Printer Friendly

Occurrence and Multilocus Genotyping of Giardia duodenalis in Yunnan Black Goats in China.

1. Introduction

Giardia duodenalis (syn. Giardia lamblia and Giardia intestinalis) is a common enteric protozoan parasite which can infect humans and a wide range of animal species. G. duodenalis infection can cause a series of diseases which have important effects on human and animal health, such as abdominal cramps, diarrhea, weight loss, and malabsorption [1-3]. G. duodenalis infection can be caused by ingesting cysts in contaminated water or food, or through fecal-oral access due to wastewater [4-6]. According to the existing literature, the prevalence of G. duodenalis is approximately 10% in the world population [7], and the G. duodenalis prevalence ranged from 0 to 15.6% in humans [8,9] and 1.3%-55.6% in sheep and goats in China [1]. G. duodenalis has a high prevalence in some low-income areas and developing countries [10-13].

So far, G. duodenalis isolates from humans and various animals have been classified into eight different assemblages (A-H) on the basis of molecular characterization [14, 15]. Among them, assemblages A and B are the important zoonotic parasites that have a wild range of hosts, including human and other mammals, such as bovine, sheep, goats, and other domestic animals [1, 3]. Assemblage E occurs in artiodactyls, and assemblages C, D, F, G, and H have obvious animal specificity, but assemblages C-F have also been reported in humans in Ethiopia [16], Thailand [17], and Egypt [18].

Yunnan province is the fifth largest producer of goats in China [19], and about 10 million goats are raised each year. Many previous studies have reported G. duodenalis infection in goats in other countries with prevalence ranging from 2.9 to 35.8% [20, 21], but only limited investigations have been conducted in goats in China, with the prevalence ranging from 2.9 to 7.1% [22-25].

Yunnan black goat is a unique breed of goat distributed in subtropical Yunnan province, southwestern China. It is yet to be known whether Yunnan black goats are infected with G. duodenalis. Thus, the objectives of the present study were to estimate the G. duodenalis prevalence in Yunnan black goats based on characterization of the [beta]-giardin (bg) gene sequences and identify its genotypes using multilocus genotyping (MLG) targeting gdh gene, tpi gene, and bg gene sequences [15, 26].

2. Materials and Methods

2.1. Animals and Samples Collection. A total of 907 fecal samples were randomly collected from Yunnan black goats in Chuxiong, Lijiang, and Xishuangbanna prefectures, Yunnan province, southwestern China (Figure 1). All of the fecal samples were stored in separate sterile plastic collection tubes containing 2.5% potassium dichromate, kept cold with ice packs, transported to the laboratory as soon as possible, and kept in 4[degrees]C freezer until analysis. The sample information including geographical gender, age, locality, and date of sampling was recorded.

2.2. Genomic DNA Extraction. Fecal specimens were washed repeatedly with ultrapure water until all the potassium dichromate was removed, and then genomic DNA was extracted from 200 mg of each fecal sample in a 2 ml centrifuge tube using the commercial E.Z.N.A[R] Stool DNA kit (Omega Bio-Tek Inc., GA, USA) by following the manufacturer's instruction. The obtained DNA samples were stored at -20[degrees]C for further study.

2.3. PCR Amplification and Sequencing. Each fecal specimen was examined for the presence and genotype of G. duodenalis by PCR-based sequencing of the 511 bp fragment of the bg-gene [27]. In addition, For MLG analysis, all bg-positive specimens were subjected to further PCR using primers for the tpi gene loci and gdh gene loci [28-30]. The sequences of primers are presented in Table 1.

The secondary reaction mixture contained 2 [micro]l of template from the first PCR product, 2 [micro]L deoxyribonucleotide triphosphate (dNTP) mixture, 2.5 [micro]L of 10xPCR buffer, 3 mM of Mg[Cl.sub.2], and 0.2 [micro]M of each primer in a total volume of 25 [micro]L. PCR amplifications were performed as follows: 1 cycle for 5 min at 94[degrees]C, followed by 35 cycles of 45 s at 94[degrees]C for denaturation, 45 s at 67[degrees]C for annealing, and 45 s at 72[degrees]C for an extension. All of amplification products were subsequently visualized on 1.5% agarose gels with ethidium bromide. For each PCR amplification, a positive sample (sequenced DNA) and negative (PCR water) control sample were included.

All nested-PCR products were sent to Xi'an Qingk Biotechnology Company for two-directional sequencing on an ABI PRISM 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using relevant internal nested primers for PCR amplification. The sequences obtained were compared with relevant sequences available in GenBank database (http://www.ncbi.nlm.nih.gov/GenBank) using Basic Local Alignment Search Tool (BLAST).

2.4. Phylogenetic Analysis. The tpi gene sequences were used for phylogenetic reconstruction using the Neighbor-Joining [NJ] analysis and the genetic distances were calculated by the Kimura 2-parameter model in MEGA6 [31, 32]. Bootstrap analysis (1000 replicates) was used to evaluate the reliability of the phylogenetic tree [33].

2.5. Statistical Analysis. The relationships between G. duodenalis prevalence and risk factors were analyzed using the [chi square] test in SPSS 20.0 (SPSS Inc., Chicago, IL, USA), and statistically significant differences were considered when P <0.05.

3. Results and Discussion

3.1. The Prevalence ofG. duodenalis in Yunnan Black Goats. A total of 907 fecal samples were collected from Yunnan black goats in five regions in Yunnan province (Figure 1), and 38 (4.2%, 95% CI, 2.9-5.5) were G. duodenalis-positive based on the amplification of the bg gene. G. duodenalis prevalence was significantly different among the study areas ([chi square]=10.933, df=4, P < 0.05), between different age groups ([chi square]=5.208, df=1, P < 0.05), and between different genders ([chi square]=1.615, df=1, P > 0.05). The G. duodenalis prevalence in Yunnan black goats was higher than that (2.9%) in goats in Heilongjiang province [22], but lower than that in goats in Anhui (6.3%) [23], Shaanxi (7.9%) [25], and Henan provinces (12.7%) [24], China. The G. duodenalis prevalence in Yunnan black goats was markedly lower than in goats in Greece (40.4%) [34], Spain (42.0%) [20], Uganda (40.7%) [35], and Belgium (35.8%) [21]. The difference in G. duodenalis prevalence may be related to feeding conditions, geographical difference, and animal husbandry practices as well as different susceptibility of different breeds of goats.

G. duodenalis prevalence ranged from 0% to 7.03% among the sampled areas. The highest G. duodenalis prevalence was found in Yunnan black goats in Mohan (7.03%, 9/128), Xishuangbanna prefecture (Table 2), followed by Wuding (5.41%, 24/444) in Chuxiong prefecture, Ninglang (1.96%, 1/51) in Lijiang prefecture, and Yongreng (1.43%, 2/139) and Mouding (1.38%, 2/145) in Chuxiong prefecture. The likely reason for this discrepancy may be due to different geographical conditions.

3.2. Molecular Characterization of G. duodenalis Isolates. All the bg sequences obtained in the present study were aligned with corresponding G. duodenalis sequences available in GenBank by BLAST. A total of 38 positive samples were clustered in assemblage E, containing one known assemblage E subtype ([E.sub.5], n=35) and two novel assemblage E subtypes (designated as [E.sub.14], n=1; [E.sub.15], n=2) based on sequence analyses of the bg gene loci (Table 3). Additionally, one known assemblage E subtype ([E.sub.10], n=2) and one novel assemblage E subtype ([E.sub.13], n=16) based on the gdh gene sequences and two novel assemblage E subtypes ([E.sub.11], n=1; [E.sub.12], n=10) based on the tpi gene sequences were also identified among G. duodenalis-positive samples from Yunnan black goats (Table 3).

Previous studies have indicated that assemblage E is the predominant genotype infecting a range of hoofed livestock; it is also the most common assemblage found in sheep, goats, and pigs. However, assemblage E has also been identified in cattle, dogs, cats, horses, fallow deer, monkeys, and humans [1, 3, 29, 36] indicating that assemblage E is of zoonotic significance.

MLG analysis based on bg, gdh, and tpi gene sequences is a useful tool to illustrate the diversity of the G. duodenalis genotypes [37]. In this study 18 of the 38 bg-positive samples were gdh-positive, and 11 were tpi-positive. Ten samples were successfully sequenced at all of the three loci, and three novel MLGs (designated as MLGE9-E11) were identified within assemblage E (Table 4).

3.3. Phylogenetic Analysis of G. duodenalis Isolates from Yunnan Black Goats. To clarify the genetic relationships of the G. duodenalis isolates in this study with relevant G. duodenalis isolates, the obtained G. duodenalis tpi gene sequences were aligned with corresponding sequences available in the GenBank database. The phylogenetic tree showed that G. duodenalis isolates from Yunnan black goats clustered within assemblage E which contained G. duodenalis isolates (E11 and E12) from other animals and humans (Figure 2), with a high bootstrap value, indicating that G. duodenalis genotypes in Yunnan black goats have zoonotic potential, raising a public health concern.

4. Conclusion

This is the first report of prevalence and molecular characterization of G. duodenalis from Yunnan black goats in Yunnan province, southwestern China, which revealed a 4.2% G. duodenalis prevalence and identified seven subtypes including five novel assemblages E subtypes ([E.sub.11]-[E.sub.15]) and two known assemblages E subtypes ([E.sub.5] and [E.sub.10]). MLGs analysis identified three novel MLGs within assemblage E of G. duodenalis. These results not only extended the host range of G. duodenalis distribution, but also enriched the genetic diversity of G. duodenalis in humans and animals, which also have implications for controlling G. duodenalis infection in Yunnan black goats.

https://doi.org/10.1155/2018/4601737

Data Availability

The Giardia duodenalis prevalence data used to support the findings of this study are included within the article.

Ethical Approval

All Yunnan black goats were handled in strict accordance with good animal practice according to the Animal Ethics Procedures and Guidelines of the People's Republic of China, and the study was approved by the Animal Administration and Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

Project support was provided by the Excellent Scientist Fund of Yunnan Agricultural University (2015JY03), the Agricultural Science and Technology Innovation Program (ASTIP) (Grant No. CAAS-ASTIP-2016-LVRI-03), and the Elite Program of Chinese Academy of Agricultural Sciences.

References

[1] Y. Feng and L. Xiao, "Zoonotic potential and molecular epidemiology of Giardia species and giardiasis," Clinical Microbiology Reviews, vol. 24, no. 1, pp. 110-140, 2011.

[2] W. Li, C. Liu, Y. Yu et al., "Molecular characterization of Giardia duodenalis isolates from police and farm dogs in China," Experimental Parasitology emphasizes, vol. 135, no. 2, pp. 223-226, 2013.

[3] U. Ryan and S. M. Caccio, "Zoonotic potential of Giardia" International Journal for Parasitology, vol. 43, no. 12-13, pp. 943-956, 2013.

[4] C. Kourenti, P. Karanis, and H. Smith, "Waterborne transmission of protozoan parasites: a worldwide review of outbreaks and lessons learnt," Journal of Water and Health, vol. 5, no. 1, pp. 1-38, 2007.

[5] J. Plutzer, J. Ongerth, and P. Karanis, "Giardia taxonomy, phylogeny and epidemiology: Facts and open questions," International Journal of Hygiene and Environmental Health, vol. 213, no. 5, pp. 321-333, 2010.

[6] A. Efstratiou, J. E. Ongerth, and P. Karanis, "Waterborne transmission of protozoan parasites: Review of worldwide outbreaks --An update 2011-2016," Water Research, vol. 114, pp. 14-22, 2017.

[7] D. B. Huang and A. C. White, "An Updated Review on Cryptosporidium and Giardia," Gastroenterology Clinics of North America, vol. 35, no. 2, pp. 291-314, 2006.

[8] H. Liu, Y. Shen, J. Yin et al., "Prevalence and genetic characterization of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora in diarrheal outpatients in china," BMC Infectious Diseases, vol. 14, no. 1, 2014.

[9] S. Zhang, Y. Zhou, W. Xu et al., "Impact of co-infections with enteric pathogens on children suffering from acute diarrhea in southwest China," Infectious Diseases of Poverty, vol. 5, no. 1, 2016.

[10] J. H. Botero-Garces, G. M. Garcia-Montoya, D. Grisales-Patino, D. C. Aguirre-Acevedo, and M. C. Alvarez-Uribe, "Giardia intestinalis and nutritional status in children participating in the complementary nutrition program, Antioquia, Colombia, May to October 2006," Revista do Instituto de Medicina Tropical de Sao Paulo, vol. 51, no. 3, pp. 155-162, 2009.

[11] J. S. Yoder, J. W. Gargano, R. M. Wallace, M. J. Beach et al., "Giardiasis surveillance-United States, 2009-2010," Morbidity and mortality weekly report. Surveillance Summaries, vol. 61, no. 5, pp. 13-23, 2012.

[12] K. A. Ul Haq, N. A. Gul, H. Muhammad Hammad, Y. Bibi, A. Bibi, and J. Mohsan, "Prevalence of giardia intestinalis and hymenolepis nana in afghan refugee population of mianwali district, pakistan," African Health Sciences, vol. 15, no. 2, pp. 394-400, 2015.

[13] J. E. Painter, J. W. Gargano, S. A. Collier, and J. S. Yoder, "Giardiasis surveillance - United States, 2011-2012," Mmwr Supplements, vol. 64, no. 3, pp. 15-25, 2015.

[14] M. F. Heyworth, "Giardia duodenalis genetic assemblages and hosts," Parasite, vol. 23, article no. 23,2016.

[15] J. Li, H. Wang, R. Wang, and L. Zhang, "Giardia duodenalis infections in humans and other animals in China," Frontiers in Microbiology, vol. 8, 2017.

[16] T. Gelanew, M. Lalle, A. Hailu, E. Pozio, and S. M. Caccio, "Molecular characterization of human isolates of Giardia duodenalis from Ethiopia," Acta Tropica, vol. 102, no. 2, pp. 92-99, 2007.

[17] R. J. Traub, T. Inpankaew, S. A. Reid et al., "Transmission cycles of Giardia duodenalis in dogs and humans in Temple communities in Bangkok-A critical evaluation of its prevalence using three diagnostic tests in the field in the absence of a gold standard," Acta Tropica, vol. 111, no. 2, pp. 125-132, 2009.

[18] P. Foronda, M. D. Bargues, N. Abreu-Acosta et al., "Identification of genotypes of Giardia intestinalis of human isolates in Egypt," Parasitology Research, vol. 103, no. 5, pp. 1177-1181,2008.

[19] National Bureau of Statistics of China, http://www.stats.gov.cn/ english/Statisticaldata/AnnualData.

[20] A. Ruiz, P. Foronda, J. F. Gonzalez et al., "Occurrence and genotype characterization of Giardia duodenalis in goat kids from the Canary Islands, Spain," Veterinary Parasitology, vol. 154, no. 1-2, pp. 137-141, 2008.

[21] T. Geurden, P. Thomas, S. Casaert, J. Vercruysse, and E. Claerebout, "Prevalence and molecular characterisation of Cryptosporidium and Giardia in lambs and goat kids in Belgium," Veterinary Parasitology, vol. 155, no. 1-2, pp. 142-145, 2008.

[22] W. Zhang, X. Zhang, R. Wanget al., "Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang Province, China and possibility of zoonotic transmission," PLOS Neglected Tropical Diseases, vol. 6, no. 9, Article ID e1826, 2012.

[23] Y. F. Gu, L. K. Wang, Y. Li, L. Li et al., "Prevalence and molecular characterization of Giardia lamblia isolates from goats," Chinese Journal of Parasitology and Parasitic Diseases, vol. 32, no. 5, pp. 401-403, 2014.

[24] X.-Q. Peng, G.-R. Tian, G.-J. Ren et al., "Infection rate of Giardia duodenalis, Cryptosporidium spp. and Enterocytozoon bieneusi in cashmere, dairy and meat goats in China," Infection, Genetics and Evolution, vol. 41, pp. 26-31, 2016.

[25] Y.-L. Yin, H.-J. Zhang, Y.-J. Yuan et al., "Prevalence and multilocus genotyping of Giardia duodenalis from goats in Shaanxi province, northwestern China," Acta Tropica, vol. 182, pp. 202-206, 2018.

[26] C. Wielinga, U. Ryan, R. C. Andrew Thompson, and P. Monis, "Multi-locus analysis of Giardia duodenalis intra-Assemblage B substitution patterns in cloned culture isolates suggests sub-Assemblage B analyses will require multi-locus genotyping with conserved and variable genes," International Journal for Parasitology, vol. 41, no. 5, pp. 495-503, 2011.

[27] I. M. Sulaiman, R. Fayer, C. Bern et al., "Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis," Emerging Infectious Diseases, vol. 9, no. 11, pp. 1444-1452, 2003.

[28] C. M. Read, P. T. Monis, and R. C. A. Thompson, "Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP," Infection, Genetics and Evolution, vol. 4, no. 2, pp. 125-130, 2004.

[29] S. M. Caccio and U. Ryan, "Molecular epidemiology of giardiasis," Molecular Biochemical Parasitology, vol. 160, no. 2, pp. 75-80, 2008.

[30] T. Geurden, P. Geldhof, B. Levecke et al., "Mixed Giardia duodenalis assemblage A and E infections in calves," International Journal for Parasitology, vol. 38, no. 2, pp. 259-264, 2008.

[31] K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, "MEGA6: Molecular Evolutionary Genetics Analysis version 6.0," Molecular Biology and Evolution, vol. 30, no. 12, pp. 2725-2729, 2013.

[32] M. Fantinatti, A. R. Bello, O. Fernandes, and A. M. Da-Cruz, "Identification of Giardia lamblia Assemblage E in humans points to a new anthropozoonotic cycle," The Journal of Infectious Diseases, vol. 214, no. 8, pp. 1256-1259, 2016.

[33] N. Saitou and M. Nei, "The neighbor-joining method: a new method for reconstructing phylogenetic trees," Molecular Biology and Evolution, vol. 4, no. 4, pp. 406-425, 1987.

[34] N. Tzanidakis, S. Sotiraki, E. Claerebout et al., "Occurrence and molecular characterization of Giardia duodenalis and Cryptosporidium spp. in sheep and goats reared under dairy husbandry systems in Greece," Parasite, vol. 21, article 45, 2014.

[35] A. R. Johnston, T. R. Gillespie, I. B. Rwego, T. L. T. McLachlan, A. D. Kent, and T. L. Goldberg, "Molecular epidemiology of cross-species Giardia duodenalis transmission in Western Uganda," PLOS Neglected Tropical Diseases, vol. 4, no. 5, Article ID e683, 2010.

[36] M. Santin, D. Dargatz, and R. Fayer, "Prevalence of Giardia duodenalis assemblages in weaned cattle on cow-calf operations in the United States," Veterinary Parasitology, vol. 183, no. 3-4, pp. 231-236, 2012.

[37] S. M. Caccio, R. Beck, M. Lalle, A. Marinculic, and E. Pozio, "Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B," International Journal for Parasitology, vol. 38, no. 13, pp. 1523-1531, 2008.

Shi-Chen Xie [ID], (1,2) Yang Zou, (2) Dan Chen (2), Meng-Meng Jiang, (1) Xiao-Dan Yuan, (2) Zhao Li, (3) Feng-Cai Zou, (3) Jian-Fa Yang, (3) Jin-Liang Sheng, [ID], (1) and Xing-Quan Zhu [ID] (2,4)

(1) College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang Uygur Autonomous Region 832003, China

(2) State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, China

(3) Key Laboratory of Veterinary Public Health of Yunnan Province, College of Veterinary Medicine, Yunnan Agricultural University, Kunming, Yunnan Province 650201, China

(4) Jiangsu Co-innovation Center for the Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University College of Veterinary Medicine, Yangzhou, Jiangsu Province 225009, China

Correspondence should be addressed to Jin-Liang Sheng; sjlshz@126.com and Xing-Quan Zhu; zhuxingquan@caas.cn

Received 6 August 2018; Revised 15 September 2018; Accepted 26 September 2018; Published 10 October 2018

Academic Editor: Roberto Amerigo Papini

Caption: Figure 1: A map depicting the sampling sites for collecting fecal samples from Yunnan black goats in Yunnan province, southwestern China.

Caption: Figure 2: The phylogenetic relationships among G. duodenalis isolates inferred by a Neighbor-Joining (NJ) algorithm using a Kimura two-parameter analysis (1000 replicates) based on the tpi gene sequences. The two novel assemblage E subtypes [E.sub.11] and [E.sub.12] (MH621338, MH621340) are marked by filled triangles.
Table 1: Primers used in the study; annealing temperatures
used in the PCRs.

Gene   Primer        Sequences (5'-3')         Annealing
                                              temperature
                                              ([degrees]C)

BG      GF1     AAGCCCGACGACCTCACCCGCAGTGC         55
        GR1     GAGGCCGCCCTGGATCTTCGAGACGAC
        GF2       GAACGAACGAGATCGAGGTCCG           55
        GR2         CTCGACGAGCTTCGTGTT
GDH     Gdh1       TTCCGTRTYCAGTACAACTC            50
        Gdh2       ACCTCGTTCTGRGTGGCGCA
        Gdh3      ATGACYGAGCTYCAGAGGCACGT          65
        Gdh4       GTGGCGCARGGCATGATGCA
TPI    AL3543       AAATIATGCCTGCTCGTCG            50
       AL3546      CAA ACCTTITCCGCAAACC
        ALEf       CCCCTTCTGCCGTACATTTAT           58
        ALEr      GGCTCGTAAGCAATAACGACTT

Gene   Primer   Reference

BG      GF1        [1]
        GR1
        GF2
        GR2
GDH     Gdh1       [1]
        Gdh2
        Gdh3
        Gdh4
TPI    AL3543     [1,3]
       AL3546
        ALEf
        ALEr

Table 2: Prevalence and risk factors of Giardia duodenalis infection
in Yunnan black goats in Yunnan province, southwestern China.

Factor        Category   No. tested   No. positive (%)
                                          [95% CI]

Area           Wuding       444       24 (5.4, 3.3-7.5)
              Yongreng      139       2 (1.4, 0.6-3.3)
              Mouding       145       2 (1.4, 0.5-3.3)
              Ninglang       51        1 (2.0, 1.8-5.8)
               Mohan        128       9 (7.0, 2.6-11.5)
Gender         Female       633       23 (3.6, 2.1-5.1)
                Male        274       15 (5.5, 2.8-8.2)
Age (month)   [less than    364       22 (6.1, 3.6-8.6)
              or equal
               to]12
                >12         543       16 (2.9, 1.2-4.6)
Total                       907       38 (4.2, 2.9-5.5)

Factor        Category      OR [95 % CI]      P-value

Area           Wuding      4.086 (0.95-17.50)    0.04
              Yongreng     1.044 (0.15-7.51)     0.97
              Mouding           Ref             Ref
              Ninglang     1.430 (0.13-16.11)    0.77
               Mohan       5.408 (1.15-25.51)    0.02
Gender         Female      0.651 (0.33-1.27)     0.20
                Male
Age (month)   [less than   2.119 (1.10-4.09)     0.02
               or equal
                to]12
                >12
Total

Table 3: Intra-assemblage substitutions in tpi, gdh, and bg loci
within Giardia duodenalis assemblage E.

Subtypes (number)    Nucleotide position and     GenBankID
                         substitutions

tpi

                    188   248

Ref. sequence        G     A                     MF095054
[E.sub.11] (1)       C     T                     MH621338
[E.sub.12] (10)      G     A                     MH621340
gdh
                    391   608   623

Ref. sequence        C     A     A               KX813711
[E.sub.10] (2)       T     G     G
[E.sub.13] (16)      C     G     G               MH621339
bg
                    62    66    78    82   365
Ref. sequence        C     A     A    T     C    KY769092
[E.sub.5] (35)       C     A     A    T     C
[E.sub.14] (1)       A    --     G    G     C    MH621337
[E.sub.15] (2)       C     A     A    T     T    MH621341

Table 4: Multilocus characterization of Giardia duodenalis isolates
based on the tpi, gdh, and bg genes.

subtype                                           No. of sequences

tpi                gdh                bg
[E.sub.12]      [E.sub.13]        [E.sub.15]             1
[E.sub.12]      [E.sub.13]      [E.sub.5.sup.a]          8
[E.sub.11]      [E.sub.13]      [E.sub.5.sup.a]          1
--              [E.sub.13]            E15                1
--           [E.sub.10.sup.b]   [E.sub.5.sup.a]          2
--              [E.sub.13]      [E.sub.5.sup.a]          5
[E.sub.12]          --          [E.sub.5.sup.a]          1
--                  --            [E.sub.14]             1
--                  --          [E.sub.5.sup.a]          18

subtype      MLG type

tpi
[E.sub.12]    MLGE9
[E.sub.12]    MLGE10
[E.sub.11]    MLGE11
--
--
--
[E.sub.12]
--
--

Note: a, b indicate that genotypes have been reported.

-: not determined.
COPYRIGHT 2018 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Xie, Shi-Chen; Zou, Yang; Chen, Dan; Jiang, Meng-Meng; Yuan, Xiao-Dan; Li, Zhao; Zou, Feng-Cai; Yang
Publication:BioMed Research International
Geographic Code:9CHIN
Date:Jan 1, 2018
Words:3730
Previous Article:Digital versus Analog Procedures for the Prosthetic Restoration of Single Implants: A Randomized Controlled Trial with 1 Year of Follow-Up.
Next Article:Effect of Ionizing Radiation on the Microbiological Safety and Phytochemical Properties of Cooked Malva sylvestris L.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |