Printer Friendly

Polymorphisms within the protein tyrosine phosphatase 1B (PTPN1) gene promoter: functional characterization and association with type 2 diabetes and related metabolic traits.

Type 2 diabetes (T2D) [8] is a heterogeneous disorder that results from a combination of environmental and genetic factors (1), which contribute to its pathogenesis by influencing [beta]-cell function and tissue insulin sensitivity (2-4). Insulin resistance (IR) is the core defect in T2D (5). The molecular mechanisms underlying IR are poorly understood but appear to include defects in the signal transduction pathway downstream of the insulin receptor (6). Protein tyrosine kinases and protein tyrosine phosphatases are important regulators of insulin signal transduction. Recently, much attention has been directed toward protein tyrosine phosphatase, nonreceptor type 1 (PTPN1)[9] which negatively regulates the phosphorylation of insulin receptor and insulin receptor substrates (7,8).

Several studies investigated the association of PTPN1 single-nucleotide polymorphisms (SNPs) with traits related to T2D. Mok et al. (9) reported an association between an SNP in exon 8 and impaired glucose tolerance and T2D in Canadian aboriginal individuals. Similarly, Echwald et al. (10) observed an association of a coding SNP (P387L) with T2D in Danes. Di Paola et al. (11) identified a nucleotide insertion in the 3' untranslated region (UTR) that was associated with IR in obese individuals. Bento et al. (12) and Palmer et al. (13) investigated common variants in PTPN1 and found association with T2D and IR. Olivier et al. (14) observed a strong association between common haplotypes and hypertension, and also between individual SNPs and lipids and obesity, in Japanese and Chinese individuals. Florez et al. (15) studied 42 SNPs spanning 112 kb and selected partly from the HapMap Phase I database and partly from those previously studied but found no association between selected tag SNPs or haplotypes and T2D or diabetic phenotypes.

Human studies have demonstrated that PTPN1 expression increases in obese individuals and those with T2D (16,17). The effect of genetic variations on gene expression is one of the most likely mechanisms by which such variations can contribute to complex diseases such as T2D; obviously, gene promoter regions are the best targets to look for variations that affect gene expression and contribute to traits in health and disease. Few efforts have been made to identify variants within the PTPN1 promoter region and investigate their relationships with T2D and its related traits. In the present study, we hypothesized that variants in the PTPN1 promoter region not previously studied, identified, or well captured by variants available on HapMap Project Phase I (18) or in Phase II (release 19) at the [r.sup.2] = 0.8 cutoff might affect T21) and related traits.

Patients and Methods

STUDY PARTICIPANTS

We initially recruited 639 unrelated Iranian individuals ages 23 to 79 years. After excluding 43 individuals with abnormal glucose tolerance based on the WHO 1997 criteria (19) and 12 diabetic patients who were being treated with insulin, we performed genetic association analysis on 412 nondiabetic and 174 diabetic individuals. Written informed consent was obtained from all participants before enrollment in the study.

A detailed description of the study population has been published (20). Screening included standardized questionnaires on personal data and clinical measurements such as age, sex, obesity, drug consumption during the past month, and medical or family history of diabetes. All those who were not taking diabetes medication underwent a 2-h oral glucose tolerance test (OGTT) after an overnight fast. Criteria for control selection was fasting glucose <6.1 mmol/L and 2-h plasma glucose <7.8 mmol/L after OGTT. Diabetes was defined as fasting glucose [greater than or equal to] 7.0 mmol/L, 2-h glucose [greater than or equal to]11/1 mmol/L after OGTT, or use of hypoglycemic medication.

LABORATORY MEASUREMENTS

Blood samples were taken at 0 and 120 min. We measured glucose, total cholesterol, triglycerides, and HDL cholesterol using enzymatic methods on the Technicon[R] analyzer RATM 1000 (Technicon Instruments). We measured serum concentrations of insulin by RIA (Bio-Source Europe).

CLASSIFICATION CRITERIA

IR was assessed from glucose and insulin concentrations by use of the homeostasis model assessment of IR (HOMA-IR) equation (21). Hypertension was defined as systolic blood pressure [greater than or equal to]85 mmHg, diastolic blood pressure [greater than or equal to] 130 mmHg, or use of antihypertensive medication; parental history of diabetes was based on self-reported diabetes in one or both parents (22).

VARIATION DETECTION

We screened variations by PCR and denaturing HPLC and confirmed them by direct sequencing. We used 8 sets of primers to amplify overlapping regions of the PTPN1 promoter from chromosome 20:48 558 283 to 48 560 496, corresponding to -2044 to +169 of the transcription start site. Primer sequences and PCR conditions are listed in Table 1. We performed initial screening on genomic DNA of 100 patients with T2D and 100 nondiabetic individuals (400 chromosomes in total) by denaturing HPLC using a Transgenomic WAVE HT DNA Fragment Analysis System (Transgenomic, Inc.). We confirmed all variants identified by denaturing HPLC by sequencing in both directions.

GENOTYPING

We performed genotyping with either PCR-RFLP or denaturing HPLC. Genotyping of the -467T>C variant was carried out by PCR amplification of a 269-bp segment using the following primers: forward, 5'-TTC ATT CCT GCA GCA CCC AAG-3', and reverse, 5'-GTT GAG TCA CAG AGT GAG TGG-3'. The rare variant creates a restriction site (RS) for the Aval enzyme, which cuts the PCR amplicon into 163 and 106 by for a homozygous variant and 269, 163, and 106 by for a heterozygote. For genotyping -1023C>A SNP, genomic DNA was PCR-amplified using the following primers: forward, 5'-TAG CAG AAA CCG AGT TTC ACC-3', and reverse, 5'-CCT GGG TAA CAG AAT CAG ACC-3'. The SNP creates an RS for Bc1l, which cuts the 312-bp PCR amplicon into 249and 63-bp fragments for variant homozygote. The -1045G>A was genotyped with mismatch PCR-RFLP. Briefly, the PTPN1 promoter was amplified using a forward primer (5'-TCT GTT GAG ACC CTA ATG CCA GAA-3') and a mutagenic reverse primer (5'-GGA TCA CCT GAG GTC AAG AGgC-3'). For the latter, a T>G substitution was engineered at the penultimate primer base (shown above in lowercase). The presence of G at the variant position then created an artificial RS for BsuRI within the amplicon. The expected products after the digestion of the 268-bp amplicon with BsuRI were 268 by for a wild-type homozygote; 245 and 23 by for a variant homozygote; and 268, 245, and 23 by for a heterozygote. Denaturing HPLC was used to genotype the -51delA, -451A>G, 3-bp insertion-deletion, and 9-bp insertion-deletion variants. To identify the homozygotes for these polymorphisms, aliquots of a known wild-type sample were pooled with the unknown DNA samples before the reannealing step to enable heteroduplex formation before injection into denaturing HPLC.

GENOTYPING OF THE -1023C>A IN HAPMAP SAMPLES

The -1023C>A was genotyped in 90 HapMap Centre d'Etude du Polymorphisme Humain samples. We added the genotypes to those of HapMap samples (Phase II, release 19, 2005) for all markers in a 200-kb interval encompassing the PTPN1 gene. We used Haploview software (23) to produce the linkage disequilibrium (LD) structure.

CELL CULTURE

We obtained HepG2 cells from ATCC and cultured at 37'C under 5% [CO.sub.2] in DMEM (Gibco-BRL) supplemented with 10% fetal calf serum and 100 000 units/L penicillin/ streptomycin.

TRANSFECTION AND LUCIFERASE REPORTER ASSAY

We prepared 4 constructs from human genomic DNA obtained from participants with the -1023C>A and -51delA genotypes. The oligonucleotides spanned the DNA sequence from -1100 (from the transcription start site) to +169 by for -1023C>A and from -545 to +169 by for -51delA. We introduced the HindIII and Xhol sites at the ends of the PCR products that were cloned into the PGL3-Basic vector (Promega) after subcloning to the pcR2.1 TOPO. The sequences of the primers used are listed in Table 1 in the Data Supplement that accompanies the online version of this article at http: //www.clinchem. org/content/vo153/issue9. We transiently transfected HepG2 cells with 1-[micro]g constructs using Fugene6. Ten hours after transfection, we treated the cells with 5.5 or 22.5 mmol/L glucose and 100 nmol/L insulin. Forty-eight hours posttransfection, we carried out the luciferase assay using the Dual-Luciferase Reporter Assay System (Promega). To control transfection efficiency, we mixed 0.25 [micro]g pRL-TK plasmid (Renilla luciferase under control of TK promoter; Promega) with experimental DNA. We performed parallel transfections with positive control vector (SV40-PGL3) and negative control vector (PGL3 with no insert). Firefly luciferase activity was normalized for Renilla luciferase activity. We repeated each transfection 6 times in triplicate, and data were averaged.

ELECTROPHORETIC MOBILITY SHIFT ASSAYS

Synthesized wild-type and mutated oligonucleotides were 3'-end labeled with biotin-11-dUTP using the Biotin 3'-end DNA labeling reagent set (Pierce). The sequences of the used upper strands of the oligonucleotides are listed in Table 2 in the online Data Supplement. We performed electrophoretic mobility shift assays (EMSAs) by use of the LightShift Chemiluminescent EMSA reagent set (Pierce) on nuclear extract of HepG2 cells. For competition experiments, we added unlabeled wild-type, mutant, sterol regulatory element-binding protein (SREBP), Sp, and Egr1-consensus oligonucleotides in a 100-fold molar excess before the addition of the biotinylated probes.

STATISTICAL ANALYSIS

We performed statistical analysis by use of SAS (SAS Institute) and considered a 2-sided value of P <0.05 to be statistically significant. Baseline quantitative results are expressed as mean (SD). Concentrations of triglycerides, insulin, and HOMA-IR were log transformed. To determine the predictors of diabetes risk in this data set, we performed stepwise logistic regression analyses. We calculated odds ratios (ORs) and 95% CIs for diabetes from the regression model estimates conditioned on clinical covariates. Binary covariates included sex, hypertension, parental history of diabetes, and smoking. Continuous covariates included age, body mass index, waist circumference, HDL cholesterol, triglycerides, and HOMA-IR. Except for age, we included all continuous covariates in the model per interquartile range increase to allow easier interpretation of their relative effect size. We used an additive model for the -1023C>A variant and included it in the models. We estimated allele frequencies by gene counting. We used analysis of covariance to determine associations of -1023C>A and -51delA variants with diabetes-related traits after adjusting for age and sex. We used the [chi square] test to evaluate deviation from Hardy-Weinberg equilibrium and to compare categorical variables. We assessed LD between SNPs using D' (24) and [r.sup.2]. We performed power calculations by use of the program by Purcell et al. (25), available at http:// statgen. iop.kcl.ac.uk/gpc.

Results

BASELINE CHARACTERISTICS OF STUDY SAMPLES

We included 586 Iranian individuals in the analyses of genetic association. All studied biomarkers significantly differed between the diabetic and the control groups (Table 2).

GENOMIC DNA SCREENING OF THE PTPN1 PROMOTER

Primary analysis of 2.0 kb of the PTPN1 promoter in 200 individuals revealed 7 variants: a deletion of A nucleotide at position -51 (-51deIA), 4 SNPs (-451A>G, -467T>C, -1023-C>A, and -1045G>A), a 3-bp insertion-deletion (-1286 to -1288), and a 9-bp insertion-deletion (-1291 to -1299; Table 3). At the time of the present study, only -1023C >A had been submitted to the public SNP database (http://www.ncbi.nlm.nih.gov/ SNP), corresponding to dbSNP entry rs6126029. Allele and genotype frequencies of each variant, as well as genomic position, are shown in Table 3. None of the genotype frequencies significantly deviated from Hardy-Weinberg equilibrium. The frequency of the A allele of -1023C>A SNP significantly differed between the T2D and nondiabetic individuals (P = 0.020), whereas the difference in the genotype frequency between the 2 groups approached borderline significance (P = 0.069; Table 3). None of the other markers was significantly associated with T2D.

To verify the association observed between the -1023C>A variant and T2D, we performed stepwise logistic regression analysis, which included the genotypes of -1023C>A variant, assuming an additive model along with established risk factors for T2D (Table 4). Age, parental history of diabetes, HOMA-IR, smoking, and hypertension were the only significant predictors of T2D, suggesting that the -1023C>A genotype is not an independent risk factor for T2D in this population.

POWER CALCULATION

Considering the minor allele frequency (MAF) of the -1023C>A and -51delA variants and 0.8 D' with the risk allele, and the ORs of 1.5 and 15% for frequency of the disease allele, our case-control provides 37% and 11% power, respectively, to detect associations between -1023C>A and -51delA variants and T2D.

ASSOCIATION ANALYSIS OF PTPN1 PROMOTER GENE VARIANTS WITH BIOCHEMICAL AND CLINICAL PHENOTYPES

We used a general linear model analysis to assess the relationship of genotypes of -1023C>A and -51delA with biochemical and clinical features in the diabetic and control groups separately. Covariates included age, sex, body mass index, and use of antihypertensive or lipid-lowering medication. No significant differences (P <0.05) in anthropometric or biochemical features were observed between the wild-type and heterozygous individuals at -51delA and -1023-C>A variants in the T2D group or controls (data not shown).

Pairwise D' statistics were calculated for the identified PTPN1 promoter variants (see Table 3 in the online Data Supplement). The -451A>G variant is in complete LD with -467T>C ([r.sup.2] = 1.00). All other variants had low LD between each other.

To investigate whether -1023C>A SNP was captured well by the previously studied SNPs, this variant was genotyped in the same 30 trio Centre d'Etude du Polymorphisme Humain samples that have been genotyped in the HapMap project (Phase 11, release 19). The MAF of -1023C>A in HapMap samples was 6.7%. With Phase 11 release 19 of HapMap and examination of a 200-kb interval, -1023C>A could be tagged by itself only if an [r.sup.2] cutoff of 0.8 was used. The highest [r.sup.2] between -1023C>A and other markers was 0.75 with rs6126033 (see Table 4 in the online Data Supplement).

EFFECT OF THE -1023C>A AND -51delA POLYMORPHISMS ON PROMOTER ACTIVITY

We used Genomatix to perform a bioinformatics search for potential binding sites for transcription factors at the sites of -1023C>A and -51delA variations (http://www. genomatix.de/products/GEMSLauncher/GEMSLauncher2. html). The search identified potential binding sites for C2H2 zinc finger proteins, such as the specificity protein (SP) family and Egr1 at -51delA and SREBP at -1023C>A. To validate these sites experimentally, we assessed the effect of the 2 variants on PTPN1 promoter activity by the luciferase reporter assay. As shown in Fig. 1, there was no difference in luciferase activity between the 2 alleles of the -1023C>A variant in the absence or presence of 5.5 or 22.5 mmol/L glucose and 100 nmol/L insulin. Constructs containing -51delA genotype showed 2-fold lower PTPN1 promoter activity compared with the wild-type construct in the absence or presence of 5.5 or 22.5 mmol/L glucose and 100 nmol/L insulin (P <0.001; Fig. 1).

DETERMINATION OF THE BINDING OF NUCLEAR PROTEINS BY EMSA

We performed EMSA to further verify the potential binding sites for transcription factors at -1023C>A and -51delA variations. As shown in Fig. 1 in the online Data Supplement, 2 complexes, A and B, were retarded when the -1023C/A DNA fragments were used as probes. In unlabeled probe competition assays, excess of oligonucleotide A or C and SREBP consensus sequence eliminated the binding of complex B. The result suggests that a similar specific DNA-protein complex was formed with both -1023C and -1023A. We also performed EMSA on nuclear extracts of HepG2 and labeled -51A, -51delA, Sp, and Egr1 probes. The results indicated that there are 3 complexes that specifically bind to the labeled probes. The 2 upper complexes correspond to the Sp consensus sequence, whereas the lower complex corresponds to the Egr1 consensus sequence (Fig. 2). Competition assay with unlabeled probes disrupted the binding of all labeled probes with nuclear proteins. As shown in Fig. 2A, the affinity of SP family proteins to the A allele was visibly higher than that to the delA (Fig. 2, lane 7 vs lane 2).

[FIGURE 1 OMITTED]

Discussion

PTPN1 is a negative regulator of the insulin signaling pathway (16). The importance of PTPN1 for several crucial metabolic pathways has been illustrated in mice deficient for this phosphatase (26). These observations suggest that PTPN1 plays a role in attenuating insulin signal transduction. Variations in the PTPN1 promoter might affect gene regulation and could therefore be associated with T2D (7). Several studies have investigated the association of variants in the PTPN1 gene with T2D (9-15,27-31), but none has included sequence analysis of the PTPN1 promoter region. Our study is the first to do so, and because we analyzed 400 chromosomes, we were able to identify variants even with low allele frequency.

[FIGURE 2 OMITTED]

Both common and rare variants are expected to contribute to common diseases, as illustrated by the finding in the PCSK9 gene of a spectrum of alleles with a wide range of allele frequencies (0.2%-34%) associated with LDL cholesterol and magnitude of phenotypic effects (approximately 3% increase to 49% reduction in LDL cholesterol) (32).

Identifying SNPs in the promoter region of the PTPN1 gene and testing their relations to T2D and its related traits is particularly important, because this region seems to be an SNP-poor area in the HapMap Project (Phase II, release 19), for which the first available SNP (rs602O563) is >7 kb upstream exon 1 in PTPN1 gene. PCR-denaturing HPLC analysis of 2.0 kb spanning the PTPN1 promoter region identified 7 polymorphisms, which were then investigated in our entire sample. In the dbSNP genome build 36.2, 7 SNPs were observed to map to the scanned area (see Table 5 in the online Data Supplement). None of these SNPs were detected in our scan. However, the sample size used to identify most of these SNPs was only 2, and the variation status for these SNPs is not verified, which casts doubts about their presence. Of the variants identified in our scan, only the -1023A allele seemed to be associated with a protective effect against T21) at P <0.05, but this association disappeared after adjusting for established T2D risk factors. An [r.sup.2] = 0.8 cutoff was suggested to be able to capture both haplotype- and clade-specific patterns of variation (33). The highest [r.sup.2] of -1023C>A with SNPs contained in a 200-kb interval harboring PTPN1 in HapMap Phase II, release 19, 2005, was with rs6126033 (intron 1, position = chromosome 20:48 579 516). Two more variants (rs11698821 in intron 3 and rs2230604, a synonymous variant in exon 8) that were added to the Phase II, HapMap release 22, 2007, have the same [r.sup.2] as the -1023C>A variant. Florez et al. (15) studied rs2230604 but found no association with T21). To our knowledge, no study has investigated rs6126033 or rs11698821 in T2D. None of these variants seems to have functional importance.

Given the low MAF of the -1023C>A and -51Ade1 variants, we would have only 37% and 11% power, respectively, to detect association with T2D. Assuming ORs of the risk allele of 1.5 or 2.0 with 10% frequency and an 8% prevalence of T2D, we would need 2163 and 733 cases to detect association with the -51de1 variant, and 426 and 146 cases to detect association with the -1023 variant with 80% power at the <0.05 level. Table 6 in the online Data Supplement includes the number of samples needed to have 80% power to detect association with the -1023C>A and -51delA variants at different ORs. Our reporter assay studies showed no differences between -1023 C and A alleles on PTPN1 promoter activity in HepG2 cells. EMSA experiments suggest binding of the oligonucleotide that contains the -1023 variant alleles to SREBP in HepG2 cell nuclear extract. However, oligos that contain A or C alleles of this variant equally bind to SREBP. These observations suggest that the -1023C>A variant has no functional role in T2D by modulating PTPN1 gene expression. In contrast, the -51delA genotype lowered the transcriptional activity in transient transfection experiments by 2-fold in comparison to the wild-type allele. This finding was confirmed by EMSA, in which -51A-containing oligonucleotide markedly bound more SP proteins than -51Ade1(Fig. 2, lane 7 vs lane 2), implying a lower affinity of -51delA allele to binding SPs.

Several studies reported association between variants in the PTPN1 and T2D or related traits in Hispanics (20-26), African Americans (34), or white twins (14). However, Florez et al. (15) studied 42 SNPs in 7883 individuals and disclosed no association between individual SNPs and haplotypes with T2D. Because no variants in the promoter region of PTPN1 were available at the time when those studies were conducted, such SNPs could not be included upon selecting tag SNPs (Florez et al. (15)); therefore, this method may have resulted in missing some variants that could or could not be associated with T2D.

We could not detect any influence of the -1023C>A and -51delA variants on diabetes-related traits in the study groups. In fact, we observed a trend toward association between glucose and HOMA-IR levels and -51delA (P = 0.09 and 0.10, respectively; data not shown). The reason that we observed an effect of the -51delA SNP on reporter gene expression but not on T2D-related traits might be a tissue-specific effect.

In conclusion, our study in a sample of Iranian T2D cases and controls identified several SNPs, of which the -1023C>A SNP was the most frequent, but with no effect on PTPN1 expression or association with T2D and related metabolic traits after adjustment for established T2D risk factors. In addition, the rare -51delA variant significantly reduced the transcription of the luciferase reporter gene as well as the affinity to binding SP family proteins in HepG2 cells but had no significant physiological effect on T2D-related traits at P <0.05 in our sample. Ruling in or out a possible role of these 2 variants in T2D and related traits requires investigating them in a larger population.

Grant/funding support: This work was financially supported by a grant from the Pasteur Institute of Iran (to M.T. and B.L.) and by an operating grant from the Heart and Stroke Foundation of Ontario (to K.A.).

Financial disclosures: None declared.

Acknowledgments: We greatly appreciate the assistance provided by staff of the Department of Biochemistry, Pasteur Institute of Iran; the Endocrinology and Metabolism Research Center of Shariati Hospital, Tehran University of Medical Sciences; Dr. Babak Shababa of the University of Toronto; and Dr. Peter Ray and Liping Han, Division of Molecular Genetics, the Hospital for Sick Children, University of Toronto. We also thank all volunteers for their participation in the study.

Received February 25, 2007; accepted June 20, 2007.

Previously published online at DOI: 10.1373/clinchem.2007.088146

References

(1.) Hamman R. Genetic and environmental determinants of non-insulin dependent diabetes mellitus (NIDDM). Diabetes Metab Rev 1992;8:287-338.

(2.) Iselius L, Lindssten J, Morton NE, Efendic S, Serasi E, Haegermark A, et al. Genetic regulation of the kinetics of glucose-induced insulin release in man: studies in families with diabetic and non-diabetic probands. Clin Genet 1985;28:8-15.

(3.) Bugardus C, Lillioja S, Nyomba BL, Zurlo F, Awinburn B, Esposito-Del Puente A, et al. Distribution of in vivo insulin action in Pima Indians as mixture of three normal distributions. Diabetes 1989; 38:1423-32.

(4.) Goldstein B.I. Insulin resistance as the core defect in type 2 diabetes mellitus. Am J Cardiol 2002;90:3G-10G.

(5.) Olefsky JM, Garwey WT, Henry RR, Brillon D, Matthhaei S, Freidenberg GR. Cellular mechanisms of insulin resistance in non-insulin-dependent (type II) diabetes. Am J Med 1988;85:86-105.

(6.) Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 113: possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J Biol Chem 2000;275:4283-9.

(7.) Kenner KA, Anyanwu E, Olefsky, JM, Kusari J. Protein tyrosine phosphatase 1B is a negative regulator of insulin and insulin-like growth factor-I-stimulated signaling. J Biol Chem 1996;27: 19810-6.

(8.) Kennedy BP, Ramachandran C. Protein tyrosine phosphatase-1B in diabetes. Biochem Pharmacol 2000;60:877-83.

(9.) Mok A, Cao H, Zinman B, Hanley AJ, Harris SB, Kennedy BP, et al. Single nucleotide polymorphism in protein tyrosine phosphatase PTP-1B is associated with protection from diabetes or impaired glucose tolerance. J Clin Endocrinol Metab 2002;87:724-7.

(10.) Echwald SM, Bach H, Vestergaard H, Richelsen B, Kristensen K, Drivsholm T, et al. A P387L variant in protein tyrosine phosphatase-1B (PTP-1B) is associated with type 2 diabetes and impaired serine phosphorylation of PTP-1B in vitro. Diabetes 2002;51:1-6.

(11.) Di Paola R, Miscio G, Bozzali M, Bozzali M, Barrata R, Centra M, et al. Variation in 3' UTR of hPTP1B increases specific gene expression and associates with insulin resistance. Am J Hum Genet 2002;70:806-12.

(12.) Bento JL, Palmer ND, Mychaleckyj JC, Lange LA, Langefeld CD, Rich SS, et al. Association of protein tyrosine phosphatase 1B gene polymorphisms with type 2 diabetes. Diabetes 2004;53:3007-12.

(13.) Palmer ND, Bento JL, Mychaleckyj JC, Langefeld CD, Campbell JK, Norris JM, et al. Association of protein tyrosine phosphatase 1B gene polymorphisms with measures of glucose homeostasis in Hispanic Americans: the insulin resistance atherosclerosis study (IRAS) family study. Diabetes 2004;53:3013-9.

(14.) Olivier M, Hsiung CA, Chuang LM, Ho LT, Ting CT, Bustus VI, et al. Single nucleotide polymorphisms in protein tyrosine phosphatase 1B (PTPN1) are associated with essential hypertension and obesity. Hum Mol Genet 2004;13:1885-92.

(15.) Florez JC, Agapakis CM, Burtt NP, Sun M, Almgren P, Rastam L, et al. Association testing of the protein tyrosine phosphatase 1B gene (PTPN1) with type 2 diabetes in 7,883 people. Diabetes 2005;54:1884-91.

(16.) McGuire MC, Fields RM, Nyomba BL, Raz I, Bogardus C, Tonks NK, et al. Abnormal regulation of protein tyrosine phosphatase activities in skeletal muscle of insulin-resistant humans. Diabetes 1991;40:939-42.

(17.) Ahmad F, Azevedo JL, Cortright R, Dohm GL, Goldstein BJ. Alterations in skeletal muscle protein-tyrosine phosphatase activity and expression in insulin-resistance human obesity and diabetes. J Clin Invest 1998;100:449-58.

(18.) The International HapMap Consortium. The International HapMap Project. Nature 2003;426:789-96.

(19.) Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care 1997;20: 1183-97.

(20.) Meshkani R, Taghikhani M, Larijani B, Khatami S, Khoshbin E, Adeli K. The relationship between homeostasis model assessment and cardiovascular risk factors in Iranian subjects with normal fasting glucose and normal glucose tolerance. Clin Chim Acta 2006;371:169-75.

(21.) Matthews D, Hosker J, Rudenski A, Naylor B, Treacher D, Turner R. Homeostasis model assessment: insulin resistance and B-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985;28:412-9.

(22.) Murabito JM, Nam BH, D'Agostino RB, Lloyd-Jones DM, O'Donnell CJ, Wilson PW. Accuracy of offspring reports of parental cardiovascular disease history: the Framingham Offspring Study. Ann Intern Med 2004;140:434-40.

(23.) Barrett JC, Fry B, Mailer J, Daly MJ. Haploview: analysis and visualization of LID and haplotype maps. Bioinformatics 2005;21:263-5.

(24.) Xie X, Ott J. Testing linkage disequilibrium between a disease gene and marker loci [Abstract]. Am J Hum Genet 1993;53:460-5.

(25.) Purcell S, Cherny SS, Sham PC. Genetic power calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics 2003;19:149-50.

(26.) Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, Loy AL, et al. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 1999;283:1544-8.

(27.) Weng J, Yan J, Huang Z, Sui Y, Xiu L. Missense mutation of Pro387Leu in protein tyrosine phosphatase-1B (PTP-1B) is not associated with type 2 diabetes in a Chinese Han population. Diabetes Care 2003;26:2957.

(28.) Kipfer-Coudreau S, Eberle D, Sahbatou M, Bonhomme A, Guy-Grand B, Froguel P, et al. Single nucleotide polymorphisms of protein tyrosine phosphatase 1B gene are associated with obesity in morbidly obese French subjects. Diabetologia 2004;47:1278-84.

(29.) Santaniemi M, Ukkola 0, Kesaniemi YA. Tyrosine phosphatase 1B and leptin receptor genes and their interaction in type 2 diabetes. J Intern Med 2004;256:48-55.

(30.) Dahlman I, Wahrenberg H, Persson L, Amer P. No association of reported functional protein tyrosine phosphatase 1B 3' UTR gene polymorphism with features of the metabolic syndrome in Swedish people. J Intern Med 2004;255:694-5.

(31.) Spencer-Jones NJ, Wang X, Snieder H, Spector TD, Carter ND, O'Dell SD. Protein tyrosine phosphatase-1B gene PTPN1: selection of tagging single nucleotide polymorphisms and association with body fat, insulin sensitivity, and the metabolic syndrome in a normal female population. Diabetes 2005;54:3296-304.

(32.) Kotowski IK, Pertsemlidis A, Luke A, Cooper RS, Vega GL, Cohen JC, et al. A spectrum of PCSK9 alleles contributes to plasma levels of low-density lipoprotein cholesterol. Am J Hum Genet 2006;78:410-22.

(33.) Carlson CS, Eberle MA, Rieder MJ, Yi Q, Kruglyak L, Nickerson DA. Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium. Am J Hum Genet 2004;74:106-20.

(34.) Ukkola 0, Rankinen T, Lakka T, Leon AS, Skinner JS, Wilmore JH, et al. Protein tyrosine phosphatase 1B variant associated with fat distribution and insulin metabolism. Obes Res 2005;13:829-34.

REZA MESHKANI, [1,2] MOHAMMAD TAGHIKHANI, [3] HUSSAM AL-KATEB, [4] BAGHER LARIJANI, [5] SHOHREH KHATAMI, [6] GUS KONSTANTINOS SIDIROPOULOS, [2] ROBERT ALEXANDER HEGELE, [7] and KHOSROW ADELI [2] *

[1] Department of Biochemistry, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, I.R. Iran.

[2] Division of Clinical Biochemistry, Department of Pediatric Laboratory Medicine, Hospital for Sick Children, University of Toronto, Ontario, Canada.

[3] Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modarres University, Tehran, I.R. Iran.

[4] Program in Genetics and Genomic Biology, Hospital for Sick Children, University of Toronto, Ontario, Canada.

[5] Endocrinology and Metabolism Research Centre, Shariati Hospital, Tehran University of Medical Sciences, Tehran, I.R. Iran.

[6] Department of Biochemistry, Institute Pasteur of Iran, Tehran, I.R. Iran. Robarts Research Institute and University of Western Ontario, London, Ontario, Canada.

* Address correspondence to this author at: Division of Clinical Biochemistry, DPLM, Hospital for Sick Children, University of Toronto, Toronto, Ontario, M5G 1X8 Canada. Fax 416-813-6257; e-mail khosrow.adeli@ sickkids.ca.

[8] Nonstandard abbreviations: T2D, type 2 diabetes; IR, insulin resistance; SNP, single-nucleotide polymorphism; OGTT, oral glucose tolerance test; HOMA-IR, homeostasis model assessment of IR; RS, restriction site; LD, linkage disequllibrium; EMSA, electrophoretic mobility shift assay; SREBP, sterol regulatory element-binding protein; OR, odds ratio; MAF, minor allele frequency; SP, specificity protein.

[9] Human genes: PTPN1, protein tyrosine phosphatase, nonreceptor type 1; PCSK9, proprotein convertase subtllisin/kexin type 9.
Table 1. Nucleotide sequence of DNA primers used for PCR amplification
of 8 fragments of the PTPN1 promoter.

Fragment Forward primer Reverse primer
(size, bp)

1 (505) TGACTACTTTAAGGGCCACTC CTCGAACTCCTTTTCCATCTC
2 (301) TCATTCCTGCAGCACCCAAG GGAGGGCATTGAGTTCCAGC
3 (367) TGATCTTCCTGCCTCAGCCTC CTGCTCTCTAAGGGTAGTGTCC
4 (312) TAGCAGAAACCGAGTTTCACC CCTGGGTAACAGAATCAGACC
5 (199) GAGTGCAGTGGAGCTATCTTGG ACCTGAGGTCAAGAGTCCGAG
6 (316) GTCGCATCGGGTTACTTCAGG GAAGGAGAATCCGCCTTGAACC
7 (405) TCTGAATCATTTGGCGATGGGTC CCAAGCAGACCGTTTTAATCAAC
8 (314) ATAATACCAGGCAGTGTCTCTGG TTACGGTCACCTGGGAAGTGTG

Fragment Temperature,
(size, bp) [degrees] C

1 (505) 53
2 (301) 57
3 (367) 58
4 (312) 58
5 (199) 61
6 (316) 56
7 (405) 57
8 (314) 60

Table 2. General characteristics of the study population. (a)

 Nondiabetic Type 2 diabetic

n 412 174
Age 40.35 (11.39) 55.10 (9.81)
Sex, female/male 186/226 96/78
Systolic blood pressure, mmHg 115.4 (13.3) 127.0 (13.1)
Diastolic blood pressure, mmHg 77.2 (9.0) 80.6 (8.0)
Body mass index, kg/[m.sup.2] 25.7 (3.9) 27.5 (3.8)
Waist circumference, cm 86.8 (11.5) 95.2 (9.74)
Waist-to-hip ratio 0.85 (0.08) 0.91 (0.07)
Glucose, mmol/L 5.06 (0.46) 9.27 (3.24)
Cholesterol, mmol/L 5.01 (0.88) 5.39 (0.96)
Triglycerides, mmol/L 1.56 (0.91) 1.98 (0.96)
HDL cholesterol, mmol/L 1.03 (0.21) 0.93 (0.23)
LDL cholesterol, mmol/L 3.68 (0.88) 3.90 (0.81)
Insulin, [micro]U/mL 9.09 (3.34) 11.5 (4.03)
HOMA-IR 2.07 (0.85) 3.72 (2.20)

 P value

n
Age 0.0001
Sex, female/male 0.024
Systolic blood pressure, mmHg 0.0001
Diastolic blood pressure, mmHg 0.0001
Body mass index, kg/[m.sup.2] 0.0001
Waist circumference, cm 0.0001
Waist-to-hip ratio 0.0001
Glucose, mmol/L 0.0001
Cholesterol, mmol/L 0.0001
Triglycerides, mmol/L 0.0001
HDL cholesterol, mmol/L 0.001
LDL cholesterol, mmol/L 0.008
Insulin, [micro]U/mL 0.005
HOMA-IR 0.0001

(a) Data are mean (SD). An unpaired Rest was used to compare the
continuous variables between the groups, and the X2 test was used
to compare sex between the groups. Triglycerides, insulin, and
HOMA-IR values were log transformed, but the untransformed values
are given in the table.

Table 3. Descriptive information of the identified variants in the
PTPN1 promoter and their genotype and allelic comparisons between
the control (412) and diabetic (174) participants.

 Chromosomal
Variant (MAF %) ID position Genotype

-51del A (2.0) NA (a) 48 560 276 AA
 AD
-451A>G (1.1) NA 48 559 876 AA
 AG
-467T>C (1.1) NA 48 559 860 TT
 TC
-1023C>A (9.2) rs6126029 48 559 304 CC
 CA
 AA
--1045G>A (0.93) NA 48 559 282 GG
 GA
-1286 3bp del ACA (0.17) NA 48 559 041 Ins
 del
-1291 9bp del (0.17) NA 48 559 036 Ins
CTAGACTAA del

 Control, Case,
Variant (MAF %) n (%) n (%) P value

-51del A (2.0) 393 (95.4) 169 (97.1) 0.332
 19(4.6) 5(2.9)
-451A>G (1.1) 402 (97.6) 171 (98.3) 0.598
 10(2.4) 3(1.7)
-467T>C (1.1) 402 (97.6) 171 (98.3) 0.598
 10(2.4) 3(1.7)
-1023C>A (9.2) 334 (81.1) 151 (86.8) 0.069
 71 (17.2) 23 (13.2)
 7(1.7) 0(0)
--1045G>A (0.93) 404 (98.1) 171 (98.3) 0.859
 8(1.9) 3(1.7)
-1286 3bp del ACA (0.17) 0(0) 172 (98.9)
 0(0) 2(1.1)
-1291 9bp del (0.17) 0(0) 172 (98.9)
CTAGACTAA 0(0) 2(1.1)

Variant (MAF %) Allele Control, % Case, %

-51del A (2.0) A 97.7 98.6
 D 2.3 1.4
-451A>G (1.1) A 98.8 99.1
 G 1.2 0.9
-467T>C (1.1) T 98.8 99.1
 C 1.2 0.9
-1023C>A (9.2) C 89.7 93.4
 A 10.3 6.6
--1045G>A (0.93) G 99.0 99.1
 A 1.0 0.9
-1286 3bp del ACA (0.17) Ins 99.5 99.5
 del 0.05 0.05
-1291 9bp del (0.17) ins 99.5 99.5
CTAGACTAA del 0.05 0.05

Variant (MAF %) P value

-51del A (2.0) 0.337
-451A>G (1.1) 0.600
-467T>C (1.1) 0.600
-1023C>A (9.2) 0.020
--1045G>A (0.93) 0.860
-1286 3bp del ACA (0.17)
-1291 9bp del (0.17)
CTAGACTAA

(a) NA, Not applicable.

Table 4. Stepwise logistic regression analysis of diabetes
predictors. (a)

Covariate OR (95% CI) P value

Age 1.11 (1.09-1.14) <0.0001
Parental history of diabetes 3.66 (2.24-5.98) <0.0001
HOMA-113 2.18 (1.72-2.76) <0.0001
Hypertension 1.89 (1.15-3.10) 0.011
Smoking 2.46 (1.18-5.13) 0.016

(a) HOMA-IR was modeled as ORs for diabetes per interquartile
range increase. For hypertension, smoking, and parental
history of diabetes, ORs were modeled relative to those
without the condition.
COPYRIGHT 2007 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Meshkani, Reza; Taghikhani, Mohammad; Kateb, Hussam Al-; Larijani, Bagher; Khatami, Shohreh; Sidirop
Publication:Clinical Chemistry
Date:Sep 1, 2007
Words:5994
Previous Article:A simple and robust quantitative PCR assay to determine CYP21A2 gene dose in the diagnosis of 21-hydroxylase deficiency.
Next Article:Development of an integrated assay for detection of BCR-ABL RNA.
Topics:


Related Articles
Genset and Whitehead Institute sign license and research agreements in the field of obesity and diabetes.
CEPTYR BEGINS IND-ENABLING STUDIES FOR TYPE II DIABETES.
GENAERA FILES IND FOR TRODUSQUEMINE (MSI-1436).
Endothelial nitric oxide synthase haplotypes are associated with features of metabolic syndrome.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters