Printer Friendly

Pichia pastoris Expressing Recombinant Misgurnus anguillicaudatus Growth Hormone Promotes the Growth of M. anguillicaudatus Larvae.

Byline: Yongfang Jia Xiaolin Ji Qiongqiong Wang Lifang Wang Ningning Li Qiyan Du and Zhongjie Chang

Abstract

Growth hormones (GH) can promote fish growth however it is extremely low in fish body and difficultly to purify. The study attempted to address this problem by introducing gene engineering technology. The HIS4 mutant yeast Pichia pastoris GS115 strain was transformed with a constructed vector pPIC9K containing misgurnus anguillicaudatus Growth Hormone (maGH) cDNA under the control of alcohol oxidase (aox1) gene promoter. PCR analysis was employed in verifying the stable integration of introduced DNA. SDS-PAGE analysis indicated that recombinant M. anguillicaudatus GH (rmaGH) had been expressed and exported into the culture medium after methanol induction. The production peaked at 72 h after induction and the yield was as high as 300 mg/L in shaking-flask fermentation medium accounting for 53% of the total secreted proteins. By feeding experiment to larvae rmaGH showed the significant growth-promoting effects in body weight and length on M. anguillicaudatus compared with the control group (Pless than 0.01) at 6 weeks. These results were valuable to develop a new fish growth promoting agent.

Key Words: Misgurnus anguillicaudatus growth hormone Pichia pastoris secretion expression growth-promoting effect recombinant protein.

INTRODUCTION

The growth hormones (GH) prolactin placental lactogen and somatolactin belong to the family of pituitary hormones which share several similarities in structure function and gene organization (Acosta et al. 2008). GH are single- chain polypeptide hormones of about 22 kDa secreted by the anterior pituitary gland which regulate diverse and essential physiological processes. They are involved in the regulation of somatic growth development (Xu et al. 2013) and reproduction through modulation of steroidogenesis gametogenesis ovulation and gonadal differentiation (Hull and Harvey 2001) and also govern gonadotropin secretion and responsiveness (Munakata et al. 2007) osmoregulation (Almeida et a. 2013) appetite (Johnsson and Bjornsson

1994) behavior (Ojima and Iwata 2009) and immunologic function (Shved et al. 2011) across vertebrates.

Previously a number of cDNAs of fish GH have been cloned and expressed in Escherichia coli (Sekine et al. 1985; Bai et al. 1999; Wang et al.

2001). The recombinant GH expressed in E. coli largely contribute to several physiological processes in fish and have been widely used in aquaculture (Poen and Pornbanlualap 2013). However as E. coli is a prokaryote and its intrinsic characteristics differ from those of eukaryotes the protein product may be typically obtained as insoluble misfolded inclusion bodies requiring subsequent solubilization and re-folding steps. Therefore E. coli is generally not suitable for the expression of proteins that contain a high level of disulfide connectivity or proteins that require post-translational modifications such as glycosylation proline cis/trans isomerization disulfide isomerization lipidation sulfation or phosphorylation (Daly and Hearn 2005; Macauley-Patrick et al. 2005; Zhu et al. 2014). These limitations have prompted biotechnologists to seek new production systems. With the development of eukaryotic expression systems several fish GH have been expressed in the yeast Pichia pastoris (Acosta et al. 2007; Li et al. 2003). P. pastoris is an efficient host for heterologous gene expression using the promoter from the methanol-induced

alcohol oxidase 1 gene. Owing to its extensive application in the commercial production of various foreign proteins (Daly and Hearn 2005; Acosta et al. 2007; Peng et al. 2013) in the present study P. pastoris was selected as the expression system and the Misgurnus anguillicaudatus GH (maGH) was cloned and expressed in it.

The objective of this study was to establish a system with high-level expression of maGH in P. pastoris and evaluate the effect of the recombinant P. pastoris on the growth of M. anguillicaudatus fry that were immersed into water containing this recombinant maGH. The results showed that the recombinant P. pastoris had significant growth- promoting effects on M. anguillicaudatus. The present study provides important information relevant to the use of recombinant GH for the enhancement of the growth rate of fish in aquaculture.

MATERIALS AND METHODS

Preparation of total RNA and RT-PCR M. anguillicaudatu pituitary was dissected and immediately homogenized in the medium provided by the RNA isolation kit (TaKaRa Japan) The cDNA synthesis was carried out with the PrimeScriptTM RT Reagent Kit (TaKaRa Japan) A forward primer

(FP: 5'GCTGGAATTCTCAGAGAACCAAAGGCTCTT3') and a reverse primer (RP: 5'CACTGCGGCCGCTTACTACAGGGTGCAGTTG3') were designed from M. anguillicaudatu cDNA growth hormone sequence (GenBank Accession No.DQ350433) for the amplification of the mature GH. The forward and reverse primers contain the restriction sites for EcoRI and NotI restriction endonuclease (underlined) respectively. The reaction mixture of PCR was first kept at 94C for 5 min then 35 cycles of PCR (94C for 40 s 50C for

40 s 72C for 1 min) were done and the sample finally kept at 72C for 10 min. PCR products were separated in 1% agarose gels.

Construction of the expression vector pPIC9K- maGH The PCR product of approximately 570 bp was digested by BamHI and NotI and subcloned into the P. pastoris shuttle expression vector pPIC9K which was previously digested with the same enzymes to generate the expression plasmid. The vector contains the alcohol oxidase (aox1) promoter from P. Pastoris and the histidine4 gene (HIS4) as selection marker. As the resultant plasmid pPIC9K- maGH was sequenced using a-factor pPIC9K Primer. Insertion of the PCR product was verified by restriction enzyme digestion electrophoresis; PCR and sequencing (Shanghai Sangon Biotech China).

Transformation of Pichia pastoris and screening for Mut+ phenotype

The expression plasmid was linearized with Sal I and transformed into P. pastoris strain GS115 by lithium chloride method. The transformation mixture was plated on selective medium MD [1.34 % (w/v) yeast nitrogen base 4A-10-5 biotin 2% (w/v) agar 2% (w/v) glucose]. Colonies were visible after 2-3 days at 30. The target gene in the recombinants was detected by a genomic PCR assays using the

5'AOX1 (5'-GACTGGTTCCAATTGACAAGC-3') and 3'-AOX1 (5'-GCAAATGGCATTCTGACATCC-3') primers (Shanghai Sangon Biotech China) to screen for methanol utilization plus (Mut+) and methanol utilization slow (Muts) phenotypes. The GS115 clone recombinant with pPIC9K plasmid was used as negative control (GS115/pPIC9K).

Methanol-induced maGH expression in Pichia pastoris and SDSPAGE analysis

Fermentations of selected clones were done in 250 ml shake-flasks. Recombinant colonies (GS115/pPIC9K-maGH) with methanol utilization plus (Mut+) phenotype were inoculated into 10 ml of yeast peptone glucose (YPD) medium [1% (w/v) yeast extract 2% (w/v) peptone and 1% (v/v) glucose as carbon source] for 24 h under the condition of 300 in a shaking incubator (250 rpm). Then clones of Mut+ yeast were inoculated in liquid BMGY medium (1% yeast extract; 2% peptone; 100 mM potassium phosphate pH 6.0; 1.34% yeast nitrogen base; 4A-10-5 biotin; 1% glycerol) and grown at 30C in a shaking incubator for 30 h until the culture reached an absorbance at 600 nm (A600) of 10 units. Cells were harvested by centrifugation

and gently resuspended in 25 ml of Buffered Methanol-complex Medium (the ingredient was same as BMGY but containing 0.5% methanol instead of 1% glycerol as carbon source) to induce expression of recombinant maGH through the AOX1 promoter. Absolute methanol was added continuously to maintain a final concentration of

0.5% (V/V) for 120 h at 30. The proteins of the culture supernatant were precipitated by trichloroacetic acid (TCA) and resuspended in reducing sample loading buffer. They were analyzed by Coomassie stained 15% SDS-polyacrylamide gel with 5% stacking gel and the protein lane scanned by gel image analysis system BandScan to calculate the percentage of rmaGH.

Biological activity assays

M. anguillicaudatus larvae at 2 days post hatching were acclimatized in tanks (500 l) with fresh water for one week prior to the experiment. Five experimental groups (n = 200 for each group) were immersed into the water which containing the following ingredient: (1) culture supernatant of transformed P. pastoris containing the rmaGH at a dose of 0.1 mg/l (rmaGH culture supernatant groups) (2) cell lysates of transformed P. Pastori expressing rmaGH at a dose of 0.1 mg/l (rmaGH cultures groups) (3) cell lysates of non-transformed P. pastoris (yeast culture groups) (4) culture supernatant of non-transformed P. pastoris expressing total protein at a dose of 0.1 mg/l (yeast culture supernatant groups) (5) non-treated group (the control groups). The treatment was done for 90 min without water recirculation it was repeated three times in a week for 6 weeks. Sampling of 30 shes per group was taken at two weeks four weeks and six weeks from the beginning of the experiment. Growth promoting effect was evaluated by measuring of body weight and fork length increase. Data were expressed as mean SD and analyzed by a Student's t-test.

RESULTS

Molecular cloning of maGH gene and construction of expression plasmid pPIC9K/maGH The PCR products amplified with FP1 and RP2 were approximately 590 bp. The amplicon was

recovered by double digestion with EcoRI and NotI. Then it was ligated into plasmid pPIC9K giving rise to the expression plasmid pPIC9K-maGH. The construct was used to transform the E. coli DH5a. The plasmid extracted from Ampicillin-resistant transformants was digested with EcoRI and NotI and a 570 bp fragment was obtained as expected indicted that the insertion direction was correct. In addition sequencing showed that the open reading frame of maGH cDNA was completely in frame with that of the a-factor signal peptide.

Transformation of P. pastoris and Mut+ phenotype selection

Transformation with the Sal I-linearized version of pPIC9-maGH favored its insertion into the yeast genome by homologous recombination positive transformants (His+ Muts) were selected on MD plates. Transformant P. pastoris were analyzed by PCR with the primers of aox1 gene. The PCR products of transformants have two expected amplification bands typical of Mut+ clones. One of 1062 bp pertaining to the growth hormone expression cassette" flanked by aox1 sequences and the other of 2105 bp corresponding to the native aox1 gene of the yeast genome (clone N2-N4 in Fig.1). The clone N5 (Muts) only 1062 bp appeared meaning absence of aox1 endogenous gene. Mut+ clones were chosen for the subsequent expression study.

Selection of high expression strain and production of rmaGH Expression cassette-positive clones of each type were fermented in YPD medium and then induced with methanol to a final concentration of

0.5% for a total induction time of 120 h. After induction with methanol all clones expressed an extracellular protein of approximately 24 kDa with the same size as the standard maGH which were visualized by Coomassie brilliant blue stained SDS- PAGE. The protein band was absent in the culture supernatant of non-transformed GS115 host cells (Fig.2). There was one clone expressing the highest levels about 300 mg/L recombinant maGH in shake- flask fermentation medium which accounted for

53% of all the protein in the culture supernatant. Therefore it was designated as GS115/(pPI9K- rmaGH) and was selected for further analysis. The production increased along with the increase of duration time after methanol induction then the peak of the production was obtained at 72 h (Fig.2).

Assessing biological activity of rmaGH The wet body weight of larvae were recorded at two weeks four weeks and six weeks from the beginning of the experiment. Statistically signicant differences in the growth rate were found in larvae treated with culture supernatant of recombinant P. pastoris compared with the control group (P less than 0.01) and with the other groups (P less than 0.05) at 4 weeks. At six weeks from the beginning of the experiment larvae were treated with recombinant P. pastoris culture supernatant had a weight increase of 2.79

1.99 1.88 and 2.09-fold higher than the control group (Pless than 0.01) the rmaGH culture groups (Pless than 0.01) the yeast culture supernatant groups (Pless than 0.01) and the yeast culture groups (Pless than 0.01) respectively (Fig.

3A). In addition fork length of the rmaGH culture supernatant groups had a great increase of 2.1-fold higher than the control group after 6 weeks (Fig.3B).

DISCUSSION

Although many recombinant GH had been produced by using E. coli (Sekine et al. 1985; Bai et al. 1999; Wang et al. 2001) the product expressed in the inclusion bodies requires additional modification which weakens its bioactivity. Accordingly the present study attempted to address this problem by introducing a new host to express recombinant maGH (rmaGH). An easy expression system which was capable of producing biologically active rmaGH in large quantity was developed and the rmaGH bioactivities were analyzed by vitro experiments.

The GH cDNA of M. anguillicaudatus was cloned and the open reading frame of the maGH encoded a precursor of 210 aa including a 22 aa signal peptide and a 188 aa mature protein. To achieve secretion of a particular target protein the preferred approach is to select appropriate secretion signal. This selection can be based on the protein's own native secretion signal such as the S. cerevisiae alpha-mating factor (a-MF) pre-pro leader sequence the acid phosphatase signal sequence or the invertase signal sequence (Macauley and Patrick

2005; Li et al. 2001). The most commonly used signal sequence in P. pastoris secretion system is the S. cerevisiae a-MF (Daly et al. 2005; Acosta et al. 2007; Peng et al. 2013). Similar to S. cerevisiae

linear DNA can generate stable transformants of P.

pastoris via homologous recombination between the transforming DNA and regions of homology within the genome. Therefore in the present study the native maGH leading signal was removed and the S. cerevisiae a-MF secretion signal was used for the secretion of the recombinant hormone. PCR and sequence analyses indicated that the maGH genes were transformed into P. pastoris GS115 and SDS- PAGE analysis showed the presence of rmaGH in the culture supernatant with a molecular weight of around 24 kDa similar to that of the standard maGH suggesting that the a-MF signal peptide was recognized and processed appropriately. Gel scanning of the protein band revealed that the secreted rmaGH accounted for 53% of all the protein in the culture supernatant which could minimize time-consuming and laborious downstream purification process.

Numerous studies have been conducted to develop high-copy recombinants to obtain large quantities of products. As the number of integrated copies of the expression cassette could affect the amount of protein expressed in the present study the expression level of rmaGH was different. The results indicated that multicopy recombinant plasmid containing the maGH cDNA was integrated into the genome of P. pastoris and that a large quantity of biologically active rmaGH (300 mg/l rmaGH) was secreted into the culture supernatant which was higher than that of carp and tilapia GH obtained in P. pastoris (Wang et al. 2003; Acosta et al. 2008). Furthermore the expression of rmaGH in P. pastoris was noted to be time-dependent and the optimal time period was 72 h after induction with methanol similar to the expression of the recombinant carp GH in P. pastoris which also peaked at 72 h of induction (Li et al. 2003). The above-mentioned results were obtained in shake- flask culture in the laboratory and as P. pastoris is well suited for fermentation (Peng et al. 2013) a tenfold higher recombinant GH production could be achieved through high-density fermentation.

Similar to the synthesis of rmaGH in P. pastoris and its secretion into the extracellular environment the production of other teleost GH has also been reported in the literature (Wang et al.

2003; Li et al. 2003). Li observed the growth-promoting effect of recombinant carp GH which was secreted into the culture supernatant of recombinant P. pastoris (Li et al. 2003) while Acosta reported that the recombinant tilapia GH expressed in P. pastoris cells could significantly increase the body weight of tilapia (Acosta et al.

2007). These findings indicate that irrespective of whether the recombinant GH are expressed in the cells or secreted into the culture medium their effect may be the same. The present study was conducted to better understand the role of P. pastoris rmaGH in fish and is the first to compare the growth-promoting effects of rmaGH obtained from recombinant P. pastoris culture supernatant recombinant P. pastoris cells normal P. pastoris culture supernatant and normal P. pastoris cells on M. anguillicaudatus fry (the control group was treated with water alone). The results showed that the weight and body length of M. anguillicaudatus fry treated with rmaGH obtained from recombinant P. pastoris culture supernatant were 2.79- and 2.1- fold higher than those of the control group (P less than 0.01) after 6 weeks respectively. Furthermore the culture supernatant containing rmaGH had a stronger effect on the growth of the larvae than the rmaGH obtained from P. pastoris cells indicating that extracellular rmaGH could be assimilated more easily by the larvae when compared with rmaGH obtained from P. pastoris cells.

Recent studies had focused on the growth- promoting effects of GH on genetically modified fish and found that GH-treated transgenic fish exhibited accelerated growth rates when compared with non-transgenic fish (Cao et al. 2014; Gopal et al. 2014; Duan et al. 2013). However numerous problems were noted to be associated with transgenic fish such as high predation mortality (Duan et al. 2013) impairment of the immune system (Batista et al. 2014) delayed gonadal development (Cao et al. 2014) smaller and lighter bone development (Zhu et al. 2013) etc. Research on this topic conducted in Europe has suggested that the potential environmental effects of transgenic fish that escape into the wild are ambiguous. (Zhang et al. 2014). With improved living standard increasing numbers of people now prefer animal food products with high quality than quantity. In many countries people avoid transgenic foods because of the controversy associated with the

effects of such foods on human health (Frewer et al. 2013). Accordingly the method of immersion of larvae into recombinant P. pastoris culture supernatant appears to be a more efficient and safe approach for GH administration. Nevertheless further detailed studies are required to determine the optimal conditions for rmaGH production through large-scale fermentation the optimal larval period for treatment with rmaGH and the optimal dose of rmaGH.

ACKNOWLEDEGMENTS

This work is supported by grants from the National Natural Science Foundation of China (no. 31200923 and U1204329) Tianjin Key Laboratory of Animal and Plant Resistance Open Fund (no. 01046651012) the Henan Scientific and Technological Research Projects (no. 142300410164) the Natural Science Project of the Education Department of Henan Province (no. 14A180031 and 2010B360002).

REFERENCES

ACOSTA J. CARPIO Y. BESADA V. MORALS R. SANCHEZ A. CURBELO Y. AYALA J. AND ESTRADA M.P. 2008. Recombinant truncated tilapia growth hormone enhances growth and innate immunity in tilapia fry (Oreochromis sp.). Gen. Comp. Endocrinol. 157: 49-57.

ACOSTA J. MORALES R. MORALES A. ALONSO M.

AND ESTRADA M.P. 2007. Pichia pastoris expressing recombinant tilapia growth hormone accelerates the growth of tilapia. Biotechnol. Lett. 29:

1671-1676.

ALMEIDA D.V. MARTINEZ GASPAR MARTINS DE.C. AZEVEDO FIGUEIREDO DE M.CECCON LANES C.F. BIANCHINI A. AND MARINS L.F. 2013. Growth hormone transgenesis affects osmoregulation and energy metabolism in zebrafish (Danio rerio). Transgen. Res. 22: 75-88.

BAI J.J. MA J. JIAN Q. LI X.H. AND LUO J.R. 1999.

Clone of cDNA for common carp GH and its expression in prokaryocyte. Chin. J. Biochem. Mol. Biol. 15: 409-

412.

BATISTA C.R. FIGUEIREDO M.A. ALMEIDA D.V. ROMANO L.A. AND MARINS L.F. 2014. Impairment of the immune system in GH- overexpressing transgenic zebrafish (Danio rerio). Fish Shellfish Immunol. 36: 519-524.

CAO M. CHEN J. PENG W. WANG Y. LIAO L. LI Y.

TRUDEAU V.L. ZHU Z. AND HU W. 2014. Effects of growth hormone over-expression on reproduction in the common carp Cyprinus carpio L. Gen. Comp. Endocrinol. 195: 47-57.

DALY R. AND HEARN. M.T. 2005. Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. J. Mol. Recognit. 18: 119-138.

DUAN M. ZHANG T. HU W. XIE S. SUNDSTROM L.F. LI Z. AND ZHU Z. 2013. Risk-taking behaviour may explain high predation mortality of GH-transgenic common carp Cyprinus carpio. J. Fish Biol 83: 1183-

1196.

FREWER L.J. VAN DER LANS I. A. FISCHER A.R.H. REINDERS M.J. MENOZZI D. ZHANG X.Y. VAN DEN BERG I. AND ZIMMERMANN K.L. 2013. Public perceptions of agri-food applications of genetic modification - A systematic review and meta-analysis. Trends Fd. Sci. Technol. 30: 142-152.

GOPAL R.N. KUMAR P. AND LAL B. 2014. Temperature dependent action of growth hormone on somatic growth and testicular activities of the catfish Clarias batrachus. Gen. Comp. Endocrinol. 195: 125-131.

HULL K.L. AND HARVEY S. 2001. Growth hormone: roles in female reproduction. J. Endocrinol. 168: 1-23.

JOHNSSON J. I. AND BJORNSSON B. T. 1994. Growth hormone increases growth rate appetite and dominance in juvenile rainbow trout Oncorhynchus mykiss. Anim. Behav. 48: 177-186.

LI P.Z. GAO X.G. ARELLANO R.O. AND RENUGOPALAKRISHNAN V. 2001. Glycosylated and phosphorylated proteins-expression in yeast and oocytes of Xenopus: prospects and challenges-relevance to expression of thermostable proteins. Protein Expres Purif. 22: 369-380.

LI Y. BAI J. JIAN Q. YE X. LAO H. LI X. LUO J.

AND LIANG X. 2003. Expression of common carp growth hormone in the yeast Pichia pastoris and growth

stimulation of Juvenile tilapia (Oreochromis niloticus).

Aquaculture 216: 329-341.

MACAULEY-PATRICK S. FAZENDA M.L. MCNEIL B.

AND HARVEY L.M. 2005. Heterologous protein

production using the Pichia pastoris expression system.

Yeast 22: 249-270.

MUNAKATA A. AMANO M. IKUTA K. KITAMURA S.

AND AIDA K. 2007. Effects of growth hormone and

cortisol on the downstream migratory behavior in masu salmon Oncorhynchus masou. Gen. Comp. Endocrinol.

150: 12-17.

OJIMA D. AND IWATA M. 2009. Central administration of growth hormone-releasing hormone triggers

downstream movement and schooling behavior of chum salmon (Oncorhynchus keta) fry in an artificial stream. Comp. Biochem. Physiol. A. 152: 293-298.

PENG N. XU W.L. WANG F. HU J.L. MA M.H. HU Y.L. ZHAO S.M. LIANG Y.X. AND GE X.Y. 2013. Mitsuaria chitosanase with unrevealed important amino acid residues: characterization and enhanced production in Pichia pastoris. Appl. Microbiol. Biol. 97: 171-179.

POEN S. AND PORNBANLUALAP S. 2013. Growth hormone from striped catfish (Pangasianodon hypophthalmus): genomic organization recombinant expression and biological activity. Gene 518: 316-324.

SEKINE S. MIZUKAMI T. NISHI T. KUWANA Y. SAITO A. SATO M. ITOH S. AND KAWAUCHI H.

1985. Cloning and expression of cDNA for salmon growth hormone in Escherichia coli. Proc. natl. Acad.

Sci. 82: 4306-4310.

SHVED N. BERISHVILI G. MAZEL P. BAROILLER J.F.

AND EPPLER E. 2011. Growth hormone (GH) treatment acts on the endocrine and autocrine/paracrine GH/IGF-axis and on TNF-a expression in bony fish

pituitary and immune organs. Fish Shellfish Immunol.

31: 944-952.

WANG W. SUN Y.H. AND WANG Y.P. 2003. Expression of grass carp growth hormone in the yeast Pichia pastoris. Acta Genet. Sin. 30: 301-306.

WANG W. WANG Y.P. AND ZHU Z.Y. 2001. Prokaryotic expression of recombinant grass carp growth hormone. J. Genet. Genom. 28: 306-312.

XU Q. FENG C.Y. HORI T.S. PLOUFFE D.A. BUCHANAN J.T. AND RISE M.L. 2013. Family- specific differences in growth rate and hepatic gene expression in juvenile triploid growth hormone (GH) transgenic Atlantic salmon (Salmo salar). Comp. Biochem. Physiol. Part D. 8: 317-333.

ZHANG L. GOZLAN R.E. LI Z. LIU J. ZHANG T. HU W. AND ZHU Z. 2014. Rapid growth increases intrinsic predation risk in genetically modified Cyprinus carpio: implications for environmental risk. J. Fish Biol. 84: 1527-1538.

ZHU B.J. WANG D.J. PENG T. WANG L. WEI G..Q.

AND LIU V.L. 2014. Characterization and function of

a gene Pc 14-3-3 isoform from red crayfish

Procambarus clarkii. Pakistan J. Zool. 46: 107-113.

ZHU T. ZHANG T. WANG Y. CHEN Y. HU W. AND ZHU Z.J. 2013. Effects of growth hormone (GH) transgene and nutrition on growth and bone development in common carp. Exp. Zool. A Ecol. Genet. Physiol 319: 451-460.
COPYRIGHT 2014 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Yongfang Jia; Xiaolin Ji; Qiongqiong Wang; Lifang Wang; Ningning Li; Qiyan Du; Zhongjie Chang
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9CHIN
Date:Aug 31, 2014
Words:3974
Previous Article:Isolation and Characterization of Biotechnologically Potent Micrococcus luteus Strain From Environment.
Next Article:Expression of Human Interferon a-2b and Escherichia coli Methionine Aminopeptidase Genes in a Single Host Using Two Incompatible Plasmids.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |