flor con variegacion. Las lineas con flores variegadas eran hibridos producidos por cruces entre plantas comerciales y silvestres que provenian del programa de mejoramiento del grupo de fitopatologia molecular de la Universidad Militar Nueva Granada. Estas presentaban manchas, puntos y estrias, de formas y tamanos azarosos, de color diferente al color base. Las lineas UM225, UM226 y VRB presentaban flores con puntos, manchas y estrias blancas sobre fondos rojos, UM290 y UM302 puntos, manchas y estrias rojas sobre fondos rojos o rosados y CRS mostraba estrias rosadas sobre un color base naranja. Los cultivares comerciales con flores no variegadas eran de color blanco en el caso de Kaly y Bagatel, blanco verdoso para Lady Green y flores de color rojo para la linea hibrida "comercial XXX".

Deteccion de dTdic1 por PCR y clonacion de los productos de PCR

El ADN de hojas de clavel fue extraido por un metodo quimico estandar. Brevemente, 1g de material foliar se macero con nitrogeno liquido, se incubo por 30 minutos a 65 [grados]C en 8 ml de buffer de extraccion (2% CTAB, 100 mM Tris-HCl pH 8, 20 mM EDTA disodico pH 8.0, 1.4 M NaCl, 1% PVP-40, 2% 2-mercaptoetanol). Despues se hizo una extraccion con 8 ml de cloroformo: alcohol isoamilico 24:1 despues se centrifugo a 5.660 x g durante 10 min para recuperar el sobrenadante. Se adicionaron 0.8 ml de buffer de extraccion secundario (0.8 ml de CTAB 10%, NaCl 0.7 M) en el que se incubo a 65 [grados]C por 10 minutos. Se recupero el sobrenadante, se adiciono isopropanol (2/3 volumen) y se almaceno a 4 [grados]C. Al dia siguiente se centrifugo a 5.660 x g durante 10 min y el pellet de ADN se resuspendio en 2 ml de TE 1 M NaCl (Tris-HCl 10 mM, EDTA 1 mM, pH 8.0). Por ultimo, se precipito el ADN mediante adicion de 5 ml de etanol, seguido por lavado con 1ml de etanol al 70%. Se centrifugo a 12000 x g para retirar el exceso de etanol y el pellet se resuspendio en 0.3 ml de TE. El ADN se almaceno a - 20 [grados]C tras adicionar RNAsa 100ug/ml. Los ensayos de PCR se dirigieron a la busqueda del EGT dTdic1 usando cebadores previamente reportados por Itoh y colaboradores (2002) (tabla 1). Adicionalmente en este trabajo se disenaron tres pares de cebadores para la amplificacion de dTdic1 (tabla 2) usando como referencia la secuencia previamente publicada (AF250367).

[FIGURA 1 OMITIR]

Los cebadores dTdic1-F1, dTdic1-F2, dTdic1-R1, dTdic1-R2 y dTdic1-R3, fueron disenados para la amplificacion de dTdic1 sin importar su lugar de insercion en el genoma, mientras que dTdic1-2 y CHI-2 permitieron la amplificacion de dTdic1 cuando se encontraba dentro del gen CHI (chalcona isomerasa) Los cebadores dTdic1-1 y DFR-1 permitieron la amplificacion de dTdic1 cuando se encontraba interrumpiendo el gen DFR (dihidroflavonol reductasa) (figura 2).

Las concentraciones finales de los reactivos para PCR fueron: 0,2 mM de dNTPs, 0,2 pM de cada cebador, 1X Buffer, 1,5-2,5 mM de MgCl2, 0,75 U de Taq Polimerasa (Promega, Madison, WI) y 40 ng de DNA para reacciones de 15 pl. Las reacciones se llevaron a cabo segun el siguiente perfil termico: ciclo de denaturacion inicial de 95 [grados]C, 7 min y 35 ciclos de 1 min a 90 [grados]C, 1 min a 54-65 [grados]C, 1,5 min a 72 [grados]C y un ciclo de extension final de 10 min a 72 [grados]C. Los productos de PCR se analizaron por electroforesis en gel de agarosa estandar, tenido con bromuro de etidio.

Los productos de PCR se clonaron mediante el kit TOPO TA Cloning[R] Kit PCR[R] 2.1-TOPO[R] Vector (Invitrogen[R]), segun instrucciones del fabricante. La transformacion bacteriana se realizo por electroporacion en celulas DH5a electrocompetentes (Sambrook y Russell, 2001). Celulas DH5a se cultivaron en 500ml de caldo LB (Luria Broth) a 37 [grados]C hasta obtener una OD de 0,35. Las celulas se recuperaron por centrifugacion a 1.000 x g durante 15 min a 4[grados]C y el pellet se resuspendio en 250 ml de agua MilliQ hasta concentrar la masa celular en 10 ml de solucion de glicerol (10% v/v). Las celulas se resuspendieron en caldo GYT frio (Glicerol 10% v/v, extracto de levadura 0,125% p/v y triptona 0,25% p/v) a una concentracion de 3 X [10.sup.10] celulas/ml. Para la transformacion se usaron 40 pl de suspension de celulas electrocompetentes y 10-25 ng del plasmido ligado, los cuales se sometieron a un pulso electrico de 2.500 V. Las celulas electroporadas se incubaron en 1 ml de caldo SOC (Triptona 2% p/v, extracto de levadura 0,5% p/v, NaCl 0,05% p/v, KCl 2,5 mM, MgCl2 10 mM y glucosa 20 mM) 1 hora a 37 [grados]C y posteriormente 10 y 100 ml se sembraron en agar SOB (Triptona 2% p/v, extracto de levadura 0,5% p/v, NaCl 0,05% p/v, MgSO4 10 mM y KCl 2,5 mM) con X-gal 0.1 M, IPTG 20 mg/ml y ampicilina 0,1 mg/ml. Las colonias transformantes blancas fueron analizadas por PCR y enviadas a secuenciar.

[FIGURA 2 OMITIR]

Estimacion de la abundancia de dTdic1 en el genoma de clavel

Se fabrico una sonda complementaria a un fragmento de 757 pb de dTdic1 utilizando el Kit Dig High Prime Labeling and Detection Starter Kit II de ROCHE[R] (Mannheim, Germany), segun instrucciones del fabricante. Con el fin de detectar el elemento dTdic1 en el DNA genomico de clavel, se realizo Southern blot utilizando el Kit Dig High Prime Labeling and Detection Starter Kit II de ROCHE[R], siguiendo el protocolo descrito en DIG Application Manual for Filter Hibridization de ROCHE[R]. Para cada linea de clavel diferentes cantidades de ADN precalentado (10, 7, 5 y 2 pg) se digirieron durante 12 h con una de estas enzimas de restriccion BamHI, BglII, EcoRI o HindIII. Las reacciones (200 [micron]l) contenian 5 U de enzima por pg de DNA, 1 mg/ml de BSA, 1 mM de espermidina y 1X del buffer de la enzima. El DNA digerido se separo por electroforesis en geles de agarosa en concentraciones que variaron entre 0,7 - 1,5 % p/v. El DNA separado se transfirio por capilaridad, previa depurinacion, denaturacion y neutralizacion, a una membrana de nylon. La temperatura de hibridacion se calculo segun sugerencia del fabricante (Thyb= Tm-22,5), considerando el contenido GC de la sonda (37,33%) y del DNA blanco (40%). Las membranas se hibridaron con las sonda dTdic1 (25 ng/ml de solucion de hibridacion) durante 12- 16 horas a 42 [grados]C (tambien se evaluaron otras temperaturas de hibridacion a 37 y 48 [grados]C). Posterior a la hibridacion se realizaron dos lavados (5 min, 2x SSC y 0,1% SDS a 25 [grados]C) seguido por dos lavados (0,5x SSC y 0,1% SDS durante 15 min a 65 [grados]C). Las membranas se lavaron a temperatura ambiente con buffer de lavado (acido maleico 0,1 M, NaCl 0,15 M, pH 7,5, Tween 20 0,3% v/v), y se incubaron en solucion de bloqueo durante 30 min. Se adiciono solucion de anticuerpo Anti-digoxigenina-Fosfatasa alcalina 1:10.000 en solucion de bloqueo durante 30 min tras los cual las membranas se lavaron para eliminar el exceso de sonda. Posteriormente se adiciono el sustrato quimioluminiscente (CSPD-ROCHE[R]) sobre la membrana y se incubo durante 5 min a temperatura ambiente. Para visualizar la quimioluminiscencia las membranas se expusieron a peliculas de alta sensibilidad Kodak[R] durante tiempos variables de entre 5 minutos y 24 horas. Las peliculas se revelaron con el Kit Developer and Replenisher y Fixer and Replenisher de Kodak[R].

Estudio de la expresion de dTdic1

Con el fin de detectar transcritos de dTdic1, se extrajo RNA total a partir de petalos de flores variegadas y no variegadas de clavel en estado 2 (estrella) utilizando TRIzol[R] Reagent de Invitrogen[R], segun recomendaciones del fabricante. A partir del RNA total se extrajo mRNA con el Fast Track[R] MAG mRNA Isolation Kit siguiendo las instrucciones del fabricante. Las muestras fueron almacenadas en agua libre de RNAsas a -70 [grados]C hasta su utilizacion en Northern y Dot blot. Extractos de RNA total (3-6 pg) y mRNA (0,13-0,46 pg) provenientes de las lineas de clavel variegadas y no variegadas fueron analizados por dot blot con el fin de detectar transcritos del elemento dTdic1 que permitieran confirmar la transcripcion del elemento. Las misma sonda que se empleo para Southern blot se utilizo para los ensayos de Dot blot, siguiendo el mismo protocolo descrito para este excepto que las membranas fueron hibridadas con la sondas dTdic1 durante 16 horas y la temperatura de hibridacion fue de 50 [grados]C. El lavado de alta astringencia se realizo a 50 [grados]C segun las recomendaciones del fabricante. Posteriormente se realizo la deteccion y autorradiografia de las membranas como se menciono anteriormente. Todas las soluciones fueron tratadas con DEPC (Dietilpirocarbonato) y la vidrieria tratada con calor en un horno a 80 [grados]C durante 12 h con el fin de inhibir la accion de RNAsas.

Resultados

Los resultados de PCR con cebadores dTdic1F1/ dTdic1R1 tanto en claveles con petalos variegados (UM225, UM226, UM290, UM302, CRS y VRB) como no variegados (XXX, Bagatel, Kaly y Lady Green), produjeron dos amplicones, uno de 757 pb correspondiente al tamano esperado para del EGT dTdic1 (figura 3) y otro un poco mas pequeno, sugiriendo la presencia de al menos otra copia de dTdic1 un poco mas corta en estos materiales.

Para determinar si dTdic1 se encontraba dentro de los genes CHI y DFR, que hacen parte de la ruta de biosintesis de antocianinas, se evaluaron los pares de cebadores CHI-1/CHI-2, dTdic1-2/CHI-2 y dTdic1-1/DFR-1 respectivamente (figura 2). Se encontro que usando los cebadores dTdic1-2/CHI2 que generaban una banda del tamano esperado de 1250 pb, dTdic1 se encontraba dentro del gen CHI en Bagatel (un cultivar de color blanco sin variegacion) y en claveles con flores variegadas UM225, UM226, UM290 y VRB pero no se encontro en muestras de clavel variegado UM302 y CRS, ni en las no variegadas Kaly, XXX y Lady Green (figura 4). Cuando se emplearon los cebadores CHI1/ CHI2, se obtuvieron amplicones de 950 pb, los cuales se esperan cuando dTdic1 esta ausente del gen CHI. Utilizando estos cebadores la linea UM225 amplifico en pruebas posteriores (resultado no mostrado) asi como los extractos de las lineas UM226, UM290, UM302, VRB, XXX, Lady Green, Bagatel, y no amplificaron Kaly y CRS (figura 5), sugiriendo la insercion de algun tipo de elemento dentro del gen CHI. Ninguno de los ensayos de PCR realizados permitio amplificar el elemento dTdic1 dentro del gen DFR.

[FIGURA 3 OMITIR]

[FIGURA 4 OMITIR]

Las secuencias de dTdic1 obtenidas a partir de cuatro clones mostraron identidades del 92-95% con respecto a la secuencia del gen CHI (Gen FI1) de Dianthus caryophyllus, alelo FI1-m, interrumpido por el elemento transponible dTdic1" (numero de accesion AF250367 del GenBank) descrita por Larsen y Brigs en 2000 (Itoh et ai, 2002). La figura 6 muestra los alineamientos de las secuencias "Bagatel CHI" y "VRB CHI". Se observan algunas diferencias puntuales y "gaps" con respecto a la secuencia previamente reportada (figura 6) Las secuencias de dTdic1 obtenidas a partir de los clones obtenidos con cebadores dTdic1F1/dTdic1R1 permitieron identificar las regiones repetitivas que se generan tras un evento de transposicion y los ITRs (secuencias repetidas invertidas) de 12 nucleotidos (figura 7) caracteristicos de la familia de EGTs hAT (van den Broeck et ai, 1998).

Los ensayos de Southern blot realizados en este trabajo, usando una sonda construida contra dTdic1, mostraron que la sonda hibridaba sobre el ADN de las muestras, pero no se observaron bandas bien definidas, a pesar de que se evaluaron varias enzimas de restriccion, temperaturas de hibridacion y diferentes concentraciones de ADN (figura 8). A partir de este resultado se concluyo la presencia de multiples copias de dTdic1 en diferentes lineas de clavel. La figura 8 muestra la hibridacion de la sonda en todas las muestras de clavel, pero no en el control negativo que era ADN de apio.

[FIGURA 5 OMITIR]

[FIGURA 6 OMITIR]

Inicialmente para evaluar la posible expresion de dTdic1 en plantas con flores variegadas y no variegadas, se hicieron ensayos de Northern blot usando la misma sonda con la que se habia detectado este EGT por Southern blot. Para estos ensayos, se hicieron extractos de RNA total, a partir de los cuales posteriormente se extrajo el mRNA usando un kit que emplea perlas conjugadas con cadenas de poliT. A pesar de que se hicieron varios ensayos cambiando las condiciones de hibridacion y la cantidad de RNA, no se obtuvieron senales de hibridacion. Entonces, se hicieron ensayos de dot blot de RNA total, empleando la misma sonda que se habia empleado anteriormente y se detectaron transcritos de dTdic1 (figura 9) en las muestras de RNA total tanto de los claveles con flores variegadas (UM225, UM226, UM302 y UM304) como en no va riegados (XXX, Candy, Kaly y Lady Green). Sin embargo, la sonda no hibrido sobre el mRNA de muestra o la senal estaba por debajo del nivel de deteccion de la prueba.

[FIGURA 7 OMITIR]

[FIGURA 8 OMITIR]

Discusion

La tabla 3 resume los resultados de PCR con los cebadores CHI-1/CHI-2, dTdic1-2/CHI-2 y dTdic1-1/DFR-1 y los resultados de expresion por dot blot usando una sonda complementaria a dTdic1. El EGT se detecto por PCR con los cebadores dTdic1F1/dTdic1R1 en los extractos de todas las lineas de clavel estudiadas, lo cual fue confirmado en las pruebas de Southern blot y dot blot. Con lo anterior se puede afirmar que la sola presencia de dTdic1 en los claveles estudiados no se puede asociar con el fenomeno de variegacion, pues este EGT esta presente y se encuentra activo tanto en lineas que tienen o no variegacion. Una de las causas posibles de la variegacion en petalos es la transposicion de un EGT insertado en algun gen de la ruta metabolica de la biosintesis de pigmentos. Cuando el EGT esta insertado interrumpe la secuencia del gen haciendolo inactivo. Pero cuando el EGT se transpone, deja tras de si el gen mas o menos intacto que puede o no ser funcional nuevamente, permitiendo la sintesis del pigmento. Las celulas descendientes de la celula en la que ocurre la transposicion, seran pigmentadas (Liu et al., 2001; Lida et al., 2004). Sin embargo es importante tener en cuenta que la pigmentacion de los petalos de los claveles es un proceso complejo donde intervienen diversas capas celulares (Itoh et al., 2002) en las que se pueden transponer o no los EGTs) dando lugar a los puntos, estrias y sectores cianicos y blancos que se observan en estos claveles. Los resultados obtenidos en este trabajo aportan informacion sobre el EGT dTdic1, el cual se encontro interrumpiendo el gen CHI de la ruta de biosintesis de antocianinas en claveles hibridos como UM225, UM226, UM290 y VRB y en comerciales como Bagatel (figura 4). La presencia del gen CHI sin interrupciones se observo en Bagatel, Lady Green, Comercial XXX, UM225, UM226, UM 290, UM302 y VBR, pero no fue detectado en Kaly y CRS. Los resultados sugieren que algunas lineas tienen dos o mas copias del gen CHI, una de las cuales puede contener a dTdic1 y la otra no, como seria el caso de Bagatel, UM225, UM226, UM290 y VRB (tabla 3).

[FIGURA 9 OMITIR]

La presencia de dTdic1 se habia reportado interrumpiendo el gen CHI en claveles amarillos variegados (Itoh et al., 2002) pero en este trabajo se presenta evidencia de la presencia del gen CHI interrumpido por dTdic1 en claveles cianicos variegados que presentan flecos y puntos rojos sobre un fondo blanco (UM225, UM226), flecos y puntos rojos oscuros sobre un fondo rojo (UM290) y flecos y puntos rosados sobre un fondo blanco (VRB). En el mismo estudio realizado por Itoh y colaboradores en 2002, la variegacion del cultivar "Rhapsody" (flecos rojos sobre un fondo blanco) se asocio con la interrupcion del gen DFR con dTdic1, pero en este trabajo no se encontro evidencia de insercion de dTdic1 en este gen, en ninguno de los materiales estudiados. Contario a lo esperado, los resultados de PCR y secuenciacion de los amplicones y de los clones, revelaron la presencia de dTdic1 en todos los claveles analizados tanto en los variegados como en los no variegados (figura 3). Esta observacion es importante pues en la literatura solo hay un reporte de dTdic1 y este se asocia unicamente con fenotipos variegados de clavel (Itoh et al., 2002), pero no con plantas con flores de color homogeneo.

Se obtuvieron secuencias del EGT dTdic1 provenientes de cuatro clones obtenidos por clonacion del amplicon de los cebadores dTdic1F1/dTdic1R1 las cuales mostraron identidades del 92-95% con respecto a la secuencia del gen CHI (Gen FI1) de Dianthus caryophyllus, alelo FI1-m, interrumpido por el elemento transponible dTdic1 (numero de accesion AF250367 del GenBank) descrita por Larsen y Brigs (2000) segun (Itoh et al, 2002) (figura 6). Estas secuencias permitieron identificar las regiones repetitivas que se generaron tras un evento de transposicion y los ITRs (secuencias repetidas invertidas) de 12 nucleotidos (figura 7) caracteristicas de los la familia hAT, a la cual pertenece el dTdic1 y los elementos Ac/Ds de maiz y dTphl de petunia (van den Broeck et al, 1998).

No se encontro informacion en la literatura acerca de la abundancia de dTdic1 en el genoma de clavel. Sin embargo, en otros estudios acerca de EGTs de la misma familia, como dTphl, se han reportado desde 10 hasta 207 copias en diferentes lineas de petunia (De Keukeleire et al, 2001). Es posible que la abundancia de dTdic1 en los claveles estudiados sea similar al del elemento de petunia dTphl, razon por la cual tecnica de Southern Blot no permitio la estimacion de su abundancia (De Keukeleire et al, 2001). Van den Broeck y colaboradores (1998) mencionaron el bajo numero de estudios donde se estima la abundancia relativa de elementos geneticos transponibles a nivel de genoma debido a la ausencia de una tecnica alternativa al Southern blot. Por esta razon se ha desarrollado otra metodologia alternativa para la estimacion del numero de copias de EGTs denominada "Transposon Display" (Van den Broeck et al., 1998; Takagi et al, 2006).

La expresion de dTdic1 pudo ser confirmada en todos los claveles estudiados a nivel de RNA total, sin embrago no pudo ser detectada a partir de mRNA extraido. Usando una sonda que hibrida un fragmento de dTdic1, se detectaron en dot blot de RNA total RNAs complementarios en todos los casos, lo que sugiere la transcripcion del EGT. Es posible que los transcritos carezcan de colas de poliA, porque estos no pudieron ser detectados en extractos de mRNA obtenidos mediante columnas de afinidad de poliT. Previamente Itoh y colaboradores (2001) habian realizado un analisis similar buscando los transcritos de mRNA del gen CHI que contenian el inserto de dTdic1, pero estos transcritos no pudieron ser detectados o estuvieron por debajo del nivel de deteccion. Segun los autores, es probable que el elemento dTdic1 estuviera insertado en orientacion reversa, limitando la transcripcion del elemento.

Conclusiones

El EGT dTdic1 se detecto en los extractos de ADN de todos los claveles estudiados, tanto variegados como no variegados. dTdic1 se encontro interrumpiendo el gen CHI en la variedad comercial Bagatel y en cuatro lineas variegadas UM225, UM226, UM290 y VRB. En las lineas restantes no se pudo determinar la posicion de este EGT. La presencia y actividad de dTdic1 fue confirmada mediante PCR, Southern blot y dot blot de extractos de RNA total, y se encontro que la presencia de dTdic1 en los claveles estudiados no se asocio con la variegacion. Las secuencias de dTdic1 presentaron identidades del 92-95% con respecto a la secuencia del gen CHI (Gen FI1) de Dianthus caryophyllus, alelo alelo FI1-m, interrumpido por el elemento transponible dTdic1 (numero de accesion AF250367 del GenBank). En las secuencias obtenidas se identificaron las regiones repetitivas que se asocian a eventos de transposicion y los ITRs (secuencias repetidas invertidas) de 12 nucleotidos caracteristicos de los elementos geneticos transponibles de la familia hAT, a la cual pertenece el dTdic1. En los extractos de RNA total de todos los materiales estudiados, se evidencio la expresion de secuencias complementarias a dTdic1 mediante dot blot, pero no mediante Northern blots de mRNA, lo que sugiere que estos transcritos carecen de colas de poliA. En este trabajo no se encontro evidencia de la presencia de dTdic1 en el gen DFR en ninguno de los materiales estudiados.

Agradecimientos

Agradecemos a la Universidad Militar Nueva Granada por la financiacion del proyecto POST CIAS 471 y al Dr. Juan Jose Filgueira por haber suministrado el material de clavel del Programa de Mejoramiento de Clavel, para este estudio.

Recibido: junio 28 de 2012

Aprobado: noviembre 21 de 2012

Referencias bibliograficas

Babiychuk E., Fuangthong M., Van Montagu M., Inze D and Kushnir S. 1997. Efficient gene tagging in Arabidopsis thaliana using a gene trap approach. Proceedings of the National Academy of Sciences of the United States of America. (94): 12722-12727.

BioEdit (Biological sequence editor for Win 95/98/NT/2K/XP). Disponible en: http://www.mbio.ncsu.edu/bioedit/bioedit.html.

BLAST (National Center of Bioinformatic Information). Disponible en: http://blast.ncbi.nlm.nih.gov/Blast.cgi

Chuck G., Robbins T., Nijjar C., Ralston E., Courtney-Gutterson N. and Donner H.K. 1993. Tagging and cloning of a petunia flower color gene with the maize transposable element Activator. Plant Cell. (5): 371-378.

Davies K. 2009. Modifying Anthocyanin production in flowers en anthocyanins biosynthesis, functions and applications. In: Anthocyanins Gould K, Davies K and Winefield C. Eds. Springer Science Business Media. New Zealand. PP 49-83.

De Keukeleire P., Maes T., Sauer M., Zethof J., Van Montagu M and Gerats T. 2001. Analysis by transposon display of the behavior of the dTphl element family during ontogeny and inbreeding of Petunia hybrida. Molecular Genetics and Genomics. (265): 72-81.

Fernandez G. P. y Filgueira J.J. 2006. Caracterizacion de patrones de variegacion de clavel Dianthus caryophyllus y su posible relacion con resistencia a Fusarium oxysporum En: XLVI Annual meeting American Phytopathological Society Caribbean Division, Cartagena, Colombia.

Feschotte C., Jiang N. and Wesler S. 2002. Plant transposable elements: where genetics meets genomics. Nature. (3): 329-341.

Galun E. 2003. Class II transposable elements in eucariotes en Transposable elements, a guide to the perplexed and the novice. The Weisman Institute of Science. Kluwer Academic Publishers. Netherlands. PP 163-183.

Gatt M., Hammett K, Markham K. and Murria B. 1998. Yellow pinks: interespecific hybridization between Dianthus plumarius and related species with yellow flowers. Scientia Horticulturae. (77): 207-218.

Hoja de datos de la floricultura colombiana 2009 (Asocolflores). Disponible en: http://www.asocolflores.org/

Holley W. and Baker R. 1992. Breeding for better varieties. In: Carnation production II. Holley W and Baker R. Eds. Kendall Publishing Company. Colorado State University.

Huang J., Zhang K., Shen Y., Huang Z., Li M., Tang D., Gu M. and Cheng Z. 2009. Identification of a high frequency transposon induced by tissue culture, nDaiZ, a member of the hAT family in rice. Genomics. (93): 274-281.

Itoh Y., Higeta D., Suzuki A., Yoshida H. and Ozeki Y. 2002. Excision of transposable elements from the Chalcone isomerase and Dihydroflavonol 4-reductase genes may contribute to the variegation of the yellow-flowered carnation (Dianthus caryophyllus). Plant Cell Physiology. (43): 578-585.

Lida S., Morita Y., Choi J.D., Park K.I. and Hoshino A. 2004. Genetics and epigenetics in flower pigmentation associated with transposable elements in morning glories. Advances in Biophysics. (38): 141-159.

Liu D., Galli M. y Crawford N. 2001. Engineering variegated floral patterns in tobacco plants using Arabidopsis transposable element Tag l. Plant Cell Physiology. (42): 419-423.

Ogata J., Itoh Y., Ishida M., Yoshida H. and Yoshihiro O. 2004. Cloning and heterologous expresion of cDNAs encoding flavonoid glucosyltransferases from Dianthus caryophyllus. Plant Biotechnology. (21): 367-375.

Patent Abstract of Japan (Intellectual Property Library). Disponible en : http://ip.com/patapp/JP2007037407A.

Sambrook J. and Russell D. 2001. Molecular Cloning. Cold Spring Harbor Laboratory Press. Volume 1 and 2.

Takagi K., Ishikawa N, Maekawa M., Tsugane K. and Iida S. 2007. Transposon display for active DNA transposons in rice. Genes and Genetic Systems. (82): 109-122.

To K. Y. and Wnag C.K. 2006. Molecular breeding of flower colour. In: Floriculture, Ornamental and Plant Biotechnology. Volume I, Chapter 35. Global Science Books. Uk.

Yoshida H., Itoh Y., Ozeki Y., Iwashina T. and Yamaguchi M. 2004. Variation in chalcononarigenin 2'-O- glucoside contents in the petals of carnations (Dianthus caryophyllus) bearing yellow flowers. Scientia Horticulturae. (99): 175-186.

Van den Broeck D., Maes T., Sauer M., Zethof J., De Keukeleire P., D'Hauw M., Van Montagu M. and Gerats T. 1998. Transposon Display Identifies individual transposable elements in high copy lines. The Plant Journal. (13): 121-129.

Van Houwellingen A., Souer E., Spelt K., Kloods D., Mol J. and Koes R. 1998. Analysis of flower pigmentation mutants generated by random transposition mutagenesis in Petunia hybrida. The Plant journal. (13): 39-50.

Karen Rocio Lopez Castro *, Liliana Franco-Lara **

* MSc, Laboratorio de Biotecnologia Vegetal, Facultad de Ciencias, Universidad Militar Nueva Granada, karen.lopez@unimilitar.edu.co

** MSc., PhD, Laboratorio de Biotecnologia Vegetal, Facultad de Ciencias, Universidad Militar Nueva Granada, liliana.franco@unimilitar.edu.co
Tabla 1. Cebadores para la amplificacion de dTdicl
(Itoh et al., 2002)

Cebador                 Secuencia 5'-3'

dTdic1-2           CAGGGGTTTTAAATATCGGTATCG
CHI-2              AGGAGCTAACTCAAGGAGACCACTT
CHI-1      GTGAATTAGTTTAAGAGTTTACGAACTTCTCAACACGTTA
CHI-2              AGGAGCTAACTCAAGGAGACCACTT
dTdicl-1   CCGTCGGCCAGGGTTCAAAATCTCGGCCGAGTTGACTCGT
DFR-1              GCTGCGTACTTCCACGCTGCTTGCT

Cebador    Direccion   Tm [grados]C

dTdic1-2    Forward         56
CHI-2       Reverse         56
CHI-1       Forward         59
CHI-2       Reverse         59
dTdicl-1    Forward         65
DFR-1       Reverse         65

Tabla 2. Cebadores disenados en este trabajo para la
amplificacion de dTdicl

Primer           Secuencia5'-3'        Direccion   Tm [grados]C

dTdic1-F1       ACGGTATCGGCCCTGA        Forward        55,8
dTdic1-F2   CCTGAATCGCTTGTCTCGGACTAT    Forward        58,3
dTdic1-R1      GACGAGATAGGGCGAGA        Reverse         53
dTdic1-R2      GCCGAGTTGACTCGGAA        Reverse        54,7
dTdic1-R3   TAGGGCGAGATTTCACGGACCTTT    Reverse        60,1

Tabla 3. Relacion entre diferentes fenotipos de
flores de clavel y la presencia de dTdicl en
los genes CHI y DFR.

Fenotipo          Clavel       Presencia    Gen CHI
                               de dTdicl   con dTdicl

Color entero   Bagatel            Si           Si
Color entero   Kaly               Si           No
Color entero   Lady Green         Si           No
Color entero   Comercial XXX      Si           No
Variegado      UM225              Si           Si
Variegado      UM226              Si           Si
Variegado      UM290              Si           Si
Variegado      UM302              Si           No
Variegado      VRB                Si           Si
Variegado      CRS                Si           No

Fenotipo        Gen CHI      Gen DFR     Transcritos
               sin dTdicl   con dTdic1    de dTdic1

Color entero       Si           No           Si
Color entero       No           No           Si
Color entero       Si           No           Si
Color entero       Si           No           Si
Variegado          Si           No           Si
Variegado          Si           No           Si
Variegado          Si           No           Si
Variegado          Si           No           Si
Variegado          Si           No           Si
Variegado          No           No           Si
COPYRIGHT 2012 Universidad Nacional de Colombia, Instituto de Biotecnologia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:ARTICULO DE INVESTIGACION
Author:Lopez Castro, Karen Rocio; Franco-Lara, Liliana
Publication:Revista Colombiana de Biotecnologia
Date:Dec 1, 2012
Words:5480
Previous Article:Primer reporte de empleo de marcadores AFLP en Asteraceae en Cuba.
Next Article:Cultivo de tejidos de piper sp.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters