Printer Friendly

Over-expression of Cytochrome P450s in Helicoverpa armigera in Response to Bio-insecticide, Cantharidin.

Byline: Maryam Rashid, Rashid A.Khan and Ya Lin Zhang

Abstract

Cantharidin, a well known natural compound produced by beetles of family Meloidae and Oedemeridae, developed as bio- insecticide in China, was investigated for its effect of cytochrome P450 O-demethylase activity using sub-lethal concentration. Results showed that cytochrome P450 O-demethylase activity remained significantly high at 12 to 48 h after treatment. To study the gene expression of CYP6B7 at molecular level, gene specific primers were designed according to gene sequence of CYP6B7, whereas b-actin gene from Helicoverpa armigera was used as internal control. Semi qRT-PCR results showed that fluorescent intensity ratio of CYP6B7 and control mRNA transcript level remained at 1.01, 1.23, 1.68 and 1.62 folds after 12,24, 36 and 48 h, respectively after treatment by sub-lethal dose of cantharidin in artificial diet.

In light of our experimental results we may conclude that over-expression of P450s in general and CYP6B7 in specific may be involved in resistance towards cantharidin in H. armigera. Moreover, there is a potential risk of insecticide resistance against cantharidin in areas, where P450s associated resistance has already developed in lepidopteran. (c) 2013 Friends Science Publishers

Keywords: Cantharidin; Helicoverpa armigera; Cytochrome P450; CYP6B7; mRNA

Introduction

Cytochrome P450 monooxygenases belong to protein super family of diverse and widely distributed enzymes, which are mainly involved in metabolism of endogenous and exogenous compounds of structurally diverse nature (Hudgson, 1985; Nelson, 1987). They have been found to have the capability of oxidizing broad range of exogenous compounds and are therefore important in defining interaction of animals and plants (Gonzalez and Nebert,1990; Schuler, 1996). Herbivores usually use P450s to metabolize allelochemicals that allow utilization of host plants which are toxic to other species (Berenbaum, 1990).

It is widely believed that the exposure of herbivores to secondary plant metabolites such as alkaloids, terpenoids, flavonoids and quinines, which are used as defense mechanism, may have forced the evolution of P450s (Ma et al., 1994; Prapaipong et al., 1994).

Monooxygenases metabolize large number of compounds due to abundance of P450 isoforms and substrate specificity of some isoform. Generally, metabolism by monooxygenases commonly results in detoxification of substrate however activation in some cases is possible. For instance organophosphates insecticides commonly used for pest control are activated by monooxygenases (Agosin, 1985).

The activity level of monooxygenase show significant increase when exposed to certain type of natural or synthetic compounds acting as substrate known as induction of P450 (Qiu et al., 2003). P450 monooxygenases in insects may be induced by insecticides (Huang and Leng 1992), plant allelochemicals (Tan and Guo 1996; Amichot et al., 1998) and herbicides (Miota et al., 2000) etc.

Helicoverpa armigera commonly known as cotton bollworm is an important pest of many agricultural crops of economic importance all over the world. The polyphagous nature of this pest is attributed to its extensive damage to wide variety of crop species. In previous studies resistance has been mentioned as main reason behind its outbreak (Forrester et al., 1993). Cytochrome dependent detoxification has been implicated as one of the main reason of its insecticidal resistance (Forrester et al., 1993; Scott et al., 1998). In China, cantharidin insecticides are under investigation for the control of lepidopteran insects. One commercial bioinsecticide, cantharidin AS has already been registered. The insecticidal and anti-feedant activities of cantharidin are well established fact as elucidated by (Zhang et al., 2003) on armyworm and diamondback moth. However, no data is available on its interaction with cytochrome P450 monooxygenases.

In our present studies possible role of P450 monooxygenases in resistance mechanism of insect toxin, cantharidin was investigated in vivo by biochemical and molecular methods.

Materials and Methods

Reagents and Chemicals

P-Nitroanisol and NADPH were purchased from BODI and Wolsen, respectively, whereas Cantharidin, Diethylpyrocarbonate (DEPC), phenylmethanesulfonyl fluoride (PMSF), dithiothreitol (DTT) and ethylenediaminetetraacetate acid (EDTA) were procured from Sigma-Aldrich. Molecular weight marker DL2000 and rTaq polymerase enzyme were from Takara. Other chemicals used in the experiments were of commercial grade.

Rearing of Insect

H. armigera larvae were procured from Henan Jiyuan Baiyun Industry Co., Ltd. China and reared until F1 for use in bioassay. Groups of 24 larvae were placed into 24 chamber plastic boxes. The boxes were placed in an incubator at 27+1*C and 40 to 50% RH with 12 h photoperiod on artificial diet (Ahmed and McCaffery, 1991).

Statistical Analysis

SPSS 17.0 software was used for analysis of photometric data (SPSS Inc., Chicago, IL). Significance of the effect of cantharidin on enzymes specific activity was determined by independent t-test. Means were considered significantly different at P[?]0.05.

Insect Treatment for Enzyme Assay

Laboratory prepared artificial diet as mentioned above was mixed with experimentally determined sub-lethal dose of 0.01 mg/g of cantharidin, dissolved in acetone. Acetone was added to the control artificial diet. Acetone was allowed to evaporate for one h before introduction of larvae into it. Larvae of early third instar, starved for eight h, were introduced to the cantharidin-treated artificial diet and control. Ten larvae per replication were collected from cantharidin-treatment and control groups at 12, 24, 36 and 48 h for determination of enzyme activity. The experiment was replicated thrice. Collected larval samples were flash frozen in liquid nitrogen just after collection and stored at -80*C.

Protein Determination

Protein contents within homogenates were determined using bovine serum albumin as standard (Bradford, 1976).

Specific Activity of Cytochrome P450 O-demethylase

The activity of p-nitroanisole O-demethylase was determined followed by Hansen and Hodgson (1971). Midguts from larvae both in treatment and control groups were homogenized on ice by glass homogenizer in pre- cooled 0.1M PBS of pH 7.2 having 1mM EDTA, 1 mM PMSF, 1 mM DTT and 10% glycerol. Homogenates were subjected to centrifugation at 10,000xg at 4*C for 15 min. The Supernatants obtained were used as enzyme extract solutions. Enzyme extract solutions of 0.5 mL containing 0.1M sodium phosphate (pH 7.8) and 0.005M NADPH was prepared. Reaction was initiated by the addition of 10 mL 0.002M nitroanisole and placed for incubated in water bath at 25*C with shaking for 30 min. The reaction was terminated by the addition of 0.5 mL of IM HCl. The product p-nitrophenol was extracted with CHCl3 and then centrifuged to get two fractions. The CHCl3 fraction was back extracted with 0.5M NaOH.

The optical density of NaOH solution was determined at 400nm and the product was quantified using the experimentally determined curve.

RNA Extraction and Reverse Transcription Reaction

Frozen insects subjected to cantharidin treatment and stored at -80*C were used for total RNA extraction. The midguts were dissected from a total of 30 larvae per treatment and homogenized using liquid nitrogen before addition of RNAiso Plus (TaKaRa). Three biological replicates were used for each treatment and control groups. The total RNAs were extracted individually from treatment and control following manufacture's instructions. The quality of RNA samples were examined by running on agarose gel. DNase-I (Fermentas) was used to remove DNA contamination. The cDNAs were synthesized individually for treatment and control by reverse transcription using RevertAid(tm) Reverse Transcriptase (Fermentas) in 20 uL reaction following the recommended protocol provided by the manufacturer.

Gene Cloning and Sequencing

Helicoverpa armigera cytochrome P450 (CYP6B7) was amplified from cDNA by polymerase chain reaction (PCR) by upstream primer (5' GCAGGATCCATGTGGGTCTTATATCTAC3') and downstream primer (5' GACGTCGACTTAAGATACAATCTTCCTAGG3'), respectively. Bam Hl restriction site was incorporated to sense primer, whereas Sal 1 restriction site was incorporated to antisense primer for double restriction digestion. Amplification reaction was performed by PCR program: First step denaturation for 3 min at 94oC followed by 30 cycles of 94oC for 30 s, 55oC 45 s, 72oC for 2 min and final extension of 5 min at 72oC. Target gene amplified product was gel purified by gel extraction kit (Biomiga). Gel purified PCR product were then ligated to pMD-19T vector (TaKaRa) and transformed into Escherichia coli DH5a. The transformants were selected on LB agar plates containing 100 mg/mL ampicillin after overnight incubation at 37*C.

At first the presence of target gene was identified by double restriction digestion of plasmid extracted from positive clones. Resultants clones were then sequenced by Shanghai Sunny Biotech Co., Ltd.

Sequence Analysis and Phylogenetic Analysis

Sequences were analyzed by DNAman software package (Lynnon, Quebec, Canada). Amino acid sequence was deduced by http://web.expasy.org/translate/NCBI was used to BLAST amino acid sequence to see its conformity with target sequences.

Semi qRT-PCR Analysis for Gene Expression

Semi qRT-PCR was performed to compare the expression level of CYP6B7 mRNA in midgut of treatment and control groups after induction by sub lethal dose of cantharidin. The expression level of CYP6B7 gene transcript was examined by Semi qRT-PCR analysis of cDNA synthesized from RNA isolated from midgets of insects treated with cantharidin. Two gene specific primers, sense (5'AATATCTTGATGGAGTAACA3') and anti-sense (5'GATTAAGTGAGAGTTGGTA3') were designed to amplify the cDNA fragment of CYP6B7 of 135bp using Beacon Designer 7 (Premier Biosoft). To normalize gene expression H. armigera b-actin (GenBank EU527017) was used as endogenous control. A pair of primers was used to amplify Hab-actin, sense (5'GTATTGCTGACCGTATGC3') and antisense (5'ATCTGTTGGAAGGTGGAG3'). Electrophoresis and visualization of amplified products were performed as mentioned above.

Results

CYP6B7 of H. armigera was amplified using gene specific primers. A product of 1515bp was obtained after PCR reaction (Fig. 1). The gene ligated to pMD-19T sequencing vector was confirmed by double restriction digestion and sequencing (Fig. 1).

Effect of Cantharidin on Activity of Cytochrome P450 O-demethylase

Higher cytochrome P450 O-demethylase specific activity was induced by sub-lethal dose of cantharidin-treated artificial diet. The specific activity of P450 O-demethylase was induced at 12 h after treatment and remained significantly high at (P[?]0.05) compared to untreated control.

Specific activities of O-demethylase were seen increasing at 24, 36 and 48 h and remained highly significant at (P[?]0.01) compared to untreated control (Fig. 2).

Semi qRT-PCR Analysis for Gene Expression

The expression level of CYP6B7 mRNA was investigated after treatment by cantharidin using semi qRT-PCR. CYP6B7 mRNA expression level obviously changed in treatment compared to control (Fig. 3). No bigger change was seen at 12 h after treatment. Expression level however changed after 12 h. Fold change in fluorescent intensity of gene CYP6B7 mRNA expression in midgut of H. armigera induced by cantharidin remained at 1.23, 1.68 and 1.62 after 24, 36 and 48 h, respectively (Fig. 4).

Fig. 2: Specific activity of cytochrome P450s at different intervals after treatment. Asterisks show significant difference between control and treatment by independent t- test at a 0.05 level

Fig. 3: Expression level of CYP6B7 compared to control and b-actin. (A) Lane 1-4, expression level of mRNA transcript of CYP6B7 in treatment; (B) Expression level of mRNA transcript of CYP6B7 in control; (C) Expression level of mRNA transcript in b-actin in treatment; (D) Expression level of mRNA transcript in b-actin in control

Fig. 4: Ratio of fluorescent intensity of CYP6B7 mRNA transcript level and control, normalized by b-actin as internal control. Imagej software package was used to calculate fluorescent intensity of the bands. Error bars represent the mean +- SD

Discussion

In our present study cantharidin treatment of sub-lethal dose increased activity of P450s in general and midgut-specific CYP6B7 in particular. Higher level of P450s in insect midgut is responsible for metabolism of substances. Lepidopteran larvae are the most ferocious feeder of crops and higher P450 monooxygenases activity has been reported in their midgut tissue (Thongsinthusak and Krieger, 1976; Qiu et al., 2003).

Activity of cytochrome P450s monooxygenases in present study remained largely high, showing its possible involvement in resistance towards cantharidin. Similarly, insecticide metabolism is catalyzed by cytochrome P450s, an important enzyme family. Enhanced levels of P450s have been reported in resistant insects such as cotton bollworm, diamondback moth and are regarded as major resistance mechanism to pyrethroids (Martin et al., 2002; Sonoda 2010).

In our study the increased level of P450s showed similar mechanism of resistance by H. armigera with the above mentioned studies. Semi qRT-PCR results showed higher mRNA transcript of CYP6B7 in cantharidin- treatment, compared to control. These results suggest that the mechanism of resistance towards cantharidin detoxification may be similar to pyrethroids detoxification by CYP6B7. Likewise, pyrethroids resistant field population of H. armigera from Australia was reported with over- expressed levels of CYP6B7 (Ranasinghe et al., 1998). In China, main resistance mechanism of resistance towards pyrethroids has been documented as enhanced oxidative metabolism (Shen and Wu 1995; Yang et al., 2005). A higher activity of P450s in the present experiment showed that the Chinese strain of H. armigera showed similar mechanism of resistance towards cantharidin. In short, the use of cantharidin insecticide in fields with especially high

Fig. 5: Neighbor-joining phylogenetic tree of CYP6B7 and its closest relatives from the NCBI database. Phylogenetic tree was generated by subjecting CYP6B7 amino acid sequence to BLASTP in NCBI CYP6B7 associated resistance in H. armigera and phylogenetically related insect species (Fig. 5) may be counterproductive.

Higher activity of P450s in general and CYP6B7 in specific were found to be induced by cantharidin treatment showing their possible involvement in cantharidin resistance and detoxification. In the light of our experiment there is a potential risk of P450s associated insecticidal resistance if it is not used judiciously for control of lepidopteran pests.

Acknowledgments

We sincerely appreciate the financial support of the Special Fund for the Public Interest (Agriculture) (200903052) by The Ministry of Science and Technology and The Ministry of Agriculture, China and the '13115' Sci-Tech Innovation Project of Shaanxi Province (2007ZDKG-14).

References

Agosin, M., 1985. Role of microsomal oxidations in insecticide degradation. In: Comprehensive Insect Physiology, Biochemistry and Pharmacology, Vol. 12, pp: 647-712. Kerkut, G.A. and L.I. Gilbert (eds.). Pergamon press, New York, USA

Ahmed, M. and A.R. McCaffery, 1991. Elucidation of detoxification mechanisms involved in resistance to insecticides against third instar larvae of a field selected strain of Helicoverpa armigera with the use of synergists. Pest. Biochem. Physiol., 41: 41-52

Amichot, M., A. Brun, A. Cuany, G. De Souza, T. Le Mouel, J.M. Bridge, M. Babault, J.P. Salaun, R. Rahmani and J.B. Berge, 1998. Induction of cytochrome P450 activities in Drosophila melanogaster strains susceptible or resistant to insecticides. Comp. Biochem. Physiol., 121: 311-319

Berenbaum, M.R., 1990. Evolution of specialization in insect umbellifer associations. Ann. Rev. Entomol., 35: 319-343

Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein- dye binding. Anal. Biochem., 72: 248-254

Forrester, N.W., M. Cahill, L.T. Bird and J.K. Layland, 1993. Management of pyrethriod and endosulfan resistance in Helicoverpa armigera (Lepidoptera: Noctuidae) in Australia. Bull. Entomol. Res. Spec. Suppl., 1: 1-132

Gonzalez, F.J. and D.W. Nebert, 1990. Evolution of the P450 gene superfamily: animal-plant warfare, molecular drive and human genetic differences in drug oxidation. Trends Genet., 6: 182-186

Hansen L.G. and E. Hodgson, 1971. Biochemical characteristics of insect microsome: N-and O-demethylation. Biochem. Pharmacol., 20: 1569-1678

Huang, J.Y. and X. Leng, 1992. Influence of deltamethrin on microsomal cytochrome P-450 activity of susceptible house flies (Musca domestica vicina L.). Acta Entomol. Sin., 35: 301-305

Hudgson, E., 1985. In: Comprehensive Insect Physiology Biochemistry and Pharmacology, Vol. 11, pp: 647-712. Kerkut, G.A. and L.C. Gilbert (eds.). Pergamon Press, Oxford, UK

Ma, R., M.B. Cohen, M.R. Berenbaum and M.A. Schuler, 1994. Black swallowtail (Papilio polyxenes) alleles encode cytochrome P450s that selectively metabolize linear furanocoumarins. Arch. Biochem. Biophys., 310: 332-340

Martin, T., F. Chandre, O.G. Ochou, M. Vaissayre and D. Fournier, 2002. Pyrethroid resistance mechanisms in the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) from West Africa. Pest. Biochem. Physiol., 74: 17-26

Miota, F., B.D. Siegfried, M.E. Scarf and M.J. Lydy, 2000. Atrazine induction of cytochrome P450 in Chironomus tentans larvae. Chemosphere, 40: 285-291

Nelson D.R. and H.W. Strobel, 1987. Evolution of cytochrome P-450 proteins. Mol. Biol. Evol., 4: 572-593

Prapaipong, H., M.R. Berenbaum and M.A. Schuler, 1994. Transcriptional regulation of the Papilio polyxenes CYP6B1 gene. Nucleic Acids Res.,22: 3201-3217

Qiu, X., W. Li, Y. Tian and X. Leng, 2003. Cytochrome P450 Monooxygenases in the Cotton Bollworm (Lepidoptera: Noctuidae): Tissue Difference and Induction. J. Econ. Entomol., 96: 1283-1289

Ranasinghe, C., B. Campbell and A.A. Hobbs, 1998. Over-expression of cytochrome P450 CYP6B7 mRNA and pyrethroid resistance in Australian populations of Helicoverpa armigera. Pestic. Sci., 54: 195-202

Schuler, M.A., 1996. The role of cytochrome P450 monooxygenases in plant-insect interactions. Plant Physiol., 112: 1411-1419

Scott, J.G., N. Liu and Z. Wen, 1998. Insect cytochrome P450: diversity, Insecticide resistance and tolerant to plant toxins. Comp. Biochem. Physiol., 121: 147-155

Shen, J. and Y. Wu, 1995. In: Insecticide Resistance of Helicoverpa Armigera and its Management. China Agricultural Press, Beijing, China

Sonoda, S., 2010. Molecular analysis of pyrethroid resistance conferred by target insensitivity and increased metabolic detoxification in Plutella xylostella. Pest Manage. Sci., 66: 572-575

Tan, W. and Y. Guo, 1996. Effects of host plant on susceptibility to deltamethrin and detoxification enzyme of Heliothis armigera (Lepidoptera: Noctuidea). J. Econ. Entomol., 89: 11-14

Thongsinthusak, T. and R.I. Krieger, 1976. Dihydroisodrin hydroxylation as an indicator of monooxygenase capability of black cutworm, Agrotis ypsilon and cabbage looper, Trichoplusia ni larvae. Comp. Biochem. Physiol., 54: 7-12

Zhang, Y.L., Y. Zhou and Z.Y. Zhang, 2003. Effect of cantharidin on the midgut of orient armyworm (Methimna seperata) and diamond moth Plutella xylostella. Acta Entomol. Sin., 46: 272-276

Yang, E., Y. Yang, S. Wu and Y. Wu, 2005. Relative contribution of detoxifying enzymes to pyrethroid resistance in a resistant strain of Helicoverpa armigera. J. Appl. Entomol., 129: 521-525

Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, College of Plant Protection, Northwest A and F University, Yangling, Shaanxi 712100, China

For correspondence: yalinzh@yahoo.com.cn; smilejust9@yahoo.com

To cite this paper: Rashid, M., R.A. Khan and Y.L. Zhang, 2013. Over-expression of cytochrome P450s in Helicoverpa armigera in response to bio- insecticide, cantharidin. Int. J. Agric. Biol., 15: 993-997
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rashid, Maryam; A. Khan, Rashid; Zhang, Ya Lin
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9CHIN
Date:Oct 31, 2013
Words:3006
Previous Article:Protective Effect of Bacillus subtilis B10 against Hydrogen Peroxide- Induced Oxidative Stress in a Murine Macrophage Cell Line.
Next Article:Use of Bioremediated Sewage Effluent for Fish Survival.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters