Printer Friendly

Penetrance of Novel Mutations of Endothelin-B receptor Gene in Pakistani Families with Waardenburg Syndrome.

Byline: Raheela Jabeen, Masroor Ellahi Babar, Jamil Ahmad and Ali Raza Awan

Abstract

Mutations in endothelin-ss- receptor gene (EDNRB) gene have been reported to cause Waardenburg syndrome (WS4) in humans. We investigated novel mutations in EDNRB gene and their association with WS4 in two Pakistani families named WSPK1 and WSPK2 using PCR and direct sequencing technique. A transition of T to C in codon (L361S) in exon 5 of EDNRB gene was found in family WSPK1. The mutation was found in the homozygote patients with WS4 and their asymptomatic heterozygote parents. In second family WSPK2, three mutations; a G to C transversion in codon 335 (C335S) in exon 5, a transition of T to C in codon (L361S) in exon 5 and a non coding transversion of T to A at - 30 nucleotide position of exon 5 were identified in the homozyote patients and the heterozygote asymptomatic parents. The patients and asymptomatic parents carried the same mutations. In both families, the parents have consanguineous marriage.

In this study, we have identified the penetrance of the novel mutations of EDNRB gene in two Pakistani families suffering with WS4. This is first report of WS4 and its correlation with the novel mutation described herein.

Key words: Endothelin-ss-receptor gene, EDNRB, Waardenburg syndrome, penetrance.

Waardenburg syndrome (OMIM; 193500) is a rare disorder (1 in 40000 live births) characterized by sensorineural deafness along with defects of neural crest-derived tissues and pigmentary abnormalities (1). Waardenburg Syndrome is responsible for 1-3% of total congenital deafness cases (Read and Newton, 1997). Waardenburg-Shah syndrome (WS4; MIM277580) is one of the four types of Waardenburg Syndrome that is characterized by the association of pigmentation abnormalities, including depigmented patches of the skin and hair, vivid blue eyes or heterochromia irides, and sensorineural hearing loss along with dystopia canthorum, musculoskeletal abnormalities of the limbs, Hirschsprung disease, or neurological defects (Pingault et al., 2010). The syndrome has been associated with the mutations of Endothelin-B recpetor (EDNRB) gene (Puffenberger et al., 1994a), which is present on human chromosome 13 (Arai et al., 1993).

Although genotype-phenotype association of EDNRB gene with WS4 has been established (McCallion and Chakravarti, 2001), but rarity of families suffering with WS intricate the investigation of novel mutations (unpublished) in EDNRB gene. The present study describes novel mutations of EDNRB gene and their penetrance in two Pakistani families suffering with WS.

Materials and methods

After obtaining a formal approval from the Institutional Review Board of Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences and written- informed consent from the families suffering with WS4, blood samples of two families (WSPK1 and WSPK2) were collected. Each of the families had two patients suffering with WS4. DNA extraction was performed from whole blood following standard phenol-chloroform extraction method (Sambrook and Russell, 2001) and was stored at -20oC. Seven pairs of primers were designed to amplify the exons and the flanking Intronic sequences of the EDNRB gene (Table I). Purified PCR products were sequenced with both forward and reverse primers using BigDye terminator cycle sequencing kit (Applied Biosystems, USA) on ABI 3130XL Genetic Analyzer. Sequence data were edited manually using Chromas Ver. 1.45, http:// www.technelysium.com. au/chromas.html).

Nucleotide sequences of all of the seven exons were used for multiple sequence alignments, which were performed with ClustalW freeware (http://www. ebi.ac.uk/Tools/clustalw2). The coding DNA sequences were conceptually translated to amino acid sequences using BioEdit software (http:// www.mbio.ncsu.edu/BioEdit).

Results

A transition of T to C in codon (L361S) in exon 5 of EDNRB gene was found in the family WSPK1 (Fig. 1). The mutation was found in the homozygote patients with WS4 and their asymptomatic heterozygote parents. In second family WSPK2, three mutations; a G to C transversion in codon 335 (C335S) in exon 5, a transition of T to C in codon (L361S) in exon 5 and a non coding transversion of T to A at -30 nucleotide position of exon 5 were detected in homozyote patients and heterozygote asymptomatic parents (Fig. 1B). The patients and asymptomatic parents carried the same mutations. In both families, the parents have consanguineous marriage (Figs. 1A,B). All of the disease causing mutations was homozygous and novel.

Discussion

Endothelin B receptor protein is encoded by EDNRB gene which is present on the chromosome band 13q22 and consists of 7 exons with a total length of 2400 bases (Arai et al., 1993). A 442- residue protein of heptahelical receptors is encoded by the gene that is involved in the G-protein- mediated intracellular signaling pathway (McCallion and Chakravarti, 2001). EDNRB mutations are mainly inherited from unaffected parents (Zhang et al., 2007). The inheritance pattern of EDNRB mutations is complex, but it cannot be defied that homozygotes have a high probability of developing disease phenotype. The term "not fully recessive-not fully dominant" can be used for the transmission of the mutations (Pingault et al., 2010). Missense mutations are speckled along the EDNRB

Table I.- Primer used for amplifcation of EDNRB gene.

Exon###Forward Primer Sequence###Reverse Primer Sequence###Product size

Exon 1###TCCTGTCTTCCTTCCTCTGC###CTCAAGCCCACCATGATTTC###600 bp

Exon 2###ACCAGAGTTTATCCTACTCTGCAT###GCACAGTTTATTTTCTAAGTAACATGG###298 bp

Exon 3###CTGTGCAATTCAATAAAACTAAGG###GGGAACAGGGGAAAAATAGC###339 bp

Exon 4###GAAGATAATCATTCCCTGATGAA###CAAGAAAAAGGAAATATGCTCTGG###373 bp

Exon 5###AAATGTCGTTTTAGAAGATAGAATGC###AAGATCGATGGAAACACTTCTGA###277 bp

Exon 6###AAGCACAGAAGCTACAATGACTACA###GCAGTTTTGAAAGCTTATATTTGA###250 bp

Exon 7###AACCCTGGAGAGGAGGAAGA###TTTGTTTTGGCAAATGTTTCA###290 bp

protein; in the extracellular, intracytoplasmic or the transmembrane domains. These can destabilize the protein and dwindle the number of receptors on the cell surface, impaired ligand binding, or alteration of the transduction signal (Pingault et al., 2010). Approximately 23 mutation have been reported in EDNRB gene so far (Lin et al., 2008). In this study, we have investigated two families with patients of WS4 for investigation of mutations in EDNRB gene. The study found a transition of T to C in codon (L361S) in exon 5 of EDNRB gene in the family WSPK1. The mutation was found in the homozygote patients with WS4 and their asymptomatic heterozygote parents. In second family WSPK2, three mutations; a G to C transversion in codon 335 (C335S) in exon 5, a transition of T to C in codon (L361S) in exon 5 and a non coding transversion of T to A at -30 nucleotide position of exon 5 were detected in homozyote patients and heterozygote asymptomatic parents.

The association of EDNRB mutations with WS4 was also revealed in a study of a large Mennonite femaily (Puffenberger et al., 1994b). A WS4 associated missense mutation (Trp276Cys) in EDNRB gene was identified in the inbred population. The study demonstrated that the EDNRB mutations have pleiotropic effects. And non-enteric phenotypes in the population could only expressed by homozygotic mutations. The study also described the incomplete and dosage sensitive penetrance of the phenotype (Puffenberger et al., 1994a). Following the study, there have been at least three further reports of homozygous EDNRB mutation associated with WS4 (Sangkhathat et al., 2005). Considering the reports, our study persuaded that the EDNRB mutations follow the recessive mode of inheritance to express the WS4 phenotype.

Pingault et al. (2010) revealed their observations that among the EDNRB homozygous (or compound heterozygous, either proved or suspected) cases, about 70% seemed to segregate with a fully recessive transmission, whereas in the remaining families, some heterozygous relatives present with isolated HD, constipation or depigmentation features. The inconsistency in mode of penetrance could be explained as a upshot of mutation position or difference in genetic modifiers (Sangkhathat et al., 2005). Conclusively, the overall transmission of EDNRB mutations is complex, but it can be considered that homozygotes have a high probability of developing severe phenotypes (Pingault et al., 2010). In summary, we described the penetrance of the mutations of EDNRB gene in two Pakistani families having patients of WS4. This is first report of WS4 and its correlation with the novel mutation described herein.

References

Arai, H., Nakao, K., Takaya, K., Hosoda, K., Ogawa, Y., Nakanishi, S. and Imura, H., 1993. J. biol. Chem., 268: 3463-70.

Lin, Y. C., Lai, H. S., Hsu, W. M., Lee, P. I., Chen, H. L. and Chang, M.H., 2008. J. Pediat. Gastroenterol. Nutr., 46: 36-40.

McCallion, A.S. and Chakravarti, A., 2001. Pigm. Cell. Res., 14: 161-9.

Pingault, V., Ente, D., Dastot-Le Moal, F., Goossens, M., Marlin, S. and Bondurand, N., 2010. Hum. Mutat., 31: 391-406.

Pingault, V., Girard, M., Bondurand, N., Dorkins, H., Van Maldergem, L., Mowat, D., Shimotake, T., Verma, I., Baumann, C. and Goossens, M., 2002. Hum. Genet., 111: 198-206.

Puffenberger, E. G., Hosoda, K., Washington, S. S., Nakao, K., Dewit, D., Yanagisawa, M. and Chakravart, A., 1994a. Cell, 79: 1257-66.

Puffenberger, E. G., Kauffman, E. R., Bolk, S., Matise, T. C., Washington, S.S., Angrist, M., Weissenbach, J., Garver, K. L., Mascari, M. and Ladda, R., 1994b. Hum. mol. Genet., 3: 1217-25.

Read, A. P. and Newton, V. E., 1997. J. med. Genet., 34: 656-65.

Sambrook, J. and Russell, D., 2001. Molecular cloning: a laboratory manual III., Cold Spring Harbour, Cold Spring Harbor Laboratory Press.

Sangkhathat, S., Chiengkriwate, P., Kusafuka, T., Patrapinyokul, S. and Fukuzawa, M., 2005. Pediat. Surg. Int., 21: 960-3.

Zhang, X. N., Zhou, M. N., Qiu, Y. Q., Ding, S. P., Qi, M. and Li, J. C., 2007. Biochem. Genet., 45: 523-7.

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, Pakistan, 2Molecular Biology/Human Genetics, Department of Biotechnology and Informatics, Balochistan University of Information Technology, Engineering and Management Sciences, Quetta, Pakistan, Correspondence: arawan77@uvas.edu.pk
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza
Publication:Pakistan Journal of Zoology
Article Type:Clinical report
Geographic Code:9PAKI
Date:Apr 30, 2012
Words:1569
Previous Article:Water Quality Assessment and Mapping for Water Supply System of Abbottabad's Urban Settlements.
Next Article:A Note on the Diet of Indian Wolf (Canis lupus) in Baltistan, Pakistan.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |