Printer Friendly

Potential molecular basis of the chondroprotective effect of Harpagophytum procumbens.

For more than 50 years preparations of Harpagophytum procumbens DC have been used in Europe for the treatment of rheumatic entities (Anonymus, 2003). A first citation dates back to 1958, when Zorn at the University of Jena/Germany described his observations on the antiphlogistic and antiarthritic effects after administration of oral aqueous extracts prepared from the secondary roots of H. procumbens in patients suffering from arthritides. Efficacy was also shown in rats, in which arthritis was experimentally induced by formaldehyde. He observed also that cessation of the treatment was not associated with immediate cessation of the healing effect (Zorn, 1958). In the meantime, a body of evidence has been collected addressing the effectiveness of certain Harpagophytum preparations with a daily dose of > 50 mg of harpagoside (a co-active ingredient) in the treatment of painful osteoarthritis of the hip, knee and non-specific low back pain (Chrubasik et al., 2002, 2003, 2005). In-vitro data demonstrated that the active principle (sum of co-active constituents) of H. procumbens inhibits not only inflammatory mediators such as COX-2 mediated prostaglandin (Fiebich et al., 2001; Jang et al., 2003; Huang et al., 2005) or leukotriene (Loew et al., 2001) release but also mediators of cartilage destruction, such as TNF-[alpha], interleukin-1[beta], matrix metalloproteinases, nitric oxide (Fiebich et al., 2001; Huang et al., 2005; Schulze-Tanzil et al., 2004) and elastase (Boje et al., 2003). In order to see if the in vitro data may be a surrogate marker for cartilage protection, we used an animal model of osteoarthritis to assess the effectiveness of Harpagophytum extract following joint destabilization. Six months post-injury, the effects on morphometric, histological and biochemical parameters of cartilage matrix were assessed.

The study protocol was approved by the Veterinarian Ethics Committee of the University of Frankfurt and the governmental authority in Darmstadt. Twenty-three adult female white New Zealand rabbits (mean weight 4.6 [+ or -] 0.28 kg (SD)) underwent unilateral transection of the anterior cruciate ligament and removal of the medial meniscus of the right knee. The left knees served as intra-individual controls. The rabbits were divided into two groups. Group H (H, n = 11) received standard food pellets with added Harpagophytum extract FB9195 (14% harpagoside, Fig. 1) ad libitum based on 150mg extract per day with 0.1 mg harpagoside per gram pellets. The control group (C, n = 12) received standard pellets. The rabbits were placed in large individual cages and were forced to move every day. At sacrifice, after 27 weeks, both knee joints were removed to undergo macroscopic and histological evaluation (separate publication). Articular cartilage from the right and left heads of femur were removed manually and cut into three parts (1) to be stored in buffered formalin 4-6% for later histomorphometric investigations, (2) to be immersed in liquid nitrogen before embedding into Jung GmbH (020108926) medium for later histological analysis and, (3) for immediate extraction of RNA for reverse DNA transcriptase production and gene expression analyses of molecules known to be involved in cartilage metabolism and known rabbit gene sequences. These primer sequences were: biglykan forward: GCGCATCT CAGAAGCCAAGC; biglykan reverse: CGTTGT AGTAGGCCCGCTTC; aggrecan-2 forward: GCCTGTGGTGTGCGGTGGTG; aggrecan-2 reverse: GGACCCCAGGACCCCCAGTT; osteonectin forward: ACCCCCATGTGCG TGTGCCA; osteonectin reverse: ACGCA GTGGGGCCAGCTCAG; TIMP-2 forward: ACGGCAACCCCATCAAGAGGA; TIMP-2 reverse: GGAGTCCCAGGGCAC GATGAA. For further details of the methods see http://remed-chrubasik.uniklinik-freiburg.de.

[FIGURE 2 OMITTED]

During preparation of the cartilage specimens, the respective investigators (MFM, SC) discovered a macroscopical thickening of the cartilage of the right hip. However, the morphometric investigation did not correlate with per cell count or with cell density of the right and left hips of the rabbits or between the hips of Harpagophytum-treated and untreated rabbits (see webpage). Haematoxylin, safranin and elastin stainings showed a trend towards chondroid regeneration and increased elastic and collagen fibres in the hip cartilage of the surgically altered limb of the Harpagophytum-treated rabbits, although this was only statistically significant in the elastin stainings (Fig. 2). Of the examined genes, TIMP-2 mRNA showed a 2- and 5-times increase in two rabbits treated with Harpagophytum extract compared to the maximum TIMP-2 mRNA concentration in the control group.

In summary, these results suggest that one of the mechanisms of the therapeutic effect of H. procumbens may be a chondroprotective effect in which the tissue inhibitor of metalloproteinase-2 (TIMP-2) is involved.

References

Anonymus, 2003. Harpagophyti radix. In: ESCOP Monographs (Eds.), European Scientific Cooperative on Phytotherapy. Thieme-Verlag, Stuttgart, New York, pp. 233-240.

Boje, K., Lechtenberg, M., Nahrstedt, A., 2003. New and known iridoid- and phenylethanoid glycosides from Harpagophytum procumbens and their in vitro inhibition of human leukocyte elastase. Planta Med. 69, 820-825.

Chrubasik, S., Thanner, J., Kunzel, O., Conradt, C., Black, A., Pollak, S., 2002. Comparison of outcome measures during treatment with Doloteffin[R]. Phytomedicine 9, 181-194.

Chrubasik, S., Conradt, C, Black, A., 2003. The quality of clinical trials with Harpagophytum procumbens. Phytomedicine 10, 613-623.

Chrubasik, S., Kunzel, O., Thanner, J., Conradt, C., Black, A., 2005. A one-year follow-up after a pilot study with Doloteffin[.sup.R] for low back pain. Phytomedicine 11, 470-477.

Fiebich, B.L., Heinrich, M., Hiller, K.O., Kammerer, N., 2001. Inhibition of TNF-[alpha] synthesis in LPS-stimulated primary human monocytes by Harpagophytum extract SteiHap 69. Phytomedicine 8, 28-30.

Huang, T.H., Tran, V.H., Duke, R.K., Tan, S., Chrubasik, S., Roufogalis, B.D., Duke, C.C., 2005. Harpagoside suppresses lipopolysaccharide-induced iNOS and COX-2 expression through inhibition of NF-kB activation. J. Ethnopharmacol. 13, 11-15.

Jang, M.H., Lim, S., Han, S.M., Park, H.J., Shin, I., Kim, J.W., Kim, N.J., Lee, J.S., Kim, K.A., Kim, C.J., 2003. Harpagophytum procumbens suppresses lipopolysaccharide-stimulated expressions of cyclooxygenase-2 and inducible nitric oxide synthase in fibroblast cell line L929. J. Pharmacol. Sci. 93, 367-371.

Loew, D., Mollerfeld, J., Schrodter, A., Puttkammer, S., Kaszkin, M., 2001. Investigations on the pharmacokinetic properties of Harpagophytum extracts and their effects on eicosanoid biosynthesis in vitro and ex vivo. Clin. Pharmacol. Ther. 69, 356-364.

Schulze-Tanzil, G., Hansen, C., Shakibaei, M., 2004. Effect of a Harpagophytum procumbens DC extract on matrix metalloproteinases in human chondrocytes in vitro. Arzneimittel-Forsch. 54, 213-220.

Zorn, B., 1958. Uber die antiarthritische Wirkung der Harpagophytum-Wurzel. Deutsche. Rheumaforschung. 134-138.

J.E. Chrubasik, E. Neumann, U. Muller-Ladner Department of Rheumatology and Clinical Immunology, Kerckhoff Clinic Bad Nauheim and Chair for Internal Medicine and Rheumatology, University of Giessen and Marburg, Benekestrasse 2-8, D-61231 Bad Nauheim, Germany

J.E. Chrubasik, M. Faller-Marquardt, S. Chrubasik

Institute for Forensic Medicine, Albert-Ludwig-University Freiburg, Albertstrasse 9, D-79104 Freiburg, Germany

E-mail address: sigrun.Chrubasik@klinikum.uni-freiburg.de (S. Chrubasik)

E. Lindhorst

Department of Surgery, Wolfgang Goethe-University, Theodor Stern-Kai 7, 60590 Frankfurt/Main, Germany

U. Gerlach

Institute for Pathology, Albert-Ludwig-University Freiburg, Albertstrasse 9, D-79104 Freiburg, Germany

T. Torda

School of Medical Sciences, University of New South Wales, Sydney 2033, Australia
Figure 1. HPLC-fingerprint of the 14% Harpagophytum extract FB9195,
Finzelberg, Andernach, Germany (references harpagoside HF-HO3 and
methylcinnamate HF-MO6).

Column: LiChroCART 100 Merck, Darmstadt, RP 18, end-capped, 0.2 [micro]m
Solvent A: water; solvent B: methanol, isocratic:

Min A B

 0 0.75 0.75
20 Stop

Flow rate: 1.5 ml/15 min, injection volume 10 [micro]l, detection 278 nm
UVvis, temperature 40 [degrees]C.
COPYRIGHT 2006 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:LETTER TO THE EDITOR
Author:Chrubasik, J.E.; Neumann, E.; Muller-Ladner, U.; Faller-Marquardt, M.; Chrubasik, S.; Lindhorst, E.;
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Date:Sep 1, 2006
Words:1187
Previous Article:Further evidence on the effectiveness of potato juice in dyspeptic complaints.
Next Article:Natural Medicines Comprehensive Database.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |