Printer Friendly

PHYLOGENETIC RELATIONSHIPS OF THE MALAY PENINSULA OTTERS (LUTRA SUMATRANA, LUTROGALE PERSPICILLATA, AND AONYX CINEREUS) BASED ON DNA SEQUENCES OF MITOCHONDRIAL D-LOOP REGION.

Byline: M. K. A Rosli, P. Abdul-Patah, S. M. F. Syed-Shabthar, M. N. Burhanuddin, T. Sekiguchi, H. Sasaki, M. N. Shukor, S. Yaakop and B. M. Md-Zain

ABSTRACT

Aonyx cinereus, Lutrogale perspicillata and Lutra sumatrana are three species of the Old World Otter that can be found in Peninsular Malaysia. The main objective of this research was to determine the phylogenetic relationships among these three otter genera using 401 bp DNA sequences of the D-loop region. Tree topologies were reconstructed using the Neighbor-Joining (NJ) and the Maximum Parsimony (MP) methods. Both NJ and MP trees showed that the three Otter species (A. cinereus, L. perspicillata, and L. sumatrana) formed their own monophyletic clade. The results also showed that L. perspicillata and A. cinereus were sister clades and closely related, which is supported by the bootstrap values of 85% (NJ) and 84% (MP). The two species also had a close genetic distance value of 0.031. The clades, consisting of both A.cinereus and L. perspicillata, were formed in a distinct group from L. sumatrana, which was found to be grouped with L. perspicillata in previous morphological studies.

The independent monophyletic clade of L. sumatrana was supported by high bootstrap values. These results imply that L. perspicillata does not belong to the same group as L. sumatrana which has been concluded in several previous molecular studies.

Key words: Otter, Aonyx cinereus, Lutrogale perspicillata, Lutra sumatrana, Malaysian otter, mtD-loop region.

INTRODUCTION

Otters are semi-aquatic mammals that belong to the family Mustalidae and to the subfamily Lutrinae (Hussain 1999). Most of these charismatic species are top predators in their respective communities and are threatened due to a combination of habitat loss, hunting, and pollution (Mason and MacDonald 1990). A total of 13 otter species are found in the world comprising seven distinct genera consisting of three major clades based on nuclear and mitochondrial markers (Koepfli and Wayne 1998). The three clades are: the sea and river otters of Eurasia and Africa (Aonyx, Enhydra, Hydrictis, Lutra, and Lutrogale), the marine and river otters from North, central, and South America (Lontra), and a basal lineage of Pteronura brasiliensis (Koepfli and Wayne 1998; Koepfli et al. 2008a; Koepfli et al. 2008b). In addition, Wilson and Reeder (2005) also recognize that there are 13 species in the Lutrinae subfamily.

Three species of otters can be found throughout the Peninsular Malaysia: Aonyx cinereus, Lutra sumatrana, and Lutrogale perspicillata (Shariff 1984; Burhanuddin 1990; Hussain et al. 2011). All three species are represented by three different genera in which A. cinereus originates from the genus Aonyx, L. perspicillata originates from the genus Lutrogale, and L. sumatrana originates from the genus Lutra (Duplaix 1975; Hwang and Lariviere 2005; IUCN 2010; Hussain et al. 2011). Based on previous systematic studies of morphological data, Lutra and Lutrogale are often grouped together in the Lutrini clade, and Amblonyx is grouped with Aonyx in the Aonychini clade (van Zyll de Jong 1987; van Zyll de Jong 1991; Willemsen 1992). However, molecular data has indicated that L. perspicillata is a sister clade of A. cinerius in a higher clade that is different from L. sumatrana, which is a species that was previously closely related to L. perspicillata morphologically (Koepfli et al. 2008).

Only few studies available involving the genetic aspects of otters in Peninsular Malaysia with a focus on population genetics of A. cinereus (Rosli et al. 2014). Molecular systematic research in Malaysia mainly focused on other mammals, such as cattle, human, primates, etc. (Md-Zain et al. 2010a; Md-Zain et al. 2010b; Vun et al. 2010; Rosli et al. 2011a; Rosli et al. 2011b). Mitochondrial D-loop is a non-coding region that has been extensively used in phylogenetic studies (Ang et al. 2011; Vianna et al. 2011). In this study, the mtD-loop region was selected due to its effectiveness in portraying relationships between species and population levels (Lim et al. 2010; Rosli et al. 2014). The main objective of this study was to portray the phylogenetic relationships of all three otter species in Peninsular Malaysia using the mitochondrial DNA sequences of the D-loop region.

MATERIALS AND METHODS

Samples and DNA isolation. Sampling was conducted in several Peninsular Malaysia states such as Terengganu, Perak, Kedah, Penang, Johor, Malacca, and Pahang (Fig. 1). The 27 collectedsamples represented all three Malaysian otter species: L. sumatrana, A. cinereus, and L. perspicillata. All samples (Table 1) were obtained with the help of various parties, such as the Department of Wildlife and National Parks (Wildlife and National Parks), the National Zoo of Malaysia, the museum of Zoology, the Universiti Kebangsaan Malaysia (UKM). Tissues of road kill and fecal samples were used in this study. Fecal samples were preserved in 70% ethanol solution to prevent damage. Tissue samples were stored in freezer at a temperature of -80C. The total genomic DNA was extracted using a standard extraction kit and the protocol provided by QIAGEND Neasy Tissue or Stool Kit (Qiagen).

DNA amplification. A polymerase chain reaction (PCR) was performed using a 25 l reaction mixture containing 1l of genomic DNA, 2.5lPCR Buffer 10X, 1 l 50 mMMgCl2, 0.5l 10mMdNTP mix, 1.5 l each of 10 pmol/l primer, and 4 units of Taq DNA Polymerase (Vivantis) in PTC-100 Thermal Cycler (MJ Research Inc.). The partial mtD-loop fragment of approximately 450 base pairs was amplified using forward primer tanaD-F (ACCATCAGCACCCAAAGCTG) and reverse primer tanaD-R (GGGCTGATTAGTCATTAGTCCA TC) (Masuki et al. 2008). The PCR conditions were as follows: 4 minutes denaturation at 94C followed by 30 cycles of 30 seconds at 94C, 30 seconds at 56C, 1 minute at 72C, and a final 7 minutes extension at 72C before cooling to 4C for 10 minutes in thethermal cycler.DNA from the PCR products was purified using a Vivantis G-F1 PCR Clean-up Kit (Vivantis) and was sent directly to a private laboratory (First Base Sdn. Bhd) for sequencing.

Phylogenetic analysis. The sequencing results were exported as FASTA sequence files. The mtD-loop sequences of studied samples were aligned using the Clustal W multiple alignment algorithm of Bio Edit and the outgroup sequences of palm civet (Paradoxurus hermaphroditus). All sequences were analyzed using PAUP4.0b10 (Swofford 2002) and MrBayes 3.1 (Huelsenbeck et al. 2001) for phylogeny reconstruction.

Two methods of analysis in the PAUP included: (1) Neighbor-joining (NJ) using the Kimura 2-parameter (Kimura 1980) model, and (2) Maximum Parsimony (MP) with stepwise addition 1000 replicates in a heuristic search (Swofford 2002). All trees were subjected to a bootstrap value of 1000 replicates. A genetic distance analysis was performed using the Kimura 2-parameter in PAUP4.0b10.

RESULTS

DNA from 30 samples was extracted, amplified, and sequenced. Sequences of 401 base pairs of hypervariable mtD-loop region were aligned. Prior to the sequence analysis, the Basic Local Alignment Search Tool (BLAST) was used to compare the nucleotide of sequence databases (NCBI) and to calculate the statistical significance of the matches. All DNA sequences matched the genus Lutrinae DNA sequences in the online database GenBank with a maximum identical index of between 90- 99%.

Sequence polymorphism. From the 30 aligned DNA sequences, a portion of the 347 bp representing 31.9% of the complete mtD-loop region were included for further analysis. From the analysis, 91 variable sites were detected in which 11 variable characters were parsimony- uninformative and 80 characters were parsimony- informative. This portion of the 23.1% of informative sites suggested that D-loop is not a conserved region in the mtDNA. The sequence analysis for the polymorphism of the mtD-loop sequences are summarized in Table 2.

Phylogenetic construction

Neighbor-joining. NJ trees were constructed using the Kimura-2-parameter algorithm and bootstrap test. NJ topology showed a clear separation between the outgroup (civet) and the ingroup (Fig. 2). All three otter species were grouped in a major clade that was different from the outgroup. The ingroup was divided into two main clades (Clade A and B). Clade A was divided into two subclades (Subclade I and II). Subclade I is a monophyletic clade of L. perspicillata with a bootstrap value of 99%, while Subclade II is a monophyletic clade of A. cinereus with a bootstrap value of 68%. Clade B is a monophyletic clade of L. sumatrana with a bootstrap value of 98%.

Maximum parsimony. An MP tree was constructed by performing a heuristic search with 1000 replications. The tree shared the same topology with NJ with the exception of a higher bootstrap value (Fig. 3). The bootstrap value for Subclade I is 100%, the value for Subclade II is 94%, and the value for Clade B is 100%. Based on the MP tree, several values of indexes were obtained. The values are: a Consistency index of CI=0.8947, a Homoplasy index of HI=0.1053, a Retention index of RI=0.9694, a Rescaled consistency index of RC=0.8673, and a tree length of 114.

Genetic distance analysis. A genetic distance analysis was performed using the Kimura-2-Parameter algorithm. Pairwise distances between samples from all three different genuses were calculated as shown in Table 3. The results showed that the biggest genetic distance value was obtained between A. cinereus and L. sumatrana with a value of 0.070. The closest genetic distance value was between L. perspicillata and A. cinereus with a value of 0.031. For the genetic distance between otter species and the outgroup, the values obtained were 0.254 (L. perspicillata), 0.232 (L. sumatrana), and 0.229 (A. cinereus).

Table 1. List of genetic samples used in this study.

No.###Sample Code###Species###Location###Type of Sample

1###L. perspicillata TP 7###L. perspicillata###Tanjung Piandang###Feaces

2###L. perspicillata TP 6###L. perspicillata###Tanjung Piandang###Feaces

3###L. perspicillata TP 5###L. perspicillata###Tanjung Piandang###Feaces

4###L. perspicillata TP 12###L. perspicillata###Tanjung Piandang###Feaces

5###L. perspicillata TP 13###L. perspicillata###Tanjung Piandang###Feaces

6###L. perspicillata KG 15###L. perspicillata###Kuala Gula###Feaces

7###L. perspicillata KG 16###L. perspicillata###Kuala Gula###Feaces

8###L. perspicillata KG 19###L. perspicillata###Kuala Gula###Feaces

9###L. perspicillataSP 3###L. perspicillata###Sungai paka###Feaces

10###L. perspicillataSP 4###L. perspicillata###Sungai paka###Feaces

11###L. perspicillataKJMN###L. perspicillata###Kg Jelutong Malim Nawar###Feaces

12###L. perspicillataKPS 5###L. perspicillata###Kampung Padang Salim###Feaces

13###L. perspicillataKPS 6###L. perspicillata###Kampung Padang Salim###Feaces

14###A. cinereusSampel7###A. cinereus###Kuala Gula###Feaces

15###A. cinereusSampel8###A. cinereus###Kuala Gula###Feaces

16###A. cinereusTM 12###A. cinereus###Tumpat###Feaces

17###A. cinereusTM 14###A. cinereus###Tumpat###Feaces

18###A. cinereusTM 15###A. cinereus###Tumpat###Feaces

19###A. cinereusPN 5###A. cinereus###Penarik###Feaces

20###A. cinereusPN 1###A. cinereus###Penarik###Feaces

21###A. cinereusPN 93###A. cinereus###Penarik###Feaces

22###L. sumatrana PI###L. sumatrana###Paya Indah###Feaces

23###L. sumatranaJHR###L. sumatrana###Johor###Tissues

24###L. sumatranaZM###L. sumatrana###Zoo Melaka###Tissues

25###L. sumatrana BR###L. sumatrana###Bera###Tissues

26###L. sumatranaKR###L. sumatrana###Kampar###Tissues

27###L. sumatranaPKN###L. sumatrana###Pekan###Tissues

28###CIVET PNG 29705 4###P. hermaphroditus###Penang###Feaces

29###CIVET PNG 30185 4###P. hermaphroditus###Penang###Feaces

30###CIVET PNG 30185 3###P. hermaphroditus###Penang###Feaces

Table 2.Summary of DNA variations along the sequences across taxa.

###Characters###Value

Total###347

Constant###256

Variation###91

Parsimony uninformative###11

Parsimony informative###80

A nucleotide frequency###0.296

T nucleotide frequency###0.292

C nucleotide frequency###0.247

G nucleotide frequency###0.165

Tree length###114

Table 3. Genetic distance of the three otter species of Malay Peninsular using Kimura 2 Parameter.

###L. perspicillata###A. cinerea###L. sumatrana

L. perspicillata###-

A. cinereus###0.031###-

L. sumatrana###0.062###0.070###-

P. hermaphroditus###0.254###0.229###0.232

DISCUSSION

A total length of 401 bp partial mtD-loop sequences were sequenced and edited using BioEdit software. In the sequence variation analysis, the selected region showed a significant DNA polymorphism with 111 characters from a total of 212 variable characters that were parsimony informative. This shows that the mtD- loop region is an effective locus to study DNA variation characteristics of otter species in a systematic study (Vianna et al. 2010; Vianna et al. 2011). In this study, NJ and MP phylogenetic tree topologies clustered each otter species of A. cinereus, L. perspicillata, and L. sumatrana in a monophyletic group, which was separate from an external group of P. hermaphroditus. Between the three species, two major perspicillata, which is also the sister group of A. cinereus, and Clade B consisted of L. sumatrana.

The grouping of Clade A was supported by a high bootstrap value of 85% for the NJ tree and 84% for the MP tree, which concurs with the results obtained by Koepfli et al. (2008a) that show similar results of L. perspicillata and A. cinereus being sister groups; however, both species have significant differences in morphology characters and ecological aspects, such as body mass and diet selection (Hwang and Larivierie 2005).

According to Koepfli et al. (2008a), there are some possible explanations for this grouping based on continuous observation: a) hybridization between the two species may occur and is not impossible since the two species have the same chromosome number of 2n = 38, b) both species share a similar brain structure with the presence of a larger rear sigmoid gyrus that provides a higher tactile sensitivity that influences similarities in foraging activity for both species, and c) Lutrogale have teeth structures that are suitable for eating shelled foods, which is a diet similar to A. cinereus, based on extinct Lutrogale paleoleptonyx and Lutrogale robusta fossils found in Java, Indonesia.

Furthermore, the results of this study indicated that the separation of the genus Lutra was represented by L. sumatrana with Lutrogale and supported by a high genetic distance value of 6.2%. This research study supports the findings of Koepfli et al.2008a and Koepfli et al. 2008b. The DNA variation results from this study can further strengthen the position of L. perspicillata in the genus Lutrogale and indicate that the classification of L. perspicillata in the Lutrogale genus is not based solely on morphological differences in the species of the genus Lutra as was reported by Pocock (1941), Harris (1968), Willemsem (1980, 1992) and Hwang and Lariviere (2005). To further support this statement, further research involving samples of the species L. lutrais needed. Koepfliet al. (2008a) stated that they did not support the hypotheses that L. perspicillata is a subgenus of Lutra or that the species evolved from a common ancestor of Lutra.

Instead, the results show that Lutrogale shared the same ancestor as Aonyx and further proposed that Lutrogalebe classified in the Aonyxinigroup.

The position of L. sumatrana in Clade B was supported by a high bootstrap value of 98%. The classification and taxonomic status of L. sumatrana are still unresolved. The status of this species was disputed and classified as a subspecies of L. lutra, known as L. lutrabarang, based on a high morphological similarity (Koepfli et al.2008a); however, in this study, L. sumatrana formed its own monophyletic group based on DNA studies conducted by Koepfli et al. (2008a,b), and L. sumatrana was recognized as a valid species. According to Koepfli et al. (2008a), the skulls of L. lutrabarang from several different locations are shorter than the skulls of L. sumatrana based on morphological data. Additionally, Sivasothi and Burhanuddin (1994) also found out that L. sumatrana possessed a more flattened and longer skull in comparison with L. lutra.

To validate these conclusions, further studies should be conducted to include samples from L. lutra barang that can be found scattered throughout Thailand, Vietnam, and Sumatra (Pocock 1941; Sivasothi and Burhanuddin 1994).

Acknowledgments: The authors are deeply indebted to several institutions that provided them necessary facilities and assistance for tissue sample collection, including the Faculty of Science and Technology, Universiti Kebangsaan Malaysia, the Department of Wildlife and National Parks (Peninsular Malaysia), and Chikushi Jogakuen University Junior College. The authors would also like to thank members of the Cytogenetic Laboratory, Faculty of Science and Technology, and Mrs.

Zamzuraida A Samad. This survey was partly supported by Chikushi Jogakuen Special Research Grant. This research was made possible under Grants UKM-GUP- 2011-183 and DLP-2013-006.

REFERENCES

Ang, K.C., J. W. H. Leow, B. H. Ng, W. K. Yeap, S. Hood, M. C. Mahani and B. M. Md-Zain (2011). Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers. Genetics and Molecular Research 10: 640-649. Bioinformatics 17: 754-755.

Burhanuddin, H. M. N. and N. Ahmad (1990). A survey on the distribution of otters in Pulau Pinang and Perlis. J. Wildlife and Parks 9: 53-38.

Duplaix-Hall, N. (1975). River otters in captivity: a review. In R. D. Martin (ed.), 1975. Breeding Endangered Species in Captivity. Academic Press, London. 315-397 pp.

Harris, C. J. (1968). Otters: A study of the recent Lutrinae. Weinfield and Nicoloson, London, United Kingdom. 397pp.

Huelsenbeck, J. P. and F. Ronquist (2001). Mr Bayes: Bayesian inference of phylogeny.

Hussain, S. A. (1999). Status of otter conservation in India. ENVIS Bulletin wildlife and protected areas 2: 92-97.

Hussain, S.A, S. K., Gupta and D. P. K. Silva (2011). Biology and Ecology of Asian Small-Clawed Otter Aonyxcinerea (ILLIGER, 1815): A Review. IUCNOSG 28: 63-75.

Hwang, Y. T. and S. Lariviere (2005). Lutrogale perspicillata. Mammal. Sp. 786: 1-4.

IUCN (2010). IUCN Red List of Threatened Species. Version 2010.2 [Internet]. [cited 2010 June 29]. Available from: www.iucnredlist.org.

Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111-120.

Koepfli, K. P. and R. K. Wayne (1998). Phylogenetic relationships of otters (Carnivora: Mustelidae) based on mitochondrial cytochrome b sequences. J. Zoology 246: 401-416.

Koepfli, K. P., B. Kanchanasaka, H. Sasaki, H. Jacques, K. D. Y. Louise, T. Hoai, N. X. Dang, E. Geffen, A. Gutleb, S. Y. Han, T. M. Heggberget, L. LaFontaine, H. Lee, R. Melisch, J. Ruiz- Olmo, M. Santos-Reis, V. E. Sidorovixh, M. Stubbe, and R. K. Wayne (2008a). Establishing the foundation for an applied molecular taxonomy of otters in Southeast Asia. J. Conservation Genetics 9: 1589-1604.

Koepfli, K. P., K. A. Deere, G. J. Slater, C. Begg, K. Begg, L. Grassman, M. Lucherini, G. Veron and R. K. Wayne (2008b). Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation. BMC Biology 6:10.

Lim, L. S., K. C. Ang, M. C. Mahani, A. W. Shahrom and B. M. Md-Zain (2010). Mitochondrial DNA polymorphism and phylogenetic relationships of proto Malays in Peninsular Malaysia.J. Biological Sciences 10(2): 71-83.

Mason, C. and S. Macdonald (1990).Conclusion and priorities for otter conservation. In Otters: an action plan for their conservation: 80-89. Foster- Turley, P., S. Macdonald, and C. Mason, (Eds) Gland. Switzerland: IUCN/SSC Otter Specialist Group.

Masuki, R., R. Takeuchi, S. Abe, M. Nashimoto, T. Hirata, M. Kanao and K. Sakata (2008). Species and individual identification of feces collected from latrines of badger or raccoon dog by DNA analysis. DNA polymorphism 16: 55-59.

Md-Zain, B. M., M. Mohamad, M. A. Ernie-Muneerah, A. Ampeng, A. Jasmi, M. Lakim and M. C. Mahani, (2010b).Phylogenetic relationships of Malaysian monkeys, Cercopithecidae, based on mitochondrial cytochrome c sequences. Genetics and Molecular Research 9: 1987-1996.

Md-Zain, B. M., S. J. Lee, M. Lakim, A. Ampeng and M.C. Mahani (2010a). Phylogenetic position of Tarsius bancanus based on partial cytochrome b DNA sequences. J. Biological Sciences 10: 348- 354.

Pocock, R. I. (1941). The fauna of British India including Ceylon and Burma Mammalia 2. Taylor and Francis, London.

Rosli, M. K. A., A. S. Zamzuriada, S. M. F. Syed- Shabthar, M. C. Mahani, O. Abas-Mazni and B. M. Md-Zain (2011). Optimizing PCR Conditions to Amplify Cyt b, COI and 12S rRNA Gene Fragments of Malayan Gaur (Bos gaurus hubbacki) mtDNA. Genetics and Molecular Research 10: 2554-2568.

Rosli, M. K. A., S. M. F. Syed-Shabthar, P. Abdul-Patah, Z. Abdul-Samad, S. N. Abdul, M.N. Burhanuddin, N. A. Zulkifli, M. N. Shukor, K. Budsabong, S. Changtragoon, T. Sekiguchi, H. Sasaki and B.M. Md-Zain (2014). A New Subspecies Identification and Population Study of the Asian Small-Clawed Otter (Aonyx cinereus) in Malay Peninsula and Southern Thailand Based on Fecal DNA Method. The Scientific World J. 2014: 457350.

Rosli, M. K. A., S. S. Zakaria, S. M. F. Syed-Shabthar, Z. Z. Zainal, M. N. Shukor, M. C. Mahani, O. Abas-Mazni and B. M. Md-Zain (2011). Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences. Genetics and Molecular Research10: 482-493.

Shariff, S.M. (1984). Some observations on otters at Kuala Gula, Perak and National Park, Pahang. J. Wildlife and Parks 3: 75-88.

Sivasothi, N. and M. N. Burhanuddin (1994). A review of otters (Carnivora: Mustelidae: Lutrinae) in Malaysia and Singapore. Hydrobiologia 285: 151-170.

Swofford, D. L. (2002). Phylogenetic analysis using parsimony and other methods version 4.0 beta version.Sinauer Associates, Sunderland

Van Zyll de Jong, C. G. (1987). A phylogenetic study of the Lutrinae (Carnivora; Mustelidae) using morphological data. J. Zoology 65: 2536-2544.

Van Zyll de Jong, C. G. (1991). A brief review of the systematics and a classification of the Lutrinae. Habitat 6: 79-83.

Vianna, J. A, G. Medina-Vogel, C. Chehebar, W. Sielfeld, C. Olavarria and S. Faugeron (2011). Phylogeography of the Patagonian otter Lontra provocax: adaptive divergence to marine habitat or signature of southern glacial refugia BMC Evolutionary Biology 11: 53.

Vianna, J. A., P. Ayerdi, G. Medina-Vogel, J. C. Mangel and H. Zeballos (2010). Phylogeography of the Marine Otter (Lontra felina): Historical and Contemporary Factors Determining Its Distribution. J. Heredity 101: 676689.

Vun, V. F., M. C. Mahani, M. Lakim, A. Ampeng and B. M. Md-Zain (2010). Phylogenetic relationships of leaf monkeys (Presbytis; Colobinae) based on cytochrome b and 12SrRNA genes. Genetics Molecular and Research 10: 368-381.

Willemsen, G. F. (1980). Comparative study of the functional morphology of some Lutrinae, especially Lutralutra, Lutrogale perspicillata and the Pleistocene Isolalutra cretensis. Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen, Series AB83: 289-326.

Willemsen, G. F. (1992). A revision of the Pliocene and Quaternary Lutrinae from Europe. Scr. Geol. 101: 1-115.

Wilson, D. E. and D. A. M. Reeder (2005). Mammal Species of the World. A Taxonomic and Geographic Reference.3rd edn. Johns Hopkins University Press, Baltimore.
COPYRIGHT 2015 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Geographic Code:9MALA
Date:Jun 30, 2015
Words:3703
Previous Article:MICROSATELLITE-BASED SIBSHIP RECONSTRUCTION AND ESTIMATION OF GENETIC RELATEDNESS IN THE ENDANGERED LABEO CALBASU (HAMILTON 1822) (CYPRINIDAE:...
Next Article:TOXICITY OF AVERMECTIN B1b TO EARTHWORM AND COCKROACHES.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |