Printer Friendly

Phylogenetic Studies of Selected Citrus Species Based on Chloroplast Gene, rps.

Byline: Shumaila Wali, Faiza Munir and Tariq Mahmood

Abstract

Citrus, one of the major genus of Rutaceae family, has a tropical to semi tropical origin and is well known for its medicinal, nutritional and commercial importance. In order to assess the phylogenetic relationships among eight samples of six Citrus species (C. aurantium, C. sinensis var. mousami, C. medica, C. limon, C. maxima, C. sinensis var. malta, C. reticulata, C. sinensis var. feutrell) a chloroplast gene rps14 was successfully amplified and sequenced. The overview of phylogram illustrated an overall genetic distance of 0.02 indicating close genetic relationship among Citrus species. Pairwise distance was calculated for rps14 gene and low genetic diversity values were observed that ranges from 0.10-0.41. On the basis of results obtained it was concluded that lowest genetic diversity value 0.003 was observed from C. sinensis var. mousami and C. medica indicating that both are closely related species.

However, most distant members are C. limon and C. sinensis var. feutrell with highest genetic diversity value 0.404. (c) 2013 Friends Science Publishers

Keywords: Rutaceae; Phylogeny; rps 14; Chloroplast; Citrus

Introduction

Citrus is a genus of family Rutaceae that comprise some 158 genera and 1900 species (Mabberley, 2008). It is mainly tropical to semi tropical in origin and is assumed to have originated from the region within Northeast India, South China, Indonesia and Peninsular Malaysia (Swingle and Reece, 1967). Citrus grows particularly well in areas where there is enough rainfall or irrigation to maintain growth and freezing conditions are not severe enough to kill the tree (Whiteside et al., 1998). Citrus is also one of the most important fruit crops in the world and its international production has reached 122 million tons (FAO, 2008). The increased interest in their consumption is not only due to their sweet refreshing properties but also as a result of increased knowledge of their nutritional and medicinal values. Such as orange fruit and its juice have a number of beneficial, nutritive and health properties (Okwu and Emenike, 2006).

For medical point of view, based on epidemiological studies it has been reported that dietary Citrus flavonoids can enhance a reduction in the risk of coronary heart disease and chronic asthma (Hertog et al.,1993; Di-Majo et al., 2005) and is attracting more and more attention not only due to their antioxidant properties, but as anti-carcinogenic, anti-inflammatory, anti-fungal agents and blood clot inhibition activities (Kaur and Kapoor, 2001; Martin et al., 2002; Abeysinghe et al., 2007).

Citrus fruits and juices are a great source of bioactive compounds including antioxidants such as ascorbic acid, flavonoids, phenolic compounds and pectins that are important to human nutrition (Ebrahimzadeh et al., 2004; Fernandez-Lopez et al., 2005; Jayaprakasha and Patil, 2007).

The peel which represents almost one half of the fruit mass has the highest concentrations of flavonoids in the Citrus fruit (Manthley and Grohmann, 1996, 2001; Anagnostopoulou et al., 2006). A wide range of DNA markers is available and has been used to study the classification of Citrus genus, and phylogenetic relationships within Citrus and with related genera. These molecular studies have provided some insight to Citrus phylogeny. In this context, microsatellite or simple sequence repeats (SSR) have been employed in Citrus for the assessment of genetic variability, phylogenetic studies and for the construction of genetic maps (Kijas et al., 1995; Corazza-Nunes et al., 2002; Zane et al., 2002; Cristofani et al., 2003; Pang et al., 2003; Golein et al., 2005; Barkley et al., 2006).

The application of DNA sequence data to address phylogenetic problems is now a routine (Small et al., 2004). Araujo et al. (2003) first attempted it in Citrus and its relatives using two segments of chloroplast DNA (cpDNA) (Jena et al., 2008). In order to analyze the phylogenetic relationship among selected Citrus species, a chloroplast gene encoding ribosomal protein for smaller subunit (rps) was amplified and sequenced and finally the sequence data was analyzed with the help of computational tools.

Materials and Methods

Plant Material

Eight samples from different Citrus species (C. aurantium, C. sinensis var. mousami, C. medica, C. limon, C. maxima, C. sinensis var. malta, C. reticulata, C. sinensis var. feutrell) were selected and the botanical names were given according to Muhammad et al. (2006) and Naeem et al. (2011). Young leaves were removed from the plant and stored at 4oC.

DNA Extraction and Primer Design

For DNA extraction CTAB (Cetyl Trimethyl Amonium Bromide) protocol of DNA isolation was adopted (Richards, 1997). A pair of primer that can amplify ribosomal protein S14 (rps14) were designed from tobacco chloroplast genome (Accession No. Z00044.2) available in NIH (National Institutes of Health, United States) GenBank. Primers were designed by using online available Primer 3 (version 0.4.0) software (http//primer3.source-forge.net/). The sequence of the used primers is given below: rps14 F 5 ATGGCAAGGAAAAGTTTGATTC 3 rps14 R 5 TTACCAACTTGATCTTGTTGCTCCT 3

PCR Optimization

PCR amplification was performed in a volume of 25 (Mu)L containing 12.5 (Mu)L of 2x PCR Master Mix (Fermentas), 9.5 (Mu)L of nuclease free water, 1 (Mu)L (25 pmol) of forward and reverse primer each and 1 (Mu)L (25-50 ng/mL) of DNA template. The reaction was carried out in Multi Gene thermal cycler (Labnet). The PCR conditions used after optimization were pre PCR denaturation at 95oC for 5 min followed by 35 cycles of denaturation at 94oC for 1 min, annealing for 1 min at 60oC and extension at 72oC for 1 min. Final cycle was same except extension at 72oC for 10 min. The amplified PCR products along with Gene Ruler(tm) 50 bp and 100 bp DNA Ladders (Fermentas) were resolved on 1.5 (Percent) agarose gel prepared in 0.5X TAE buffer and then gel staining (by using ethidium bromide) was performed and finally gel was visualized in gel documentation system (Wealtech, Dolphin DocPlus).

Purification of Amplified Products and Sequencing

PCR products were purified with the help of JETquick (Genomed) PCR Product Purification Spin Kit by following the manufacturer's instructions. The purified products were analyzed on 2 (Percent) agarose gel prepared in 0.5X TAE buffer. The purified DNA samples were stored at -20degC to be used for sequencing. Sequencing reaction was performed in 200 (Mu)L centrifuge tubes by using Dye Terminator Cycle Sequencing (DTCS) Quick start kit by Beckman and Coulter as per instruction provided in the manufacturer's manual. The sequencing PCR cycling conditions were as follows; pre PCR denaturation at 96degC for 1 min then 30 cycles of denaturation at 96degC for 25 sec, annealing at 55degC for 25 sec, extension at 60degC for 4 min. At the end a final extension step at 60degC for 10 min was also performed. The samples were loaded to the available wells of CEQ sample plate and a proper sequencing program was run by using Beckman Coulter CEQ 8000 sequencer.

Gene Sequence Analysis

Blastn was performed for all the sequences by using NCBI website http://blast.ncbi./nlm.nih./gov/Blast.cgi/ to verify the results of sequenced samples. The sequence of rps14 gene of eight samples of six Citrus species including C. aurantium, C. sinensis var. mousami, C. medica, C. limon, C. maxima, C. sinensi var. malta, C. reticulata and C. sinensis var. feutrell was given in the form of query one by one and blastn was performed to compare them with already reported sequences in GenBank. After performing BLAST, the sequence data of eight samples of six Citrus species was submitted to GenBank in order to get the accession numbers. The rps14 sequences from all samples were then aligned by using online multiple alignment software ClustalW and aligned sequences were further used for phylogenetic tree construction using the software Molecular Evolutionary Genetics Analysis (MEGA 5). Phylogenetic tree of sequenced samples was constructed to find out the evolutionary relationships among the rps14 sequences.

Results

Sequence Analysis

The sequences of purified amplified products of rps14 gene from C. aurantium, C. sinensis var. mausami, C. medica, C. limon, C. maxima, C. sinensi var. malta, C. reticulata and C. sinensis var. feutrell showed 90, 94, 91, 90, 85, 88, 85 and 82 (Percent) similarity respectively with C. sinensis chloroplast complete genome (Accession no. DQ864733). The similarity scores were obtained using "nblast" (http//www.ncbi.nlm.nih.gov/BLAST/Blast.cgi). The sequences were submitted in GenBank and following accession numbers were obtained JQ250613, JQ250614, JQ250615, JQ250616, JQ250617, JQ250618, JQ250619 and JQ250620 for C. aurantium, C. sinensis var. mausami, C. medica, C. limon, C. maxima, C. sinensi var. malta, C. reticulata and C. sinensis var. feutrell, respectively.

Phylogenetic Analysis

The phylogram constructed by using MEGA 5 software revealed two clusters denoted by cluster I and cluster II (Fig.1). The tree has shown that speciation occurred after gene duplication event making two clusters (I and II). All the members of cluster I and II are orthologs with their cluster members. The overview of this phylogram illustrated that Citrus species showed very little overall genetic distance of 0.02 indicating close genetic affinity among studied citrus varieties.

Table 1: Data analysis for eight samples of six Citrus species on the basis of pair wise distance calculation

Citrus species###1###2###3###4###5###6###7###8

C. aurantium###0.000

C. sinensis var. mausami###0.102

C. medica###0.099###0.003

C. limon###0.266###0.258###0.253

C. maxima###0.096###0.187###0.183###0.294

C. sinensis var. malta###0.030###0.114###0.110###0.276###0.107

C. reticulate###0.150###0.235###0.240###0.327###0.167###0.167

C. sinensis var. feutrell###0.221###0.316###0.322###0.404###0.258###0.240###0.234###0.000

Cluster I includes five samples namely C. reticulata, C. sinensis var. feutrell, C. maxima, C. aurantium and C. sinensis var. malta (Fig. 1). Although several methods for tree estimation (or inferring trees) are currently available, very little inferential theory is available for quantifying uncertainty for these trees. The most widely used tool for inference is a version of the bootstrap introduced by Felsenstein (1983). The closely related Citrus species in cluster I (C. aurantium and C. sinensis var. malta) have shown bootstrap value of 99, similarly C. reticulata and C. sinensis have shown close genetic affinity with a bootstrap value of 98. The phylogram (Fig. 1) indicates that C. maxima is genetically associated with C. reticulata and C. sinensis var. feutrell with a bootstrap value 84. In cluster I branch length indicates that C. sinensis var.

feutrell is recently evolved member with a large branch length of 0.15637, while C. aurantium is the earliest evolved member with a smallest branch length of 0.0879.

Cluster II includes three varieties C. limon, C. sinensis var. mausami and C. medica (Fig. 1). It was observed that C. sinensis var. mausami and C. medica are closely related and have shown less genetic diversity with bootstrap value of 100. According to Berry and Gascuel (1996) if the bootstrap value for a certain clade is close to 100, nearly all of the characters informative for this group agree that it is a group. Moreover, C. limon is genetically allied with C.sinensis var. mausami and C. medica with a bootstrap value 84. Among these three citrus cultivars, C. limon has a recent origin having significantly large branch length that is 0.19336, while C. medica is distantly evolved member in cluster II with small branch length of 0.00108.

The phylogram based on rps14 gene sequence constructed by using NJ method in MEGA 5, an overall genetic distance of 0.02 was observed indicating close genetic distance among them. Pairwise distance was calculated and the values for genetic diversity were in the range of 0.10-0.41. It was revealed that C. sinensis var. mausami and C. medica were closely related with bootstrap value of 100, they have shown low genetic divergence value that is 0.003. Similarly C. aurantium and C. sinensis var. malta with bootstrap value of 99 were sibilings having very close genetic affinity. It is depicted from the phylogram that there is very little overall genetic divergence (0.02) among the eight varieties of six citrus species indicating close genetic correlation.

Pairwise Distance Calculation

Pairwise distance was calculated on the basis of rps14 gene sequences (Table 1). The values for genetic diversity range from 0.10-0.41 with an average of 0.202. These values indicate that genes were genetically associated with each other and there was little genetic diversity among them. Lowest genetic diversity value (0.003) was observed between C. sinensis var. mausami and C. medica, while highest genetic diversity value (0.404) was observed in C. limon and C. sinensis var. feutrell.

Discussion

The cpDNA sequences are the primary source of characters for phylogenetic studies in plants (Bayer et al., 2000; Small et al., 2005). Protein-coding gene sequences such as rbcL have been used to elucidate phylogenetic relationships among higher-level taxa (Chase et al., 1993). Subsequently, the potential utility of non-coding regions of the chloroplast genome was recognized for lower-level studies (Taberlet et al., 1991). Recently, Lu et al. (2011) investigated the molecular phylogeny of 30 genotypes from six genra of the true citrus fruit trees by conducting research on three cpDNA regions. Earlier, with the help of cpSSR Cheng et al. (2005) and Deng et al. (2007) have reported the molecular phylogeny of Citrus.

In a recent article, ten Fritillaria taxa were phylogenetically analyzed using cpDNA sequences with the help of NJ method for phylogram construction. The phylogeny analysis revealed two major clades dividing ten Fritillaria taxa based on the DNA sequences of the chloroplast trnL-trnF region (Turktas et al., 2012). In our study, the phylogeny of rps14 gene from eight different citrus members has shown two major clusters. The cluster I having five members C. reticulata, C. sinensis var. fruiter, C. maxima, C. aurantium and C. sinensis var. malta, while the cluster II including C. sinensis var. mausami, C. medica and C. limon. In another report, Morton et al. (2003) carried out molecular phylogenetic studies on Aurantioidea subfamily based on plastid DNA sequences of citrus and its close relatives, in this report, within the subfamily Aurantioidea two tribes Citreae and Clauseneae were claded phylogenetically based on rps16 and trnL-trnF sequences.

In the present study, rps14 gene, that encodes ribosomal protein S14 was used to assess phylogenetic relationship with Citrus Spp. investigated. After analyzing the sequence data it was observed that within the genus, the level of polymorphism was very low, which might be due to the self-pollinated nature of plant or could be due to restricted distribution, non-effective gene flow, low fecundity, local selection pressure, low pollen flow, inbreeding systems or less possibility of introgressions during evolution (Loveless and Hamrick, 1984; Loveless, 1992). Research on Citrus genetics has faced many serious impediments due to genetic heterozygosity, longer Cluster I includes five samples namely C. reticulata, C. sinensis var. feutrell, C. maxima, C. aurantium and C. sinensis var. malta (Fig. 1). Although several methods for tree estimation (or inferring trees) are currently available, very little inferential theory is available for quantifying uncertainty for these trees.

The most widely used tool for inference is a version of the bootstrap introduced by showed higher level of similarity and low genetic diversification among eight samples of six selected species. So, it can be concluded that the rps14 gene sequence is highly conserved in genus Citrus and it does not provide much information for establishing phylogeny of genus Citrus. It is evident that all the species are monophyletic with very little genetic diversity.

Acknowledgement

We are thankful to Pakistan Science Foundation, Islamabad, Pakistan for providing financial assistance under the scheme "Institutional Support".

References

Abeysinghe, D.C., X. Li, C.D. Sun, W.S. Zhang, C.H. Zhou and K.S. Chen, 2007. Bioactive compounds and antioxidant capacities in different edible tissues of Citrus fruit of four species. Food Chem., 104: 1338-1344

Anagnostopoulou, M.A., P. Kefalas, V.P. Papageorgiou, A.N.Assimopoulou and D. Boskou, 2006. Radical scavenging activity of various extracts and fractions of sweet orange peel (Citrus sinensis). Food Chem., 94: 19-25

Araujo, E.F., L.P. Queiroz and M.A. Machado, 2003. What is Citrus? Taxonomic implications from a study of cp-DNA evolution in the tribe Citreae (Rutaceae subfamily Aurantioideae). Org. Divers. Evol., 3: 55-62

Barkley, N.A., M.L. Roose, R.R. Krueger and C.T. Federici, 2006. Assessing genetic diversity and population structure in a Citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theor. Appl. Genet., 112: 1519-1531

Bayer, R.J.B., C.F. Puttock and S.A. Kelchner, 2000. Phylogeny of South African Gnaphilieae (Asteraceae) based on two coding sequences. Am. J. Bot., 87: 259-272

Berry, V. and O. Gascuel, 1996. On the interpretation of bootstrap trees: Appropriate threshold of clade selection and induced gain. Mol. Biol. Evol., 13: 999-1011

Chase, M.W., D.E. Soltis, R.G. Olmstead, D. Morgan, D.H. Les, B.D.Mishler, M.R. Duvall, R.A. Price, H.G. Hills, Y.L. Qui, K.A. Kron, J.H. Rettig, E. Conti, J.D. Palmer, J.R. Manhart, K.J. Sytsma, H.J. Michaels, W.J. Kress, K.G. Karol, W.D. Clark, M. Hedren, B.S.Gaut, R.K. Jansen, K.J. Kim, C.F. Wimpee, J.A. Smith, G.R.Furnier, S.H. Strauss, Q.Y. Xiang, G.M. Plunkett, P.S. Soltis, S.M. Swensen, S.E. Williams, P.A. Gadek, C.J. Quinn, L.E. Eguiarte, E. Golenberg, G.H. Learn, S.W. Graham, S.C.H. Barrett, S. Dayanandan and V.A. Albert, 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Ann. Misso. Bot. Gard., 80: 528-580

Cheng, Y.J., M. Carmen, H.J. Meng, W.W. Guo, N.G. Tao and X.X. Deng, 2005. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera. Tree Physiol., 25: 661-672

Corazza-Nunes, M.J., M.A. Machado, W.M.C. Nunes, M. Cristofani and M.L.P.N. Targon, 2002. Assesment of genetic variability in grapefruits (Citrus paradisi) and pummelos (C. maxima) using RAPD and SSR markers. Euphytica, 126: 169-176

Cristofani, M., M.A. Machado, V.M. Novelli, A.A. Souza and M.L.P.N.Targon, 2003. Construction of linkage maps of Poncirus trifoliata Deng, Z.N., S. La-Malfa, X.M. Xie, X.G. Xiong and A. Gentile, 2007. Identification and evaluation of chloroplast uni- and trinucleotide sequence repeats in citrus. Sci. Hortic., 111: 186-192

Di-Majo, D., M. Giammanco, M. La-Guardia, E. Tripoli, S. Giammanco and E. Finotti, 2005. Flavanones in Citrus fruit: Structure-antioxidant activity relationships. Food Res. Int., 38: 1161-1166

Ebrahimzadeh, M.A., S.J. Hosseinimehr and M.R. Gayekhloo, 2004. Measuring and comparison of vitamin C content in Citrus fruits: introduction of native variety. Chem. Ind. J., 1: 650-652

FAO, 2008. Food and Agriculture Organization. FAOSTAT. Statistical database http://faostat.fao.org Felsenstein, J., 1983. Statistical inference of phylogenies (with discussion). J. R. Stat. Soc., Series A (Stat Soc.), 146: 246-272

Fernandez-Lopez, J., N. Zhi, L. Aleson-Carbonell, J.A. PerezAlvarez and V.Kuri, 2005. Antioxidant and antibacterial activities of natural extracts: application in beef meatballs. Meat Sci., 69: 371-380

Golein, B., A. Talaie, Z. Zamani, A. Ebadi and A. Behjatnia, 2005. Assessment of Genetic variability in some Iranian sweet oranges (Citrus sinensis [L.] Osbeck) and mandarins (Citrusreticulate Blanco) using SSR markers. Int. J. Agric. Biol., 7: 169-170

Hertog, M.G.L., E.J.M. Feskeens, C.H. Holmann, M.B. Katan and D.Kromhout, 1993. Dietary antioxidant flavonoids and risk of coronary heart disease: The Zutphen elderly study. Lance, 342: 1007-1011

Jayaprakasha, G.K. and B.S. Patil, 2007. In vitro evaluation of the antioxidant activities in fruit extracts from citron and blood orange. Food Chem., 101: 410-418

Jena, S.N., S. Kumarand and N.K. Nair, 2008. Molecular phylogeny in Indian Citrus L. (Rutaceae) inferred through PCR RFLP and trnL- trnF sequence data of chloroplast DNA. Conservation Biology and Molecular Taxonomy Laboratory, National Botanical Research Institute, Lucknow, India. Sci. Hortic., 119: 403-416

Kaur, C. and H.C. Kapoor, 2001. Antioxidants in fruits and vegetables-the millennium's health. Int. J. Food Sci. Tech., 36: 703-725

Kijas, J.M.H., J.C.S. Fowler and M.R. Thomas, 1995. An evaluation of sequence tagged microsatellite site markers for genetic analysis within citrus and related species. Genome, 38: 349-355

Liu, Y.Z. and X.X. Deng, 2007. Citrus Breeding and Genetics in China. National Key Laboratory of Crop Genetic Improvement; College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan,China. Asian-Aust. J. Plant Sci. Biotech., 1: 23-28

Loveless, M.D. and J.L. Hamrick, 1984. Ecological determinants of genetic structure in plants populations. Annu. Rev. Ecol. Evol. Syst., 15: 65-95

Loveless, M.D., 1992. Isozyme variation in tropical trees: patterns of genetic organization. New For., 6: 165-175

Lu, Z., Z. Zhou and R. Xie, 2011. Molecular phylogeny of the "True Citrus Fruit Trees" group (Aurantioideae, Rutaceae) as inferred from chloroplast DNA sequence. Agric. Sci. China, 10: 49-57

Mabberley, D.J., 2008. Mabberley's Plant-book: A Portable Dictionary of Plants, 3rd edition, p: 1021. Cambridge University Press, Avon, UK Manthley, J.A. and K. Grohmann, 1996. Concentrations of hesperidin and other orange peel flavonoids in Citrus processing by products. J. Agric. Food Chem., 44: 811-814

Manthley, J.A. and K. Grohmann, 2001. Phenols in citrus peel byproducts. Concentrations of hydroxycinnamates and polymethoxylated flavones in Citrus peel molasses. J. Agric. Food Chem., 49: 3268-3273

Martin, F.R., M.J. Frutos, J.A. Perez-Alvarez, F. Martinez-Sanchez and J.A.Del-Rio, 2002. Flavonoids as nutraceuticals: structural related antioxidant properties and their role on ascorbic acid preservation. In: Studies in Natural Products Chemistry, pp: 324-389. Atta Ur- Rahman (ed.). Elsevier Science Amsterdam, The Netherlands Morton, C.M., M. Grant and S. Blackmore, 2003. Phylogenetic relationships of theAurantioideae inferred from chloroplast DNA sequence data. Amer. J. Bot., 90: 1463-1469

Muhammad, M.A., S. Rehman, F.M. Anjum and E.E. Bajwa, 2006. Comparative Physical Examination of Various Citrus Peel Essential Oils. Int. J. Agric. Biol., 8: 186-190

Naeem, I., A. Taskeen and S. Iqbal, 2011. Quantitative Analysis of Flavonols in the Peels of Fruits by reversed phase high performance liquid chromatography. Electr. J. Environ. Agric. Food Chem., 10:2331-2336

Okwu, D.E. and I.N Emenike, 2006. Evaluation of the phyto-nutrients and vitamins content of Citrus fruits. Int. J. Mol. Med. Adv. Sci.,2: 1-6

Pang, X.M., C.G. Hu and X.X. Deng, 2003. Phylogenetic relationships among Citrus and its relatives as revealed by SSR markers. Acta. Genet. Sin., 30: 81-87

Richards, E.J., 1997. Preparation of plant DNA using CTAB. Plant Mol.Biol. Rep., 2: 10-11

Small, R.L., E.B. Lickey, J. Shaw and W.D. Hauk, 2005. Amplification of non-coding chloroplast DNA for phylogenetic studies in lycophytes and monilophytes with comparative example of relative phylogenetic utility from ophioglossaceae. Mol. Phylogenet. Evol.,36: 507-522

Small, R.L., R.C. Cronn and J.F. Wendel, 2004. Use of nuclear genes for phylogeny reconstruction in plants. Aust. Syst. Bot., 17: 145-170

Swingle, W.T. and P.C. Reece, 1967. The botany of Citrus and its wild relatives of the orange subfamily. In: The Citrus industry, revised 2nd edition, Vol. 1, pp: 190-430. Reuther, W., H.J. Webber and L.D. Batchelor, (eds.). History, world distribution, botany and varieties, University of California, Berkeley, California, USA

Taberlet, P., L. Gielly, G. Pautou and J. Bouvet, 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol., 17: 1105 W. 1109

Turktas, M., M. Aslay, E. Kaya and F. Ertugrul, 2012. Molecular characterization of phylogenetic relationships in Fritillaria species inferred from chloroplast trnL-trnFsequences. Turk. J. Biol., 36: 552-560

Whiteside, J.O., Garnsey, S.M. and L.W. Timmer, 1988. Compendium of Citrus Diseases. The American Phytopathology Society Press, St. Paul, MN Zane, L., L. Bargelloni and T. Patamello, 2002. Strategies for microsatellite isolation. Mol. Ecol., 11: 1-6

For correspondence: tmahmood.qau@gmail.com; tmahmood@qau.edu.pk

To cite this paper: Wali, S., F. Munir and T. Mahmood, 2013. Phylogenetic studies of selected Citrus species based on chloroplast gene, rps14. Int. J. Agric. Biol., 15: 357-361
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Wali, Shumaila; Munir, Faiza; Mahmood, Tariq
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9PAKI
Date:Apr 30, 2013
Words:4036
Previous Article:Estimation of Yield Damage in Potato Caused by Iranian Population of Globodera rostochiensis with and without Aldicarb under Greenhouse Conditions.
Next Article:Genetic Diversity in Hyper Glucose Oxidase Producing Aspergillus niger UAF Mutants by using Molecular Markers.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |