Printer Friendly

Peptidases from latex of Carica candamarcensis upregulate COX-2 and IL-1 mRNA transcripts against Salmonella enterica ser. Typhimurium-mediated inflammation.

1. Introduction

Carica candamarcensis (Caricaceae) is a plant native to western South America, popularly known as mountain papaya. After injury, the leaves and outer layers of the endocarp release a large amount of latex that is rich in carbohydrates, vitamins, minerals, and proteins [1, 2]. Previously, laticifer protein fractions from C. candamarcensis were obtained by chromatography in a Sephadex column named P1G10 and P2G10 [3]. The P1G10 fraction is rich in cysteine peptidases with proteolytic activity at least five times higher than C. papaya [1, 4].

Plant peptidases are usually implicated in protein processing in response to different external stimuli and in removal of misfolded proteins [5]. These properties have proven beneficial for the treatment in vivo of worm infections caused by Heligmosomoides polygyrus with papaya latex, since peptidases promote digestion of the worms' cuticle [6]. In particular, the fraction P1G10 of C. candamarcensis has also shown antiulcerogenic activity, similar to omeprazole or ranitidine, with effects on gastric healing that were correlated with an angiogenic stimulus [7]. P1G10 has mitogenic properties in cultured fibroblasts and epithelial cells [3] related to two peptidases already identified: CMS2MS2 and CMS2MS3 [8]. Moreover, shortening of epithelialization in a skin burn injury model was shown when P1G10 was applied at a concentration of 0.1% [9].

Previously we have shown that plant laticifer proteins can potentially be used for control of inflammatory processes derived from systemic infections [10]. Using a model of typhoid fever in rodents caused by S. enterica ser. Typhimurium, we have shown that cysteine peptidases from the laticifer fluid of Calotropis procera influence the release of proinflammatory cytokines, exhibit thrombin- and plasminlike activities, and maintain coagulation homeostasis in septic mice [11, 12]. These protein fractions have been exploited in immunotherapy, since plant peptidases can potentially mimic endogenous human peptidases involved, for example, with coagulation, digestion, and apoptosis. In the present study, the role of P1G10 of C. candamarcensis in inflammatory response was investigated in Swiss mice experimentally infected with S. Typhimurium.

2. Methods

2.1. C. candamarcensis Latex Proteins. A voucher specimen of the plant was deposited at the herbarium of the Universidad de La Serena, Chile (number 15063). The latex was collected by several incisions on the surface of the green fruit with sharp blade. After collection, it was lyophilized and stored in the dark at -20[degrees]C until use. Then the sample was dissolved and equilibrated with sodium acetate buffer 1M (pH 5.0) and applied in a Sephadex G10 column. The C18 column (Vydac) was equilibrated with 27% acetonitrile in 0.1% trifluoroacetic acid (TFA) before injection of 1mg P1G10 dissolved in milliQ water, followed by elution with a nonlinear acetonitrile-0.1% TFA gradient. Protein measurement was performed using egg-white lysozyme as standard, according to Lowry et al. [13]. The samples were screened by determining the absorbance at 280 nm and the amidase activity [3]. The first peak with amidase activity constituted the fraction P1G10.

2.2. Microorganisms. Salmonella enterica subsp. enterica ser. Typhimurium were isolated from a human clinical case sample, maintained by Ezequiel Dias Foundation (FUNED, Belo Horizonte, MG, Brazil) and was kindly provided by Dr. Jacques Robert Nicoli (Federal University of Minas Gerais, Brazil). The bacteria were kept at -18[degrees]C in brain heart infusion (BHI) culture medium containing 50% glycerol. During the experiments, the bacteria were activated by being cultured in bHi broth for 24 hours at 37[degrees]C.

2.3. In Vitro Antimicrobial Activity. The antimicrobial activity of P1G10 was assessed using the broth dilution method [14]. The proteins were dissolved in phosphate buffered saline (PBS) to give final concentrations ranging from 1 mg/mL to 0.0019 mg/mL in Mueller-Hinton broth tubes containing S. Typhimurium (105 CFU/mL). All assays were performed in duplicate. Control tubes lacked latex proteins. The minimum inhibitory concentration was estimated as the lowest concentration that inhibited visible growth after incubation for 24 h at 37[degrees]C.

2.4. Animals. All procedures were conducted in accordance with internationally accepted principles on the use of laboratory animals and were approved by the experimental ethics committee of Pernambuco Federal Rural University (Process 23082.012528/2012). Swiss mice (Mus musculus) were obtained from the collection of the Keizo Asami Immunopathology Laboratory (LIKA) of Federal University of Pernambuco. The mice weighed 30-35 grams and were kept in cages with controlled lighting (12 h light/dark cycles), 25[degrees]C with free access to water and commercial feed (Purina, Paulinia, SP, Brazil). The experiments were performed at the Microbiology and Immunology Laboratory of Federal Rural University of Pernambuco.

2.5. Experimental Peritonitis Induced by Carrageenan or Heat-Killed S. Typhimurium. The protocol was adapted from Alencar et al. [15]. The protein fraction P1G10 of C. candamarcensis was administered at concentrations of 1 or 10 mg/kgintraperitoneally (i.p.) to uninfected Swiss mice (n = 5). The control groups were given PBS. After 30 minutes; the peritonitis was induced by i.p. administration of 0.2 mL of a carrageenan solution (0.5mg/animal) or heat-killed S. Typhimurium (107 CFU/mL; 100[degrees]C/30min). After 6h, the animals were euthanized under anesthesia with isoflurane. For the total leukocyte count in the blood and peritoneal fluid, 20 [micro]L was homogenized with 380 [micro]L of the Turk reagent. An aliquot of this solution was withdrawn and placed in a Neubauer chamber, and leukocytes were counted under an optical microscope. The differential count was made from smears stained with eosin methylene blue-Giemsa [16].

2.6. Experimental Infection with S. Typhimurium. The protocol was adapted from Lima-Filho et al. [10]. Mice were divided into four groups (n = 6) as follows: experimental groups were i.p. administered with 0.2 mL of P1G10 in sterile PBS (137 mM NaCl, 10 mM [Na.sub.2]HP[O.sub.4]2[H.sub.2]O, 2 mM K[H.sub.2]P[O.sub.4]), pH 7.2, at quantities of 1, 5, or 10 mg/kg, while the control group received 0.2 mL of PBS. After 24 hours, all animals were challenged also by the i.p. route with 0.2 mL of a suspension containing 107 CFU/mL of S. Typhimurium. The clinical symptoms and survival after infection were monitored every 24 hours for seven days. Surviving animals were subjected to euthanasia with isoflurane at the end of experiment. Two other animal groups (n = 10 each), administered with P1G10 (10 mg/kg) or PBS and infected with S. Typhimurium, were submitted to euthanasia 24 h or 72 h after infection, and samples of blood, peritoneal fluid, spleen, and the liver were collected for analysis.

2.7. Assessment of the Bacterial Clearance after Infection. The spleen and livers were removed aseptically and homogenized in PBS pH 7.2. The suspensions of these organs and samples of blood were submitted to serial decimal dilutions. Then, an aliquot of 0.1 mL of each dilution was plated on a MacConkey agar plate. The plates were incubated in a growth chamber for 24 h at 37[degrees]C for later quantification of the colony forming units [11].

2.8. Histopathological Analysis. Tissue samples of spleen and liver were collected after 72 h of infection of all animal groups, fixed in 10% formaldehyde and embedded in paraffin blocks. Histological sections with 5 [micro]m thickness were stained with hematoxylin-eosin. The slides were examined by a single pathologist, who was unaware of the experimental conditions.

2.9. Assessment of Gene Expression of Inflammatory Mediators. A section of each animal's liver was removed aseptically and homogenized in 0.5 mL of TRIzol Reagent (Invitrogen) to extract total RNA, following the protocol suggested by the manufacturer. Quantification of RNA was performed by spectrophotometry at 260 nm and its integrity was confirmed by electrophoresis on 1% agarose gel [11]. The construction of cDNA and amplification by real-time PCR were performed using a commercial kit, following the manufacturer's instructions (Sigma-SYBR-Green Quantitative RT-PCR kit).

The following primers were used: [beta]-actin Mouse (Internal Control) ATATCGCTGCGCTGGTCGTC 3', 5' AGGATGGCGTGAGGGAGAGC 37; tumor necrosis factor-a (TNFa) (5' GATCTCAAAGACAACCAACTAGTG3', 5' CTCCAGCTGGAAGACTCCTCCCAG 37); Ciclooxigenase-2 (COX-2) (5' AGTTTTT CAAGACAGATCATAAGCG 3', 5' TGCTCCTGCTTGAGATGTCG 3'); inducible Nitric Oxide Synthase (iNOS) (5' AAGCACATGCAGAATGAGTACCG 3', 5' GTGGGACAGCTTCTGGTCGAT 3'); interleukin-10 (IL-10) (forward 5' CGGGAAGACAATAACTG 3', reverse 51 CATTTCCGATAAGGCTTG 37); and gamma-interferon ([gamma]-IFN) (5' GGTGAC ATGAAAATCCTGCAGAGC 3', 5' CGCTGGACCTGTGGGTTGTTGACC 3').

The results were analyzed according to Dussault and Pouliot [17]. For comparison of the levels of expression of genes of interest (G.I.) between control and experimental groups, we used the following formula:

[DELTA][DELTA]Ct = [(Ct G.I. Control - Ct Actin Control) - (Ct G.I. Experimental - Ct Actin Experimental)]. (1)

The results were expressed in terms of fold variation with formula: [2.sup.[DELTA][DELTA]CT].

2.10. Quantification of Nitric Oxide in Serum of Animals. The determination of nitric oxide in blood serum was carried out in the form of nitrite. N[O.sup.*] was first transformed into N[O.sub.3.sup.-] by dioxygenation. The conversion of nitrate (N[O.sub.3.sup.-]) into nitrite (N[O.sub.2.sup.-]) was performed by the action of the enzyme nitrate reductase, using a commercial kit (R&D Systems).

2.11. Statistical Analysis. The results are expressed as mean [+ or -] standard error of the mean (SEM). For comparison of multiple parametric data, we used analysis of variance (ANOVA) followed by Bonferroni's test or the Student-Newman-Keuls test. The significance level was P < 0.05. The analysis and processing of the results were performed using the GraphPad Prism program (version 5.0).

3. Results

P1G10 was not bacteriostatic or bactericidal against the strain of S. Typhimurium used for all experiments described here at any of the dosages tested. Pretreatments with P1G10 did not significantly increase the infiltration of leukocytes into the peritoneal cavity induced by carrageenan or heat-killed Salmonella (P > 0.05) (data not shown). However, the number of neutrophils in the bloodstreams of P1G10-pretreated mice was increased after injection with carrageenan (P < 0.05), but not eosinophils, basophils, or lymphocytes (Table 1). Moreover, pretreatments with P1G10 increased the number of circulating lymphocytes when mice were injected with heat-killed Salmonella (P < 0.05) (Table 1).

Survival of Swiss mice pretreated with P1G10 was dose-dependent and reached 60% of the animal group after seven days' infection with Salmonella (P < 0.05) (Figure 1(a)). After 24 and 72 h of infection, the number of viable bacteria in blood and the spleen did not differ significantly between the animal groups (P > 0.05). But the bacterial load in the liver of mice pretreated with P1G10 was significantly reduced 72 h after infection (P < 0.05) (Figure 1(b)). Conversely, untreated animals (PBS group) died 1-3 days after infection. There was a high infiltration of leukocytes into the peritoneal cavity of P1G10-pretreated mice 72 h after infection (P < 0.05) (Figure 1(c)). But the total leukocyte counts in the bloodstreams or the hematological profile of leukocyte populations was similar between the animal groups (data not show).

The histological evaluation of the liver of the control animals after 72 h of infection revealed inflammatory infiltration, thrombus formation, pyknotic nuclei, hepatic necrosis, and intense diffuse cytoplasmic vacuolization (Figure 2(a)). In the same period, the liver of animals pretreated with P1G10 showed mild vacuolization of hepatocytes, mild signs of necrosis, presence of microabscesses and accumulations of mononuclear cells (Figure 2(b)). The analysis of the spleen of control animals 72 h after infection revealed that the presence of splenic parenchyma in areas of inflammation and necrosis in lymphoid depletion with multinucleated cells (Figure 2(c)), while the spleen of animals pretreated with P1G10 only had slight inflammation and absence of multinucleated giant cells (Figure 2(d)).

The examination of mRNA transcripts of inflammatory mediators in liver cells 24 h after infection confirmed fold variation increases of 5.8 and 4.8 on average for IL-1 and COX-2, respectively, in mice pretreated with P1G10 (Figures 3(a) and 3(b)). Conversely, the gene expression levels of TNF-[alpha], IL-10, [gamma]-IFN, and iNOS were comparable to untreated animals (Figure 3(a)). Indeed, the N[O.sup.*] serum levels in experimental mice were not particularly altered in comparison to the control ones 72 h after infection (Figure 3(c)).

4. Discussion

5. Typhimurium provokes a syndrome similar to the human typhoid fever caused by S. Typhi in the murine model, which has been used to study severe inflammatory processes derived from bacterial infections [18,19]. Systemic infections caused by Salmonella typically induce the failure of leukocyte migration to the infection site, among other inflammatory disorders, leading to septic shock and death [20, 21]. In the present study, we have shown that P1G10 has immunomodulatory properties, which varied between infected and uninfected models.

Preliminary assays that used carrageenan or heat-killed Salmonella as phlogistic agents have shown that P1G10 stimulated the proliferation of circulating neutrophils and lymphocytes, which are important for resistance against salmonelosis [22]. Although the hematological profile was not particularly affected in a real infection, pretreatments with P1G10 increased the survival of mice after a lethal inoculum of S. Typhimurium in a dose-dependent manner. This protective effect was confirmed through histological examination in the main target organs of infection, the liver and spleen. Additionally, the infiltration of leukocytes into the peritoneal cavity was only significant in mice pretreated with P1G10 after infection (but not after carrageenan or heat-killed Salmonella injection). Since Salmonella actually have the ability to grow in the peritoneal cavity after i.p. inoculums, we hypothesize that P1G10 immunomodulation was boosted by the continuous intracellular bacterial growth into target organs during the infection.

As an attempt to explain the above results, we investigated the influence of P1G10 on inflammatory mediators. The activation of proinflammatory cytokines such as TNF-[alpha] and IL-1[beta] is important for host resistance against Salmonella, since they induce maturation of dendritic cells with implications on initiation of the adaptive immune response [23]. Moreover, nitric oxide (N[O.sup.*]) is often released after the inducible nitric oxide synthase (iNOS) is triggered by cytokines such as TNF-[alpha] and IFN-[gamma] [19]. However, our data show that mRNA expression levels of both TNF-[alpha] and IFN-[gamma] were comparable to the control mice, which died one to three days after infection. In spite of the microbicidal role of N[O.sup.*] in the intracellular environment, which could explain the lower number of colony forming units in the liver of experimental mice 72 h after infection, it was apparently not decisive to increase survival of experimental mice.

High serum levels of TNF-[alpha] have been shown to increase the severity of septic infections, while mice deficient in the production of IL-1[beta] are resistant to septic shock [24-26]. On the other hand, mRNA transcripts of IL-1[beta] and COX2 were upregulated in mice pretreated with P1G10 after infection. Interleukin-1[beta] has as main source macrophages stimulated by TNF-[alpha] or bacterial LPS and is responsible for promoting the recruitment of leukocytes to the infection site [20]. Furthermore, COX-2 enzyme is inducible by inflammation, converting arachidonic acid to prostaglandin, with its regulation being dependent on IL-1 among other stimuli [27]. Prostaglandin E2 (PGE2) exerts local inflammation and phagocyte-mediated immunity at the infection site but has anti-inflammatory properties in extended immune responses [28]. Although Salmonella infection naturally augments COX-2 mRNA expression and PGE2 synthesis [29], P1G10 pretreatments apparently contribute to recruitment and activation of leukocytes in early infection.

Previous studies have shown different effects of plant peptidases on inflammatory response. For example, bromelain, a mix of peptidases derived from pineapple stem with antiinflammatory properties, affects T-cell mRNA expression of IL-2, IL-4, and IFN-[gamma] in colon epithelial cell lines [30, 31]. Bromelain also blocks S. Typhimurium induced ERK-1, ERK-2, and c-Jun NH2-terminal kinase (JNK) activation in Caco-2 cells [32]. Additionally we have shown that laticifer peptidases of C. procera promote downregulation of IL-1[beta], among other inflammatory mediators, during infection by S. Typhimurium [10,11]. In general, plant peptidases appears to exert their biological actions indirectly on immune cells due to the proteolytic cleavage of membrane surface molecules triggering (or abrogating) the inflammatory cascade [33, 34]. For instance, peptidases of C. candamarcensis is shown to stimulate proliferation of specific cell lines such as L929, MDA-MB231, and BHK-21 [35], and this effect was further associated with an increase in activity of Erk2, a component of the MAP kinase pathway [8]. Since the MApK/ERK pathway is involved in IL-1[beta]-induced COX-2 expression and PGE2 production [36], it is reasonable to assume that pretreatments with P1G10 potentially influenced the MAP kinase pathway in vivo after infection by Salmonella.

Although the specific mechanism enhanced by P1G10 in the immune system is still to be elucidated, we have shown that early activation of inducible proinflammatory mediators possibly contributed to local bacterial killing, increasing the survival of mice after infection. Moreover, activation was not downregulated by IL-10, since no mRNA transcripts were detected for the cytokine in early infection. Since medicinal plants have been traditionally used for prevention of infectious diseases caused by different etiological agents, the clinical relevance of P1G10 is clear. Finally, we conclude that P1G10 is a source of immunomodulatory proteases that could be used for activation of the immune response against intracellular pathogens.

http://dx.doi.org/10.1155/2014/819731

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgments

This study was funded by the Brazilian National Council for Scientific and Technological Research (CNPq) (Grant no. 562664/2010-6). The first author received an M.S. scholarship from CAPES agency, Brazil. The authors also thank Dr. Maria Helena Ribeiro for supplying the animals used in the present study.

References

[1] G. Baeza, D. Correa, and C. E. Salas, "Proteolytic enzymes in Carica candamarcensis," Journal of the Science of Food and Agriculture, vol. 51, pp. 1-9, 1990.

[2] V. Walraevens, M.-C. Vandermeers-Piret, A. Vandermeers, P. Gourlet, and P. Robberecht, "Isolation and primary structure of the CCI papain-like cysteine proteinases from the latex of Carica candamarcensis hook," Biological Chemistry, vol. 380, no. 4, pp. 485-488, 1999.

[3] C. A. Silva, M. T. R. Comes, R. S. Ferreira et al., "A mitogenic protein fraction in latex from Carica candamarcensis" Planta Medica, vol. 69, no. 10, pp. 926-932, 2003.

[4] R. D. Teixeira, H . A . L. Ribeiro, M .-T. R . Gomes, M . T. P Lopes, and C. E. Salas, "The proteolytic activities in latex from Carica candamarcensis" Plant Physiology and Biochemistry, vol. 46, no. 11, pp. 956-961, 2008.

[5] M. Grudkowska and B. Zagdanska, "Multifunctional role of plant cysteine proteinases," Acta Biochimica Polonica, vol. 51, no. 3, pp. 609-624, 2004.

[6] G. Stepek, A. E. Lowe, D. J. Buttle, I. R. Duce, and J. M. Behnke, "The anthelmintic efficacy of plant-derived cysteine proteinases against the rodent gastrointestinal nematode, Heligmosomoides polygyrus, in vivo," Parasitology, vol. 134, no. 10, pp. 1409-1419, 2007

[7] V. J. Mello, M. T. R. Gomes, F. O. Lemos et al., "The gastric ulcer protective and healing role of cysteine proteinases from Carica candamarcensis," Phytomedicine, vol. 15, no. 4, pp. 237-244, 2008.

[8] M. T. R. Gomes, V. J. Mello, K. C. Rodrigues et al., "Isolation of two plant proteinases in latex from Carica candamarcensis acting as mitogens for mammalian cells," Planta Medica, vol. 71, no. 3, pp. 244-248, 2005.

[9] F. S. L. Gomes, C. de V. Spinola, H. A. Ribeiro, M. T. P. Lopes, G. D. Cassali, and C. E. Salas, "Wound-healing activity of a proteolytic fraction from Carica candamarcensis on experimentally induced burn," Burns, vol. 36, no. 2, pp. 277-283, 2010.

[10] J. V. Lima-Filho, J. M. Patriota, A. F. B. Silva et al., "Proteins from latex of Calotropis procera prevent septic shock due to lethal infection by Salmonella enterica serovar Typhimurium," Journal ofEthnopharmacology, vol. 129, no. 3, pp. 327-334, 2010.

[11] R. S. B. Oliveira, I. S. T. Figueiredo, L. B. N. Freitas et al., "Inflammation induced by phytomodulatory proteins from the latex of Calotropis procera (Asclepiadaceae) protects against Salmonella infection in a murine model of typhoid fever," Inflammation Research, vol. 61, pp. 689-698, 2012.

[12] M. V. Ramos, C. A. Viana, A. F. B. Silva et al., "Proteins derived from latex of C. procera maintain coagulation homeostasis in septic mice and exhibit thrombin- and plasmin-like activities," Naunyn-Schmiedebergs Archives of Pharmacology, vol. 385, pp. 455-463, 2012.

[13] O. H. Lowry, N. J. Rosebrough, A. L. Farr, and R. J. Randall, "Protein measurement with the Folin phenol reagent," The Journal of Biological Chemistry, vol. 193, no. 1, pp. 265-275, 1951.

[14] E. W. Koneman, S. D. Allen, W. M. Janda, P. C. Schreckenberger, and W. C. Winn, Diagnostico microbiologico: texto e atlas colorido, MEDSI, Rio de Janeiro, Brazil, 2008.

[15] N. M. N. Alencar, I. S. T. Figueiredo, M. R. Vale et al., "Antiinflammatory effect of the latex from Calotropis procera in three different experimental models: Peritonitis, paw edema and hemorrhagic cystitis," Planta Medica, vol. 70, no. 12, pp. 1144-1149, 2004.

[16] G. E. P. De Souza and S. H. Ferreira, "Blockade by antimacrophage serum of the migration of PMN neutrophils into the inflamed peritoneal cavity," Agents and Actions, vol. 17, no. 1, pp. 97-103, 1985.

[17] A.-A. Dussault and M. Pouliot, "Rapid and simple comparison of messenger RNA levels using real-time PCR," Biological Procedures Online, vol. 8, no. 1, pp. 1-10, 2006.

[18] S. Zhang, R. A. Kingsley, R. L. Santos et al., "Molecular pathogenesis of Salmonella enterica serotype typhimuriuminduced diarrhea," Infection and Immunity, vol. 71, no. 1, pp. 112, 2003.

[19] P. Mastroeni and A. J. Grant, "Spread of Salmonella enterica in the body during systemic infection: unravelling host and pathogen determinants," Expert Reviews in Molecular Medicine, vol. 13, article e12, 2011.

[20] C. F. Benjamim, "Present understanding of mediators and experimental models of sepsis," Medicina, vol. 34, pp. 18-26, 2001.

[21] J. C. Alves-Filho, C. Benjamim, B. M. Tavares-Murta, and F. Q. Cunha, "Failure of neutrophil migration toward infectious focus in severe sepsis: a critical event for the outcome of this syndrome," Memorias do Instituto Oswaldo Cruz, vol. 100, no. 1, pp. 223-226, 2005.

[22] A. Berndt, J. Pieper, and U. Methner, "Circulating yS T cells in response to Salmonella enterica serovar enteritidis exposure in chickens," Infection and Immunity, vol. 74, no. 7, pp. 3967-3978, 2006.

[23] T. Van Der Poll and H. P. Sauerwein, "Tumour necrosis factora: its role in the metabolic response to sepsis," Clinical Science, vol. 84, no. 3, pp. 247-256, 1993.

[24] L. C. Casey, R. A. Balk, and R. C. Bone, "Plasma cytokine and endotoxin levels correlate with survival in patients with the sepsis syndrome," Annals of Internal Medicine, vol. 119, no. 8, pp. 771-778, 1993.

[25] B. Gardlund, J. Sjolin, A. Nilsson, M. Roll, C.-J. Wickerts, and B. Wretlind, "Plasma levels of cytokines in primary septic shock in humans: correlation with disease severity," Journal of Infectious Diseases, vol. 172, no. 1, pp. 296-301,1995.

[26] P. Li, H. Allen, S. Banerjee et al., "Mice deficient in IL-1[beta]-converting enzyme are defective in production of mature IL-1[beta] and resistant to endotoxic shock," Cell, vol. 80, no. 3, pp. 401-411, 1995.

[27] W. L. Smith and L. J. Marnett, "Prostaglandin endoperoxide synthase: Structure and catalysis," Biochimica etBiophysica Acta, vol. 1083, no. 1, pp. 1-17,1991.

[28] P. Kalinski, "Regulation of immune responses by prostaglandin E2," Journal of Immunology, vol. 188, no. 1, pp. 21-28, 2012.

[29] C. C. Bowman and K. L. Bost, "Cyclooxygenase-2-mediated prostaglandin E2 production in mesenteric lymph nodes and in cultured macrophages and dendritic cells after infection with Salmonella," Journal of Immunology, vol. 172, no. 4, pp. 24692475, 2004.

[30] T. L. Mynott, A. Ladhams, P. Scarmato, and C. R. Engwerda, "Bromelain, from pineapple stems, proteolytically blocks activation of extracellular regulated kinase-2 in T cells," Journal of Immunology, vol. 163, no. 5, pp. 2568-2575, 1999.

[31] L. P. Hale, D. J. Fitzhugh, and H. F. Staats, "Oral immunogenicity of the plant proteinase bromelain," International Immunopharmacology, vol. 6, no. 13-14, pp. 2038-2046, 2006.

[32] T. L. Mynott, B. Crossett, and S. R. Prathalingam, "Proteolytic inhibition of Salmonella enterica serovar Typhimuriuminduced activation of the mitogen-activated protein kinases ERK and JNK in cultured human intestinal cells," Infection and Immunity, vol. 70, no. 1, pp. 86-95, 2002.

[33] L. P. Hale and B. F. Haynes, "Bromelain treatment of human T cells removes CD44, CD45RA, E2/MIC2, CD6, CD7, CD8, and Leu 8/LAM1 surface molecules and markedly enhances CD2mediated T cell activation," Journal of Immunology, vol. 149, no. 12, pp. 3809-3816, 1992.

[34] L. P. Hale, P. K. Greer, and G. D. Sempowski, "Bromelain treatment alters leukocyte expression of cell surface molecules involved in cellular adhesion and activation," Clinical Immunology, vol. 104, no. 2, pp. 183-190, 2002.

[35] C. A. Silva, M. T. R. Comes, R. S. Ferreira et al., "A mitogenic protein fraction in latex from Carica candamarcensis," Planta Medica, vol. 69, no. 10, pp. 926-932, 2003.

[36] X. Wang, F. Li, C. Fan, C. Wang, and H. Ruan, "Analysis of isoform specific ERK signaling on the effects of interleukin-1[beta] on COX-2 expression and PGE2 production in human chondrocytes," Biochemical and Biophysical Research Communications, vol. 402, no. 1, pp. 23-29, 2010.

Maria Taciana Ralph, (1) Ayrles Fernanda Brandao Silva, (2) Dayane Laise da Silva, (1) Danielle Cristina Oliveira do Nascimento, (1) Diogo Manoel Farias da Silva, (3) Manoel A. Gomes-Filho, (3) Paulo Roberto Eleuterio Souza, (1) Joaquim Evencio-Neto, (3) Marcio Viana Ramos, (2) Carlos Edmundo Salas, (4) and Jose Vitor Lima-Filho (1,5)

(1) Departamento de Biologia, Universidade Federal Rural de Pernambuco, 52171-900 Recife, PE, Brazil

(2) Departamento deBioqumica e Biologia Molecular, Universidade Federal do Ceara, 60020-181 Fortaleza, CE, Brazil

(3) Departamento de Morfologia e Fisiologia Animal, Universidade Federal Rural de Pernambuco, Recife, PE, Brazil

(4) Departamento de Biologia, Facultad de Ciencia, Universidade de La Serena, La Serena, Chile

(5) Rua Dom Manoel de Medeiros, s/n, Departamento de Biologia, Laboratario de Microbiologia e Imunologia (LAMIM), Universidade Federal Rural de Pernambuco, Campus Dois Irmaos, CEP, 52171-900 Recife, PE, Brazil

Correspondence should be addressed to Jose Vitor Lima-Filho; jvitor@db.ufrpe.br

Received 17 November 2013; Revised 9 January 2014; Accepted 24 January 2014; Published 13 March 2014

Academic Editor: Sandra Helena Penha Oliveira

TABLE 1: Leukocyte cell counts in the bloodstream of Swiss mice
pretreated with P1G10 6 h after injection of carrageenan or
heat-killed S. Typhimurium into the peritoneal cavity.

               Total leukocytes     Differential leukocyte cell counts
              ([10.sup.3] cells/    ([10.sup.3 cells/[mm.sup.3])
                 [mm.sup.3])
                                       Eosinophil

P1G10 (i.p) + 0.5 mg carrageenan (i.p.)

  PBS         5.90 [+ or -] 1.30    0.0 [+ or -] 0.0
  1 mg/Kg     4.37 [+ or -] 2.25    0.0 [+ or -] 0.0
  10 mg/kg   8.52 [+ or -] 1.56 *   0.0 [+ or -] 0.0

P1G10 (i.p.) + Heat-killed Salmonella (i.p.)

  PBS         4.40 [+ or -] 0.98    0.0 [+ or -] 0.0
  1 mg/Kg     4.32 [+ or -] 1.54    0.0 [+ or -] 0.0
  10 mg/kg   6.72 [+ or -] 0.66 *   0.0 [+ or -] 0.0

             Differential leukocyte cell counts
             ([10.sup.3 cells/[mm.sup.3])

                 Lymphocytes            Neutrophils

P1G10 (i.p) + 0.5 mg carrageenan (i.p.)

  PBS         3.58 [+ or -] 1.10     2.23 [+ or -] 0.53
  1 mg/Kg     2.69 [+ or -] 1.31     1.64 [+ or -] 0.97
  10 mg/kg    4.44 [+ or -] 1.22    4.02 [+ or -] 0.45 *

P1G10 (i.p.) + Heat-killed Salmonella (i.p.)

  PBS         2.93 [+ or -] 0.68     1.41 [+ or -] 0.30
  1 mg/Kg     3.10 [+ or -] 1.07     1.17 [+ or -]0.48
  10 mg/kg   4.63 [+ or -] 0.65 *    2.01 [+ or -] 0.59

             Differential leukocyte cell counts
             ([10.sup.3 cells/[mm.sup.3])

                 Monocytes           Basophils

P1G10 (i.p) + 0.5 mg carrageenan (i.p.)

  PBS        0.09 [+ or -] 0.04   0.0 [+ or -] 0.0
  1 mg/Kg    0.04 [+ or -] 0.03   0.0 [+ or -] 0.0
  10 mg/kg   0.06 [+ or -] 0.04   0.0 [+ or -] 0.0

P1G10 (i.p.) + Heat-killed Salmonella (i.p.)

  PBS        0.05 [+ or -] 0.04   0.0 [+ or -] 0.0
  1 mg/Kg    0.05 [+ or -] 0.03   0.0 [+ or -] 0.0
  10 mg/kg   0.08 [+ or -] 0.06   0.0 [+ or -] 0.0

* Significant difference in comparison to PBS group (P < 0.05).
COPYRIGHT 2014 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Ralph, Maria Taciana; Silva, Ayrles Fernanda Brandao; da Silva, Dayane Laise; do Nascimento, Daniell
Publication:Mediators of Inflammation
Article Type:Report
Date:Jan 1, 2014
Words:4722
Previous Article:Scropolioside B inhibits IL-1[beta] and cytokines expression through NF-[kappa]B and inflammasome NLRP3 pathways.
Next Article:Development and validation of protein microarray technology for simultaneous inflammatory mediator detection in human sera.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |