Printer Friendly

New family of allomorphic jellyfishes, Drymonematidae (scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton.

Introduction

The extant true jellyfishes represent one of the earliest diverging lineages of pelagic metazoans, class Scyphozoa (Rigby and Milsom, 2000). The morphological diversity of pelagic scyphozoan orders originated during the Cambrian (Willoughby and Robison, 1979; Hagadorn et al., 2002 Cartwright et al., 2007) and persisted through five mass extinctions that eradicated many more-diverse taxa. The durability of the scyphozoan bauplan and life history, despite low taxonomic richness, suggest early evolution of key innovations and occupation of an adaptive zone that persisted through the Paleozoic, Mesozoic, and Cenozoic. The scyphomedusan niche was apparently maintained by macro-evolutionary constraints that, notwithstanding abiotic changes which altered the phyletic composition of other zooplankton, inhibited the evolution of increasingly better adaptations by novel prey and therefore prevented co-evolutionary escalation (Rigby and Milsom, 2000). The evolutionary inference, that the scyphozoan morphology was exceedingly well-adapted or exapted for predation on diverse taxa through geologic time, has been complemented by the taxonomic and ecological literature, which together describe modern scyphomedusan diversity as comprising relatively few, often widespread, trophic generalists (e.g., Aral, 1997; Mianzan and Cornelius, 1999; Richardson et al., 2009).

A different perspective on the taxonomic richness and distribution of scyphomedusae is emerging from molecular phylogenetic analyses. Genetic evidence of cryptic species has raised estimates of scyphozoan species richness 2-to-10-fold (Dawson, 2004; Hamner and Dawson, 2009). These cryptic species often have different habitats or restricted geographic distributions (Dawson et al., 2005), suggesting local or regional adaptation. Moreover, after phylogenetic analyses have clarified species boundaries, these cryptic species often have been distinguishable using morphologic criteria and may be composed of ecologically divergent lineages (Dawson, 2003, 2005a, b, c). Thus, molecular phylogenetic analyses have highlighted that modern scyphomedusan diversity is more species-rich, geographically complex, and potentially more ecologically diverse than traditionally thought.

Recent analyses suggest that similar issues beset higher taxonomic levels, with strong inference that new families should be recognized for subsets of species currently identified as members of families Nausithoidae or Cyaneidae (Bayha et al., 2010; Fig. 1). Here, we tackle the latter case, establishing the new family Drymonematidae to accommodate species in the existing genus Drymonema and describing a new taxon: Drymonema larsoni. We then briefly consider the evidence for niche conservation in Drymonema and conclude, contrarily, that niche evolution characterizes the functional biology of Drymonema and perhaps also other scyphozoans.

[FIGURE 1 OMITTED]

Taxonomic background

Class Scyphozoa comprises two lineages: Discomedusae and Coronatae. The Discomedusae includes the order Semaeostomeae, which is now confirmed to be paraphyletic with respect to the other discomedusan order, Rhizostomeae (Bayha et al., 2010). Semaeostomeae traditionally is composed of three families of pelagic jellyfish, including some of the best-known species: Cyaneidae (e.g., the lion's mane, Cyanea capillata), Pelagiidae (e.g., the sea nettle, Chrysaora quinquecirrha), and Ulmaridae (e.g., the moon jellyfish, Aurelia aurita). Family Cyaneidae is distinguished from other semaeostome families on the basis of three characters: in cyaneids, tentacles arise from the subumbrella away from the bell margin, pendulous gonads hang below the subumbrella in complexly folded eversions of the subumbrellar wall, and the stomach forms radiate pouches that terminate in rudimentary (i.e., poorly developed) branching canals only in the marginal lappets (Kramp, 1961: p. 331). In contrast, tentacles form at the bell margin and gonads are protected within the bell in Pelagiidae and Ulmaridae, and gastrovascular canals are absent from Pelagiidae (Kramp, 1961: p. 323) or highly developed from central stomach to bell margin in Ulmaridae (Kramp, 1961: p. 337). Cyaneidae is additionally distinguished from Ulmaridae in lacking a ring canal (Kramp, 1961: p. 331).

Within family Cyaneidae, three valid genera--Cyanea, Desmonema, Drymonema--and about 20 valid species (Kramp, 1961; Daly et al., 2007) show considerable variance for the three characteristics diagnostic of the family. In each case, Drymonema (Figs. 2, 3, 4, 5) is the most extreme (i.e., the farthest from the central tendency of Haeckel's cyaneids), with Desmonema and Cyanea more similar to each other than to Drymonema. For instance, fine hairlike tentacles arise from concentric horseshoe-shaped rows at the base of the adradial marginal lappets in species of Cyanea, whereas thick ribbonlike tentacles arise in a straight line at the base of the adradial marginal lappets in Desmonema; in contrast, tentacles arise from a broad annular band toward the center of the subumbrella in Drymonema (e.g., see Fig. 6A, B). The gastrovascular systems of Cyanea and Desmonema consist of 16 radial pouches that extend from the stomach and branch into poorly developed canals only near the marginal lappets (Kramp, 1961: p. 331), whereas the gastrovascular system of Drymonema consists of well over 100 gastric pouches at the bell margin (Kramp, 1961: p. 336). In addition, while the circular and radial musculatures are well developed in Cyanea (Kramp, 1961: p. 331) and Desmonema (Kramp, 1961: p. 336), these muscles are barely a superficial veneer in Drymonema (Haeckel, 1881: p. 125). Perhaps most striking, Drymonema alone exhibits rhopalia in deep subumbrellar niches about a third of the bell radius from the margin toward the mouth (e.g., Fig. 6A, 7A-B; Haeckel, 1880; Kramp, 1961); all other scyphozoans have rhopalia at the bell margin.

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

Haeckel (1880) recognized the disparities between Drymonema and the other cyaneid genera when establishing the genus for Drymonema dalmatinum (as D. dalmatina) collected from Hvar Island, Adriatic Sea. Haeckel contemplated establishing a new family for Drymonema (Haeckel, 1880: p. 643) but in the published account wrote that the differences warranted only subfamilial distinction. Subsequent studies followed this lead, although rarity of specimens, loss of type material, individual variation, and incomplete descriptions may have hindered comparisons. Haeckel (1881) sought to rename D. dalmatinum as D. victoria, adding a single partial sample from the Strait of Gibraltar. Midler (1883) described D. gorgo from Santa Catarina Island, southern Brazil, on the basis of three specimens and two characters (size and number of gastric pockets). Antipa (1892) described D. cordelio on the basis of 10 specimens from the Gulf of Izmir, Turkey, differentiating it from D. dalmatinum on four main characters (medusae size, gastric pocket number, lappet size, and gonad structure). Stiasny (1940a) had only one new specimen, from Canale di Leme in Rovigno, Croatia, which, although he could not locate the specimens examined by Haeckel (1880) or Antipa (1892), he used to synonymize D. cordelio with D. dalmatinum, reasoning that they were different ontogenetic stages of the same species. It is unclear what happened to Stiasny's specimen, but it may have been lost while on loan or it may have been returned to Dr. G. Kolosvary at the Hungarian Natural History Museum and destroyed during bombing of the museum in 1956 (L. Forro, Hungarian Natural History Museum; pers. comm.). Currently, only a single specimen of Mediterranean D. dalmatinum can be found at any museum (the Museum of Natural History in Berlin, Germany).

A new family-level molecular phylogenetic analysis of the class Scyphozoa based on partial nuclear 18S and 28S sequences of representatives from all 19 scyphozoan families shows that family Cyaneidae, including the genus Drymonema, is polyphyletic (Bayha et al., 2010; Fig. 1). Drymonema also is clearly reciprocally monophyletic with respect to Cyaneidae (Cyanea + Desmonema), Pelagiidae, and Ulmaridae, indicating that Drymonema does represent a novel semaeostome family. Moreover, the phylogeny suggests considerable genetic difference between medusae from the Mediterranean basin and western Atlantic, highlighting the need for assignment of a neotype of D. dalmatinum to stabilize the species description and for recognition of a new species of Drymonema from the western Atlantic.

Materials and Methods

Medusae of the genus Drymonema were collected by hand from docks or boats in live geographic sites (Table 1). Medusae collected in the southeastern United States were each biopsied for a tissue sample of tentacle, oral arm, or both, that had been preserved in 75%-100% ethanol before the rest of the medusa was preserved in 10% buffered formalin in seawater. Comparative material from Argentina was fixed only in 8% buffered formalin; comparative material from Turkey was preserved only in ethanol. Additional specimens of Drymonema, all fixed in formalin, were studied at the Museum of Natural History in Berlin, Germany (ZMB), and the National Museum of Natural History at the Smithsonian Institution in Washington, DC (USNM). Molecular analyses
Table 1

Specimens of Drymonema analyzed in this study were collected in four
geographic regions: Caribbean (Guano Island), Gulf of Mexico (Dauphin
Island, Florida Keys), Mediterranean (Foca, Rovigno), and western South
Atlantic (Bahia Blanca); these regions correspond to three
biogeographic provinces: Caribbean (Caribbean and Gulf of Mexico),
Mediterranean, and Brazilian (Longhurst, 2007)

                                                                Sample
                                                                sizes
                                                                 (n)

Species        Location                 Lat.    Long.   Source  Morph.

D. dalmatinum  Foca, Turkey           38.667N  26.752E  Field     ND

D. dalmatinum  Rovigno, Croatia (ZMB  45.128N  13.623E  Museum    1
               Cni 15850)

D. gorgo       Bahia Blanca,          39.070S  62.220W  Field     1
               Argentina

D. larsoni     Dauphin Island, AL     30.090N  88.212W  Field     7
               (USA)

D. larsoni     Summerland Key, FL       ND     ND       Field     1
               (USA) [dagger]

D. larsoni     American Shoal, FL     24.527N  81.523W  Field     2
               (USA)

D. larsoni     Guano Is., British     18.479N  64.570W  Museum    7
               Virgin Is. (USNM
               54394)

                                           Sample sizes (n)

Species        Location               18S  28S  ITS *  16S  COI

D. dalmatinum  Foca, Turkey            2    3     5     5    5

D. dalmatinum  Rovigno, Croatia (ZMB   ND   ND   ND     ND   ND
               Cni 15850)

D. gorgo       Bahia Blanca,           ND   ND   ND     ND   ND
               Argentina

D. larsoni     Dauphin Island, AL      5    5     5     5    5
               (USA)

D. larsoni     Summerland Key, FL      0    0     1     1    1
               (USA) [dagger]

D. larsoni     American Shoal, FL      2    2     2     2    2
               (USA)

D. larsoni     Guano Is., British      ND   ND   ND     ND   ND
               Virgin Is. (USNM
               54394)

ND indicates that no data were available. Where GPS coordinates were
not available, they were estimated from satellite imagery using Google
Earth ver. 5.2.1.1329 beta.
* ITS1 sequences included partial flanking 18S (178 bp) and 5.8S (89
bp).
[dagger] Collected about 2 miles north of Summerland Key in the Gulf of
Mexico.


We used a modified CTAB DNA extraction protocol (Dawson et al., 1998) to extract genomic DNA from ethanol-preserved tissue. Three nuclear markers (18S ribosomal DNA [rDNA], 28S rDNA, and internal transcribed spacer 1 [ITS1]) and two mitochondrial markers (16S rDNA and cytochrome c oxidase subunit I [COI]) were amplified in 50-[micro]1 reactions composed of 0.5 [micro]mol [1.sup.-1] primers, 5.0 [micro]1 of 10x PCR buffer, 3 mmol [1.sup.-1] [MgCl.sub.2], 0.2 mmol [1.sup.-1] dNTPs, and 0.1 [micro]1 of Taq polymerase (Applied Biosystems, Foster City, CA) on an Applied Biosystems 2720 thermal cycler. Primers for 18S and 28S are listed in table 2 of Bayha et al., (2010); for ITS1 we used primers KMBN-8 and KMBN-84 (Bayha, 2005), for 16S we used 16S-L (Ender and Schier-water, 2003) with Aa_H16S_15141H (AGATTTTAATGGTCGAACAGAC), and for COI we used LCOjf (Dawson, 2005d) with Aa_HCOI_12582 (AGCAGGGTCGAAGAAAGATGTATT). Samples that did not amplify successfully with the routine PCR COI primers above were amplified with the Drymonema-specific primers Dd_L-COI_24 (TTGGAACYCTTTACCTAGTATTTG) and Dd_HCOI_638 (CGAAGAAAGATGTATTAAARTTC-CTAT). All PCRs began with a 180-s denaturation step at 94-95 [degrees]C, followed by 38 thermal cycles including a 94 [degrees]C for 30 s denaturation step and locus-specific annealing or extension steps. The locus-specific steps were as follows: 18S rDNA-48 [degrees]C for 60 s and 72 [degrees]C for 120 s; 28S rDNA-48 [degrees]C for 60 s and 72 [degrees]C for 90 s; ITS1--50 [degrees]C for 60 s and 72 [degrees]C for 60 s; 16S rDNA and COI--50 [degrees]C for 60 s and 72 [degrees]C for 75 s. All PCRs terminated with a 600-s extension step at 72 [degrees]C and refrigeration at 4 [degrees]C. PCR products were directly sequenced in both directions, using the aforementioned primers, by the University of Washington High-Throughput Genomics Unit (Seattle, WA) or the [.sup.UC.DNA] Sequencing Facility (Davis, CA). Contigs were assembled in Sequencher ver. 4.8 (Gene Codes Corporation, Ann Arbor, MI), checked by eye for correct base calls, and sequence identity confirmed by BLASTn comparison with the NCBI GenBank database (Altschul et al., 1997). We aligned homologous sequences in ClustalX ver. 2.0 using gap opening:extension penalties 6.7:15 (Larkin et al., 2007). All published sequences are available in NCBI GenBank under accession numbers HQ234610-HQ234668, and alignments used in the analyses were deposited into Tree-BASE (http://purl.org/phylo/treebase/phylows/study/TB2:S10857).
Table 2

Morphological characters examined in this study

#   Feature                Possible states, dimensions, and other
                           notes

1   bell diameter          cm

2   exumbrellar papillae   absent or present

3   exumbrella marking     absent or present

4   color of exumbrella    color
    marking

5   exumbrella furrow      absent/present

6   shape of bell in       semicircular convex, triangular, wide
    oral-aboral            rectangular, tall rectangular, square,
    cross-section          actinuloid, sinusoid or sinusoid with
                           central globose mass

7   shape of bell in       circular or square
    plane perpendicular
    to oral-aboral axis

8   rhopalium              absent or present,

9   axial position of      perradial only, interradial only, adradial
    rhopalia               only, perradial + interradial, perradial +
                           adradial, interradial + adradial, or
                           perradial + interradial + adradial

10  rhopalium location     at umbrella margin, distally on exumbrella,
                           median on subumbrella, or distally on
                           subumbrella

11  rhopaliar pit depth    mm

12  rhopaliar pit length   mm

13  rhopaliar pit width    mm

14  ocelli                 absent or present

15  statocyst length       mm

16  statocyst width        mm

17  tentacles per octant   number

18  tentacle insertion     at umbrella margin, proximally on
    position               exumbrella, distally on exumbrella,
                           proximally on exumbrella, distally on
                           exumbrella, proximally on subumbrella, or
                           distally on subumbrella

19  tentacle structure     hollow or solid

20  tentacle morphology    angular, capitate, or straight

21  axial position of      perradial only, interradial only, adradial
    tentacles              only, perradial + interradial, perradial +
                           adradial, interradial + adradial, or
                           perradial + interradial + adradial

22  tentacular             single or clumped
    arrangement

23  color of tentacles     color

24  gastric mesenteries    0 = absent, present = number
    per octant

25  gastric mesentery      straight, bent, or sinusoid
    shape

26  anastomosing velar     absent or present
    gastric mesenteries

27  anastomosing           absent or present
    rhopaliar gastric
    mesenteries

28  gastric stomach        number
    pockets per octant

29  radial canals          absent or present

30  ring canal             absent or present

31  subumbrellar radial    number
    furrows per octant

32  umbrellar margin       smooth and continuous or with clefts and
    description            lappets

33  bell margin color      color

34  velar lappets per      number
    octant

35  velar lappet length    mm

36  velar lappet width     mm

37  velar lappet shape     symmetric square, symmetric semicircular,
                           symmetric semi-oval, symmetric tapering,
                           asymmetric square, asymmetric semicircular,
                           asymmetric semi-oval, or asymmetric
                           tapering

38  size heterogeneity in  yes or no
    velar lappets

39  rhopaliar lappets per  number
    octant

40  rhopaliar lappet       mm
    length [ = rhopaliar
    cleft depth]

41  rhopaliar lappet       mm
    width

42  rhopaliar lappet       symmetric square, symmetric semicircular,
    shape                  symmetric semi-oval, symmetric tapering,
                           asymmetric square, asymmetric semicircular,
                           asymmetric semi-oval or asymmetric
                           tapering

43  size heterogeneity in  yes or no
    rhopaliar lappets

44  rudimentary lappet     absent or present
    canals

45  mouth description      simple or with mouth lips

46  mouth lip              absent, simple lips, gelatinous or
    description            curtain-like arms, or oral arms with
                           suctorial mouths

47  manubrium width at     mm
    base

48  oral arm color         color

49  gastric filaments      absent or present

50  color of gastric       color
    filaments
51  gonads                 number

52  axial position of      perradial only, interradial only, adradial
    gonads                 only, perradial + interradial, perradial +
                           adradial, interradial + adradial, or
                           perradial + interradial + adradial

53  gonad length           mm

54  structural form of     digitate, ribbon, floret, horseshoe, or
    gonads                 flame-shaped

55  color of gonads        color


Maximum-likelihood gene trees were reconstructed for 18S-ITS1-5.8S, 16S, and COI using GARLI ver. 0.951 (Zwickl, 2006), excluding gapped and degenerate positions, and employing the best-fit substitution models assessed using jMODELTEST ver. 0.11 (Posada, 2008) under the Akaike (AIC) and Bayesian (BIC) information criteria. Midpoint-rooted phylogenetic trees were drawn in Figtree ver. 1.2.3 (Rambaut, 2009). Bootstrap support values were calculated by importing 1000 maximum-likelihood trees, generated in GARLI employing the same search parameters on 1000 bootstrapped datasets, into PAUP * 4.0b10 (Swofford, 2003) and calculating the majority rule consensus tree. The maximum-likelihood gene trees were then annotated with bootstrap values in Adobe Illustrator CS2 (Adobe Systems Incorporated, San Jose, CA). Mean sequence differences between clades were calculated in PAUP 4.0b10 using maximum-likelihood analysis and the substitution model parameters obtained via jMODELTEST ver. 0.1.1.

Morphological analyses

We photographed 19 formalin-fixed specimens of Drymonema from four geographic regions (Table 1) under reflected and transmitted light in aquaria or on a flat measuring table. Morphological features were measured on high-resolution digital photographs using jMicrovision ver. 1.2.7 (Roduit, 2008). Bell diameter, the distance (cm) between distal ends of rhopalia on a chord bisecting a medusa lying exumbrella surface down on the measuring table, was our Standard measurement of medusa size (Dawson 2003, 2005b, c). The sizes of medusae reported by Haeckel (1880, 1881), Stiasny (1940a), and Larson (1987), which to the best of our knowledge were based on distances between opposing points on the bell margin (e.g., R.J. Larson, U.S. Fish and Wildlife Service, Klamath Falls, OR; pers. comm.), were standardized by regressing this marginal diameter (md) on bell diameter (bd) for all specimens in Statistica ver. 7.1 (Statsoft Inc., Tulsa, OK); bd = 0.828md -0.373.

Fifty-five additional features were documented (Table 2). To reliably enumerate tentacles, it was necessary to remove each tentacle as it was counted; consequently, tentacles were not enumerated for the single D. dalmatinum specimen that we designated as a neotype. Whenever possible, character states were calculated as the mean ([+ or -] st. dev.) of measurements in multiple octants. Lappets were enumerated between pairs of clefts in the bell margin, never using the gastric pockets as a guide (cf. Stiasny, 1940a). Gastric pockets were occasionally observed by injecting dilute food coloring through the mouth and into one octant of the gastric cavity.

Non-independence of continuous morphological features and bell diameter were tested using least-squares regression in Sigmaplot ver. 11.0 (Systat Software Inc., San Jose, CA) and 99% confidence intervals on the regression plotted in Sigmaplot. Datapoints were identified as statistical outliers from a regression if their studentized residual was more negative than -2 in MYSTAT ver. 12 (Systat Software Inc., San Jose, CA).

Results

Drymonematidae Haeckel, 1880, new family

Figs. 2-12

Haeckel (1880: p. 642) Drymonemidae subfam. nov.; Haeckel (1881: p. 124) Drymonemidae.

Diagnosis. Semaeostome with eight rhopalia in deep niches of the subumbrella away from the bell margin; tentacles within an annular zone of the subumbrella delimited proximally by the manubrium and distally by the radius to the rhopalia; gastrovascular cavity consists of radial pockets, separated by gastric mesenteries, which bifurcate numerous times toward the bell margin; ring canal absent.

Remarks. The retention of Haeckel, 1880, as the author of the new family Drymonematidae follows Article 36.1 (Statement of the Principle Coordination applied to family-group names) of the International Code of Zoological Nomenclature 4th edition (International Commission on Zoological Nomenclature, 1999).

Drymonema Haeckel, 1880

Figs. 2-12

Haeckel (1880: p. 633) Drymonema gen. nov.; Mayer (1910: p. 603); Kramp (1961: p. 336); Mianzan and Cornelius (1999: p. 539); Calder (2009: p. 33).

Diagnosis. Drymonematidae with eight rhopalia in deep niches of the subumbrella approximately one-third marginal bell radius from bell margin (Fig. 6A); tentacles distributed on subumbrella in eight adradial triangular-shaped clusters within an annular zone between mouth and rhopalia (Fig. 6B); tentacles arise from within bifurcating subumbrellar furrows (Fig. 6B); gastrovascular system consists of eight rhopaliar and eight velar radial pockets that are separated by straight or sinuate-dentate gastric mesenteries (Fig. 6C, D, F). Velar radial pockets bifurcate toward the bell margin, increasing in number with increasing bell diameter; gastric pockets rarely anastomose; pockets may terminate in many blind canals in the lappets (Fig. 6E); four veil-like perradial oral arms.

[FIGURE 6 OMITTED]

Drymonema dalmatinum Haeckel, 1880

Figs. 2, 10-11, 12A-C; Table 3
Table 3

Morphological variation among species of Drymonema; values for D.
dalmatinum and D. gorgo that are in parentheses and italics were taken
from Haeckel (1880), Muller (1883), Antipa (1892), and Stiasny (1940a)

Character              Drymonema dalmatinum   Drymonema larsoni

Bell diameter          86.5 mm (62.5-214mm)   24.6-204 mm

Tentacle number per    ? (0.474-0.639) bd     1.02-2.34 bd
octant (1)

Tentacle arrangement   clumped                clumped

Tentacle cluster       ? (triangle)           triangle
shape

Axial position of      adradial               adradial
tentacles

Gastric mesenteries    0.197 (0.079-0.320)    0.220-0.691 bd
per octant (1)         bd

Velar mesenteries      ? (Yes)                yes
anastomose?

Rhopaliar mesenteries  ? (No)                 no
anastomose (1)

Mesentery shape        straight               straight

Gastric pockets per    0.208 (0.084-0.400)    0.230-0.723 bd
octant (1)             bd

Subumbrellar furrows   no data                0.169-0.583 bd
per octant (1)

Bell color             clear, white, or       clear (2)
                       pink

Exumbrella marking     none or crenulations   none

Bell margin color      clear                  clear (2)

Velar lappets per      13 (14-24)             12-21
octant

Velar lappet length    no data                0.006-0.014 bd
(1)

Velar lappet width     no data                0.023-0.044 bd
(1)

Velar lappet shape     symmetric rounded      variable

Velar lappets of       no                     yes
heterogeneous size?

Rhopaliar lappets per  2                      2
octant

Rhopaliar lappet       no data                0.001-0.017 bd
length (1)

Rhopaliar lappet       no data                0.023-0.044 bd
width (1)

Rhopaliar lappet       symmetric rounded      variable
shape

Rhopaliar lappets of   no                     yes
heterogeneous size?

Gastric canals in      yes (3)                yes (3)
lappets?

Rhopalia number        8                      8 (4)

Axial position of      perradial and          perradial and interradial
rhopalia               interradial

Rhopaliar pit length   0.040 bd               0.032-0.053 bd
(1)

Rhopaliar pit width    0.024 bd               0.019-0.049 bd
(1)

Statocyst length       no data                0.450-0.709 mm

Statocyst width        no data                0.230-0.421 mm

Gonad number           4                      4 (4)

Axial position of      interradial            interradial
gonads

Gonad structure        (horseshoe, ribbon)    flame-shaped

Gonad length (1)       no data                0.411-0.421 bd

Gonad color            light brown or light   light brown or light pink
                       pink                   (2)

Oral arm number        4                      4 (4)

Manubrium width at     no data                0.411-0.421 bd
base (1)

Oral arm color         pink or light brown    pink or light brown (4)

Gastric filaments      in medusae < 8.65-9.9  in medusae
present                cm bd (5)              [less than or equal to]
                                              8.2 cm bd (6)

Color of gastric       pink or light brown    clear or white (2)
filaments

Character              Drymonema gorgo

Bell diameter          78.1 mm (247.3 mm)

Tentacle number per    0.745 bd
octant (1)

Tentacle arrangement   clumped

Tentacle cluster       triangle
shape

Axial position of      adradial
tentacles

Gastric mesenteries    0.226
per octant (1)

Velar mesenteries      yes
anastomose?

Rhopaliar mesenteries  no
anastomose (1)

Mesentery shape        sinuate-dentate

Gastric pockets per    0.239 (0.089) bd
octant (1)

Subumbrellar furrows   0.196 bd
per octant (1)

Bell color             clear (2)

Exumbrella marking     none

Bell margin color      clear (2)

Velar lappets per      15-16
octant

Velar lappet length    0.014 bd
(1)

Velar lappet width     0.028 bd
(1)

Velar lappet shape     tapering

Velar lappets of       yes
heterogeneous size?

Rhopaliar lappets per  2
octant

Rhopaliar lappet       0.021 bd
length (1)

Rhopaliar lappet       0.016 bd
width (1)

Rhopaliar lappet       symmetric tapering
shape

Rhopaliar lappets of   yes
heterogeneous size?

Gastric canals in      yes
lappets?

Rhopalia number        8

Axial position of      perradial and interradial
rhopalia

Rhopaliar pit length   0.053 bd
(1)

Rhopaliar pit width    0.031 bd
(1)

Statocyst length       0.697 mm

Statocyst width        0.442 mm

Gonad number           4

Axial position of      interradial
gonads

Gonad structure        no data

Gonad length (1)       no data

Gonad color            light brown or light pink (2)

Oral arm number        4

Manubrium width at     no data
base (1)

Oral arm color         pink

Gastric filaments      no data
present

Color of gastric       no data
filaments

(1) Feature is reported as a proportion of bell diameter.
(2) Color observations for some or all specimens came from
formalin-preserved specimens and may be unreliable.
(3) Gastric canals in lappets are extremely small or absent in
specimens [less than or equal to] 8.7 cm bd.
(4) A single aberrant D. larsoni had six rhopalia, oral arms and
gonads.
(5) Represents the sizes of largest animal that did possess gastric
filaments (8.65 cm) and the smallest one that did not (9.9 cm.).
(6) Value taken from Larson (1987) but is compatible with our data from
the Gulf of Mexico (largest with gastric filaments = 6.2 cm, smallest
without gastric filaments = 10.9 cm).
? = unclear from specimen.


Drymonema dalmatina--Haeckel (1880: p. 642) sp. nov., Adriatic Sea; Mayer (1910: p. 602) Mediterranean Sea; Kolosvary (1937: pp. 1-3) Adriatic Sea; Stiasny (1940a: pp. 437-462) Adriatic Sea; Stiasny (1940b: pp. 14-18) Adriatic Sea; Kolosvary (1945: p. 140) Rovigno, Adriatic Sea; Kramp (1959: p. 25) Angola, West Africa. Drymonema victoria-Haeckel (1881: p. 125) sp. nov., Strait of Gibraltar, Adriatic Sea; Stiasny (1931:140) Adriatic Sea. Drymonema cordelio--Antipa (1892: p. 337) sp. nov., Gulf of Izmir, Turkey. Drymonema dalmatinum--Kramp (1961: p. 336).

Diagnosis. Drymonematidae up to 1 m in bell diameter; exumbrella may be finely pitted, small papillae present and possess bifurcating, colored exumbrellar crenulations; color pink to light purple; gastric pockets, separated by straight gastric mesenteries, bifurcate toward bell margin; few tentacles and few gastric pockets per octant.

Material examined. Neotype--ZMB Cni 15850, immature medusa, 8.5 cm bd, collected at Canale di Leme, Rovigno, Croatia, Adriatic Sea in 1914. Type material of Mediterranean D. dalmatinum was not in collections at California Academy of Sciences (San Francisco, CA), Croatian Museum of Natural History (Zagreb, Croatia), Finnish Museum of Natural History (Helsinki, Finland), Hungarian Natural History Museum (Budapest, Hungary), Museum National d'Histoire Naturelle (Paris, France), Museum of Comparative Zoology at Harvard University (Cambridge, MA), Museum of Zoology at the University of Sao Paulo (Sao Paulo, Brazil), Natural History Museum of the UK (London, UK), Natural History Museum of Denmark (Copenhagen, Denmark), Naturalis: National Museum of Natural History (Leiden, Netherlands), Peabody Museum of Natural History at Yale University (New Haven, CT), Senckenberg Research Institute and Natural Museum (Frankfurt, Germany), Smithsonian Institution National Museum of Natural History (Washington, DC), Stazione di Napoli Anton Dohrn (Naples, Italy), Swedish Museum of Natural History (Stockholm, Sweden), nor Zoological Museum Hamburg (Hamburg, Germany).

Description of neotype. Bell flat, circular, 8.5 cm bd, semicircular convex in cross section. Exumbrella transparent, colorless, without obvious papillae or markings. Four perradial and four interradial rhopalia in deep pits in subumbrella 1.7 cm (33% of marginal bell radius [=5.15 cm] from the bell margin. Straight, hollow tentacles arise from subumbrellar radial furrows in a wide annular zone between mouth and radius of rhopalia; tentacle number increases distally, while size and length of each tentacle decreases distally. Mouth is central, obvious, four-cornered; four veil-like perradial oral arms, translucent and about the length of the marginal bell radius, extend from short manubrium. Four interradial, immature, pendulous gonadal sacs originate in mouth area. Few gastric filaments attached to stomach wall near opening of gonadal sac. Straight gastric mesenteries separate gastrovascular pockets on rhopaliar and velar axes; rhopaliar gastric mesenteries bifurcate once, whereas velar gastric mesenteries bifurcate [approximately equal to ] 4 times per octant giving [approximately equal to ] 444 gastric pockets at the bell margin; anastomoses of gastric mesenteries are unclear. Bell margin has about 16 velar and 2 rhopaliar lappets per octant; all lappets appear identical in shape and size; lappet canals cannot be seen.

Type locality. Canale di Leme, Rovigno, Croatia, Adriatic Sea.

Habitat. Medusae typically have been found at the surface in coastal waters, with one questionable record from depth (Haeckel, 1881).

Distribution. Mediterranean Sea; Hvar Island and Rovigno, Croatia, Adriatic Sea; Gulf of Izmir and Foca, Turkey, Aegean Sea; Strait of Gibraltar. Possibly disjunct off Angola (Kramp, 1959). DNA sequence. Nuclear 18S. 18S-ITS1-5.8S, and 28S, and mitochondrial COI and 16S sequence data are available in GenBank under accession numbers: HQ234614-HQ234617; HQ234621; HQ234627-HQ234630; HQ234634; HQ234640-HQ234643; HQ234647; HQ234657-HQ234658; HQ234665-HQ234666.

Drymonema larsoni, Bayha and Dawson, new species

Figures 4, 6-8, 7-8, 10-11, 12D-F; Table 3

Drymonema dalmatinum--Larson (1987: pp. 437-441) British Virgin Islands, Puerto Rico; Williams et al. (2001: pp. 127-130) Puerto Rico; Calder (2009: pp. 33-35) South Carolina, USA, Bermuda; Segura-Puertas et al. (2009: p. 374) Gulf of Mexico.

Diagnosis. Bell colorless, diameter up to 1.1 m; exumbrella smooth without papillae, markings, or crenulations. Oral arms pink to tan. Tentacle number per octant [approximately equal to ] 9.66bd + 44.0 [+ or -] (3.06bd + 29.9) [error term is 99% confidence interval]. Gastric pocket number per octant [approximately equal to] 1.44bd + 15.6 [+ or -] (0.315bd + 3.05). Subumbrellar radial furrow number per octant [approximately equal to] 0.96bd + 16.5 [+ or -] (0.289M + 2.8) [all bd calculated in cm]. Gonadal sacs flame-shaped.

Material examined. Holotype--USNM 1148179, mature medusa, 13.8 cm bd, collected off Dauphin Island, Alabama, USA, in October 2008. Paratypes--USNM 53934, nine medusae, 2.5-4.7 cm bd, Guano Island, British Virgin Islands, 20 July 1975; USNM 1148180, USNM 1148181, USNM 1148183, and USNM 1148182, three mature medusae (13.6 cm, 12.0 cm, 20.4 cm bd) and one immature medusa (4.6 cm bd), Dauphin Island, Alabama, USA, October 2008; CASIZ 184326, one immature medusa (4.3 cm bd), American Shoal, Florida, USA, 13-18 September, 2009; CASIZ 184327, One mature medusa (10.9 cm bd), Dauphin Island, Alabama, USA; Other comparative specimens--One mature medusa (18.4 cm bd), Dauphin Island, Alabama, USA, October 2008; Two immature medusae (4.6 cm, 6.2 cm bd), American Shoal and Summerland Key, Florida, USA, 13-18 September, 2009; USNM 17362, three medusae, collected off South Carolina, USA (32.46[degrees]N, 077.34[degrees]W), 21 October 1885; USNM 58679, 10 medusae, collected off Bermuda, 24 December 1898; USNM 54395 and USNM 54471, three medusae, collected from La Parguera, Puerto Rico, 11 December 1974.

Description of holotype specimen. Bell flat, circular, 13.6 cm bd, thick and firm in center, semicircular convex in cross section; 12 mm thick at center, 14 mm at l/3rd bell radius (based on bd) from center, 4 mm at 2/3rd bell radius from center. Exumbrella transparent, smooth, no furrow, no markings. Four perradial and four interradial rhopalia in deep pits, surrounded by two thickened lips in subumbrella, [approximately equal to]27% of marginal bell radius (= 8.19 cm) from bell margin; rhopaliar pit depth [approximately equal to]1 mm, rhopaliar pit width [approximately equal to] 4.2 mm, rhopaliar pit length [approximately equal to] 6.9 mm; rhopalium has simple statocyst without obvious ocellus (Fig. 7B). Straight hollow tentacles arise from bifurcating subumbrellar furrows in triangular adradial clusters within annular zone that spans from the mouth to the proximal edge of rhopalia; tentacles absent along interradii and perradii; mean [approximately equal to]192 tentacles, 25 furrows per octant; tentacles at proximal tip of clusters are largest, [approximately equal to] 4-5 mm thick and length [approximately equal to]2 bd, decreasing in size distally such that tentacles closest to rhopalia are short and hair-thin. Single large central mouth, four-cornered; short thin manubrium gives rise to four perradial veil-like tan-pink oral arms [approximately equal to]0.75 bd long. Four interradial, flame-shaped, pendant gonadal sacs fuse with the manubrium and open into the mouth (Fig. 8). Gastric filaments absent. Straight gastric mesenteries separate gastrovascular pockets (Fig. 6D) that bifurcate toward the bell margin; rhopaliar pockets typically bifurcate once, velar pockets bifurcate multiple times, giving [approximately equal to]30 gastric pockets and mesenteries per octant; velar pockets anastomose, rhopaliar pockets do not anastomose; gastric pockets extend into marginal lappets and terminate as radial canals (Fig. 6D). Bell margin has large, symmetrically rounded, paired, lappets, [approximately equal to]6.3 mm wide and [approximately equal to]1.5 mm long with some size variation; [approximately equal to]18 velar and 2 rhopaliar lappets per octant.

[FIGURE 7 OMITTED]

[FIGURE 8 OMITTED]

[FIGURE 9 OMITTED]

Variation from type specimen. Medusae varied in size from 2.5 cm to 20.4 cm bd. The numbers of tentacles, gastric pockets, subumbrellar furrows, dimensions of the rhopaliar pit all increased with bell diameter (Figs. 10-11). Lappet shape varied greatly, including very small rounded square lappets, larger pairs of rectangular lappets with rounded corners, asymmetric pairs of scalloped lappets (Fig. 6C-E), and simple symmetric semi-oval lappets. Lappets per octant variable, generally increasing with size (Fig. 10A). Gastric canals occur in the lappets of medusae from 4.5 cm to 20.4 cm bd but are difficult to see in smaller jellyfish. Gastric filaments occur only in medusae [less than or equal to] 8.2 cm bd (Larson, 1987).

[FIGURE 11 OMITTED]

Type locality. In clear water approximately 18 km south of Dauphin Island, Alabama, USA.

Habitat. Medusae are found at or near the surface in coastal waters.

Distribution. Dauphin Island, Alabama, Gulf of Mexico; Florida Straits; Florida Keys; British Virgin Islands; Puerto Rico (Larson, 1987; Williams et al., 2001); Bermuda (Calder, 2009); South Carolina, USA (Calder, 2009).

Etymology. Named for Dr. Ronald J. Larson, who first published research on this species from the British Virgin Islands and Puerto Rico (see Larson, 1987).

DNA sequence. Nuclear 18S, 18S-ITS1-5.8S, and 28S, and mitochondrial COI and 16S sequence data are available in GenBank under accession numbers HQ234649-HQ234652 and HQ234661 (type specimen); HQ234610-HQ234613; HQ234618-HQ234620; HQ234622-HQ234626; HQ234631-HQ234633; HQ234635-HQ234639; HQ234644-HQ234646; HQ234648; HQ234653-HQ234656; HQ234659-HQ234660; HQ234662-HQ234664; HQ234667-HQ234668.

Phylogeny. 18S and 28S ribosomal RNA sequences for all Drymonema dalmatinum and D. larsoni specimens analyzed were identical to published sequences for D. dalmatinum and Drymonema sp. from Bayha et al. (2010), respectively, with the exception of a single degenerate position in both regions. As this was consistent with familial patterns reported by Bayha et al. (2010), we did not examine these sequences further. AH COI sequences were the same size, and the ClustalX-aligned data set was 567 bp long, of which 76 (13.4%) positions were variable, non-gapped, and non-degenerate and 74 (13.1%) positions were parsimony-informative. All 16S sequences and the alignment thereof were 548 bases long; 33 (6.0%) positions were variable, non-gapped, non-degenerate, and parsimony-informative. The 18S-ITS1-5.8S sequences varied in length from 479 (D. larsoni) to 501 (D. dalmatinum) bp, with all length variation occurring in the ITS-1 region. The 5' and 3' ends of the ITS1 subunit were determined based on sequences from earlier studies on semaeostome ITS1 sequence (e.g., Odorico and Miller,1997; Dawson et al, 2005). The ClustalX-aligned data set was 507 bp long, of which 73 (14.4%) bases were variable, non-gapped, non-degenerate, and parsimony-informative. Maximum-likelihood analyses of 18S-ITS1-5.8S, COI, and 16S from eight medusae collected off the southeastern United States and five medusae from Foca, Turkey, indicate reciprocal monophyly of D. larsoni and D. dalmatinum (Fig. 9). Mean sequence differences between clades (ITS1-only, 24.0%; COI, 12.7%; 16S, 6.0%) were large compared to mean sequence difference within clades of D. larsoni (ITSl-only, 0.0%; COI, 0.3%; 16S, 0.0%) or D. dalmatinum (ITS1-only, 0.0%; COI, 0.1%; 16S, 0.0%).

Discussion and Remarks

Morphological analyses and DNA sequencing of medusae from the southeastern United States and Turkey confirm that Drymonema is morphologically and genetically distinct from all other genera of semaeostome scyphomedusae. The differences are of a magnitude comparable to differences between families Cyaneidae (= Desmonema + Cyanea), Pelagiidae, and Ulmaridae, and therefore warrant recognition of the new family Drymonematidae. This becomes the fourth semaeostome family, the first described since Haeckel (1880) defined Ulmaridae, and the first new scyphozoan family described since Stiasny (1921) erected Lobonematidae and Mastigiidae.

Morphological and molecular analyses also demonstrate anatomical differences or reciprocal monophyly of Drymonema from three biogeographic provinces: the Mediterranean, Caribbean, and Brazilian provinces (Longhurst, 2007). DNA sequence differences between Mediterranean and Caribbean Drymonema are comparable with those seen between other valid scyphozoan species (Dawson and Jacobs, 2001; Holland et al., 2004; Dawson, 2005a) and corroborate morphological differences in meristic traits (Fig. 10). These same morphological traits--the numbers of tentacles and gastric pockets--also distinguish Caribbean medusae from the Brazilian specimen. Additionally, the number of subumbrellar furrows distinguishes Caribbean medusae from the Brazilian specimen (albeit not from Mediterranean medusae). Thus, patterns of molecular, morphological, and biogeographic variation are clear evidence of at least two species of Drymonema--the Mediterranean province D. dalmatinum and the Caribbean province D. larsoni--and tentatively corroborate a third species--the temperate Brazilian province D. gorgo. We speculate, on the basis of biogeography, that the medusa described from Angola by Kramp (1959) may also be D. gorgo, or a novel Guinean or Benguelan province form.

The diversity of Drymonema, while herein better described and elevated in taxonomic import, remains poorly circumscribed. Particularly, problems lie in distinguishing medusae morphologically because specimens are rare and usually small, thus variations with ontogeny (e.g., see Fig. 10, 11), within individuals (e.g., see Table 3), and within geographic regions (e.g., Haeckel, 1880; cf. Antipa, 1892; cf. Stiasny, 1940a) are incompletely described. Small medusae also cause particular difficulty in enumerating some features in a standardized manner (e.g., lappets, gastric pouches, see Haeckel, 1881; cf. Stiasny, 1940a). In addition, loss of type and voucher specimens renders it impossible to check inconsistencies in the literature such as Haeckel's (1881: plate 31 fig. 11) sole comment that gastric filaments were tiny protuberances within a "gastrogenital" sac (see reproduction in Fig. 12A), which contrasts starkly with other descriptions of large filaments just inside the mouth (Stiasny, 1940a, p. 448 fig. 6; this study Fig. 12B-E). More collections of D. dalmatinum are essential to redress the loss of types, incomplete descriptions in the literature, partial information from immature stages, and few specimens available for study.

Nonetheless, our combined morphological and molecular analyses of Drymonema reveal important facets of semaeostome and scyphozoan taxonomic diversity. Particularly, they lead us to go beyond documenting cryptic taxa and to take a functional morphological perspective that increases "understanding [of] the ecological and evolutionary consequences of organismal form" (Wainwright and Reilly, 1994: p. 1). Because imprecise species delimitation may obscure functional relationships that influence the dynamics of marine ecosystems, cryptic taxa that mask cryptic phenotypes likely result in cryptic ecology. Although still incomplete, our results begin to tie together allomorphic changes, shifts in feeding ecology, and possibly population dynamics of Drymonema.

Allomorphy (i.e., evolutionary allometry). The striking phylogenetic differentiation of Drymonema from Cyaneidae emphasizes the allomorphic differentiation of these taxa. Although superficially similar to Cyaneidae, with large bell overlying veil-like oral arms and long streaming tentacles, individuals of Drymonematidae are unlike any other scyphozoan. Drymonema has subumbrellar rather man marginal rhopalia (likely due to hypertrophic or hypoplasic growth of the bell margin), a broad proximal annular zone of tentacles (as opposed to distal clusters or a marginal row), and a more finely subdivided gastric cavity (intermediate between the broad gastric pouches of Pelagiidae and Cyaneidae and the canal systems of Ulmaridae and Rhizostomeae). Although many of these differences are related to isometric growth in Drymonema (Fig. 10), one certainly is not: our investigation of D. larsoni (see also Larson, 1987) indicates that Drymonema resorbs gastric filaments between 6.2 and 10.9 cm bd such that gastric filaments are absent from larger medusae.

Trophic ecology and niche evolution. The allomorphic morphology of Drymonema, including the allometric loss of gastric filaments and massive elaboration of the oral arms (Larson, 1987), is likely functionally related to dietary specialization. Considering phylogeny and morphology, the most recent common ancestor of Drymonematidae and Cyaneidae had gastric filaments, like extant small Drymonema and all sizes of Cyanea (Mayer, 1910; Russell, 1970; KMB, pers. obs.). Therefore, the common ancestor, and small Drymonema, like extant Cyanea, probably consumed various plankton, including small gelatinous zooplankton--sometimes specializing on the latter but never or very rarely eating large gelatinous zooplankton (Russell, 1970). In contrast, larger Drymonema eat primarily Aurelia (Larson, 1987) (e.g., Fig. 5), digesting the medusae with proteases secreted by the enveloping oral arms (Larson, 1987) and therefore rendering gastric filaments functionally redundant. The intriguing inference is that the allometric loss of gastric filaments reflects an ontogenetic trophic shift that arose during evolution of the feeding niche when, phylogenetically speaking, stem group Drymonema was presented with a novel prey item by the evolution of stem group Aurelia.

Patterns of abundance. Specialization as a predator of Aurelia may in part explain the intriguing population dynamics of Drymonema (Williams et al., 2001). In the Mediterranean, Stiasny (1940a) postulated that D. dalmatinum occurred in cycles of about 30 years, which is approximately consistent with occurrence of D. dalmatinum at Foca in 2003, i.e., 116 years after Antipa (1892) collected specimens in the Gulf of Izmir. Drymonema larsoni is likewise sporadic in the western Atlantic geographic region, being reported from the southeastern United States in 1885 and 1977 (Larson, 1987), Bermuda in 1898 (USNM) and various times between 1977 and 1997 (Calder, 2009), the eastern Caribbean in 1973-1975 and 1999 (Larson, 1987; Williams et al, 2001), the western Caribbean in 2005 (A. Collins, National Systematics Lab of NOAA's Fisheries Service and Smithsonian National Museum of Natural History; pers. comm.) and 2010 (B. Mueller, Royal Netherlands Institute for Sea Research; pers. comm.), the Florida Keys in (KMB, pers. obs.), and northern Gulf of Mexico in (Williams et al., 2001); notably, Drymonema was not reported from the southeastern United States by Mayer (1910) despite his considerable work in the Dry Tortugas beginning in 1897 (Stephens and Calder, 2006). The only records of mass occurrence of D. larsoni are from 1999-2000 in the Caribbean and Gulf of Mexico (Williams et al., 2001), though D. larsoni has since been present nearly annually in the northern Gulf of Mexico (KMB, pers. obs.).

Stiasny (1940a) proposed that the population dynamics of D. dalmatinum likely were linked with oceanographic patterns, although he considered the data at the time incomplete. The apparently tri-decadal periodicity of D. dalmatinum does exceed the 12-year cycles in abundance of Mediterranean Pelagia (Goy et al., 1989; Kogovsek et al., 2010), suggesting that the population dynamics of D. dalmatinum are not similarly tied to abiotic changes in rainfall, temperature, and atmospheric pressure. The difference may stem from interactions between abiotic signals and biological responses--notably, the life histories of the meroplanktonic D. dalmatinum and holoplanktonic P. noctiluca are quite distinct--or may indicate that biotic interactions alone are important in driving population dynamics. For example, the ontogenetic trophic shift in the life history of Drymonema may represent a "critical stage" (Hjort, 1914; cited by Stenseth et al., 2002), requiring the synchrony of population dynamics of at least three taxa--Drymonema, its early-stage prey, and the late-stage prey Aurelia. Theory predicts that competitive or predatory interactions between three or more taxa may result in cyclic population dynamics that are nonperiodic or change in period (e.g., May and Leonard, 1975; Hanski et al., 1991) and thus may appear irregular to human observers; interestingly, in addition to a common 12-year cycle, Kogovsek et al., (2010) report secondary multidecadal (30-45 years) cycles in Mediterranean scyphomedusae. Although seasonal blooms of Aurelia occur practically annually in the Caribbean (Williams et al., 2001), the very low assimilation efficiency of D. larsoni may demand a particularly close "match" (sensu Cushing 1975, 1984) with a peculiarly large population of Aurelia to support a Drymonema bloom. Such links between the demography of Drymonema species and atmospheric or oceanographic climatic cycles or trends (e.g., Brierley and Kingsford, 2009), other proposed causes of mass occurrences such as eutrophication or overfishing (Richardson et al., 2009), phenological shifts (Edwards and Richardson, 2004), and multi-species interactions remain to be investigated. Our description of D. larsoni does, however, refute the hypothesis that mass occurrence of Drymonema in the Caribbean is attributable to translocation of non-indigenous D. dalmatinum (cf. http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=2381, accessed 20 February 2010).

Reorganization of facts about Drymonema in a phylogenetic framework emphasizes how little we still know about this taxon. Yet, recognizing Drymonematidae as a new family, like recognition of cryptic species and infra-specific diversity (e.g., Dawson and Martin, 2001; Dawson, 2004), again challenges us to reconsider assumptions about scyphozoan diversity that are based on an old taxonomy that dramatically underestimates and oftentimes misrepresents scyphozoan biodiversity. Broad generalizations, such as the conservation of gelatinous zooplankton niches (Rigby and Milsom, 2000) or jellyfish benefiting from environmental change (Jackson, 2008), will have many exceptions (e.g., Mills, 2001; Dawson and Hamner, 2009). Scyphomedusae are far more taxonomically rich than traditionally thought, their biogeography a more detailed mosaic, and their phenotypes more nuanced; consequently, ecological and evolutionary responses to environmental change, past or future, are almost certainly commensurately diverse.

Acknowledgments

We thank D. DeMaria, E. Demir, T. Demir, M. Graham, H. Mianzan, M. Miller, and the Coral Reef Research Foundation for help with medusae collection. We acknowledge C. Lueter and A. Schwiering for assistance at ZMB, and A. Collins, P. Greenhall, and G. Keel for assistance at USNM. A. Benovic, F. Boero, A. Morandini, and S. Romano kindly recounted their sightings, or lack thereof, of Drymonema spp. We thank D. Calder for advice on taxonomic conventions. Discussions on macroecology and speciation with W. Hamner were the source of some of the ideas introduced in this manuscript. This work was funded by a National Science Foundation Revisionary Syntheses in Systematics grant (DEB-0717078) to M. Dawson and A. Collins.

Literature Cited

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402.

Antipa, G. R. 1892. Eine neue Art von Drymonema. Jen. Z. Naturwiss. 27: 337-339.

Arai, M. N. 1997. A Functional Biology of Scyphozoa. Chapman and Hall, London.

Bayha, K. M. 2005. The molecular systematics and population genetics of four coastal ctenophores and scyphozoan jellyfish of the U.S. Atlantic and Gulf of Mexico. Ph.D. dissertation, The University of Delaware, Newark.

Bayha, K. M., M. N. Dawson, A. G. Collins, M. S. Barbeitos, and S. H. D. Haddock. 2010. Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integr. Camp. Biol. 50: 436-455.

Brierley, A. S., and M. J. Kingsford. 2009. Impacts of climate change on marine organisms and ecosystems. Curr. Biol. 19: R602-614.

Calder, D. R. 2009. Cubozoan and Scyphozoan Jellyfishes of the Carolinian Biogeogruphic Province. Southeastern U.S.A. Royal Ontario Museum Contributions in Science, 3. Royal Ontario Museum. Ontario.

Cartwright P., S. L. Halgedahl, J. R. Hendricks, R. D. Jarrard, A. C. Marques, A. G. Collins, and B. S. Lieberman. 2007. Exceptionally preserved jellyfishes from the Middle Cambrian. PLoS ONE 2:el 121.

Cushing, D. H. 1975. The natural mortality of the plaice. J. Cons. Int. Explor. Mer 36: 150-157.

Cushing, D. H. 1984. The gadoid outburst in the North Sea. J. Cons. Int. Explor. Mer 41: 159-166.

Daly, M., M. Brugler, P. Cartwright, A. G. Collins, M. N. Dawson, S. C. France, D. G. Fautin, C. S. McFadden, D. M. Opresko, E. Rodriguez, S. L. Roman, and J. L. Stake. 2007. The phylum Cnidaria: A review of phylogenetic patterns and diversity three hundred years after Linnaeus. Zootaxa 1668: 127-186.

Dawson, M. N. 2003. Macro-morphological variation among cryptic species of the moon jellyfish, Aurelia (Cnidaria: Scyphozoa). Mar. Biol. 143: 369-379.

Dawson, M. N. 2004. Some implications of molecular phylogenetics for understanding biodiversity in jellyfishes, with an emphasis on Scyphozoa. Hydrobiologia 530/531: 249-260.

Dawson, M. N. 2005a. Cyanea capillata is not a cosmopolitan jellyfish: morphological and molecular evidence for C. annaskala and C. rosea (Scyphozoa, Semaeostomeae. Cyaneidae) in southeast Australia. Inverted. Syst. 19: 361-370.

Dawson, M. N. 2005b. Morphologic and molecular redescription of Catostylus mosaicus conservativus (Scyphozoa, Rhizostomeae, Catostylidae) from southeast Australia. J. Mar. Biol. Assoc. UK 85: 723-732.

Dawson, M. N. 2005c. Morphological variation and taxonomy in the Scyphozoa: Mastigias (Rhizostomeae, Mastigiidae)-a golden unstandard? Hydrobiologia 537: 185-206.

Dawson, M. N. 2005d. Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography and biogeography in south-east Australia. J. Biogeogr. 32: 515-533.

Dawson, M. N., and W. M. Hamner. 2009. A character-based analysis of the evolution of jellyfish blooms: adaptation and exaptation. Hydrobiologia 616: 193-215.

Dawson, M. N., and D. K. Jacobs. 2001. Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). Biol. Bull. 200: 92-96.

Dawson, M. N, and L. E. Martin. 2001. Geographic variation and ecological adaptation in Aurelia (Scyphozoa: Semaeostomeae): some implications, from molecular phylogenetics. Hydrobiologia 451: 259-273.

Dawson, M. N., K. A. Raskoff, and D. K. Jacobs. 1998. Preservation of marine invertebrate tissues for DNA analyses. Mol. Mar. Biol. Biotech. 7: 145-152.

Dawson, M. N., A. S. Gupta, and M. H. England. 2005. Coupled biophysical global ocean model and molecular genetic analyses identify multiple introductions of cryptogenic species. Proc. Natl. Acad. Sci. USA 102: 11968-11973.

Edwards, M., and A. J. Richardson. 2004. Impact of climate change on marine pelagic phenology and trophic mismatch. Nature 4356: 881-884.

Ender, A., and B. Schierwater. 2003. Placozoa are not derived cnidarians: evidence from molecular morphology. Mol. Biol. Evol. 20: 130-134.

Goy, J., P. Morand, and M. Etienne. 1989. Long-term fluctuations of Pelagia noctiluca (Cnidaria. Scyphomedusa) in the western Mediterranean Sea. Prediction by climatic variable. Deep-Sea Res. 1 36: 269-279.

Haeckel, E. 1880. System der Acraspeden. Zweite Halfte des System der Medusen. Verlag von Gustav Fischer, Jena. Pp. 361-672.

Haeckel, E. 1881. Report on the deep-sea medusae dredged by H.M.S. Challenger during the years 1873-1876. Report of the Scientific Results of the Voyage of the H.M.S. Challenger During Years 1873-1876 (Zoology) 12: 1-154.

Hagadorn, J. W., R. H. Dott and D. Damrow. 2002. Stranded on a Late Cambrian shoreline: medusae from central Wisconsin. Geology 30: 147-150.

Hamner, W. M., and M. N. Dawson. 2009. A review and synthesis on the systematics and evolution of jellyfish blooms: advantageous aggregations and adaptive assemblages. Hydrobiologia 616: 161-191.

Hanski, I., L. Hansson, and H. Henttonen. 1991. Specialist predators, generalist predators, and the microtine rodent cycle. J. Anim. Ecol. 60: 353-367.

Hjort, J. 1914. Fluctuations in the great fisheries of northern Europe viewed in the light of biological research. Rapp. P.-V. Reun. Cons. Int. Explor. Mer. 20: 1-228. (Cited in Stenseth et al., 2002.)

Holland, B. S., M. N. Dawson, G. L. Crow, and D. K. Hofmann. 2004. Global phylogeny of Cassiopea (Scyphozoa: Rhizostomeae): molecular evidence for cryptic species and multiple invasions of the Hawaiian Islands. Mar. Biol. 145: 1119-1128.

International Commission on Zoological Nomenclature. 1999. International Code of Zoological Nomenclature, 4th edition. Tipografia La Garangola, Padova.

Jackson, J. B. C. 2008. Ecological extinction and evolution in the brave new ocean. Proa Natl. Acad. Sci. USA 105: 11458-11465.

Kogovsek, T., B. Bogunovic, and A. Malej. 2010. Recurrence of bloom-forming scyphomedusae: wavelet analysis of a 200-year time series. Hydrobiologia 645: 81-96.

Kolosvary, G. 1937. Erdekes allatok az ezaki adriabol. A Tenger 1937, VII-IX [in Hungarian: Interesting animals of the Northern Adriatic; offprint of The Sea].

Kolosvary, G. 1945. Beitrage zur Kenntniss der adriatischen Coelenteraten auf Grund der Sammlung des Ung. Nat. Museum. Riv. Biol. Firenze 37: 139-142.

Kramp, P. L. 1959. Medusae, mainly from the west coast of Africa. Institut Royal des Sciences Naturelles de Belgique 3: 1-33.

Kramp, P. L. 1961. Synopsis of the medusae of the world. J. Mar. Biol. Assoc. U.K. 40: 1-469.

Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007. ClustalW and ClustalX version 2.0. Bioinformatics 23: 2947-2948.

Larson, R. J. 1987. First report of the little-known scyphomedusa Drymonema dalmatinum in the Caribbean Sea, with notes on its biology. Bull. Mar. Sci. 40: 437-441.

Longhurst, A. R. 2007. Ecological Geography of the Sea. Academic Press, Boston.

May, R. M., and W. J. Leonard. 1975. Nonlinear aspects of competition between three species. J. Appl. Math. 29: 243-253.

Mayer, A. G. 1910. Medusae of the World, III--the Scyphomedusae. Carnegie Institution of Washington, Washington, DC.

Mianzan, H. W., and P. F. S. Cornelius. 1999. Cubomedusae and Scyphomedusae. Pp. 513-559 in South Atlantic Zooplankton 1, D. Boltovskoy, ed. Backhuys Press, Leiden.

Mills, C. E. 2001. Jellyfish blooms: Are populations increasing globally in response to changing ocean conditions? Hydrobiologia 451: 55-68.

Muller, F. 1883. Drymonema an der Kuste von Brasilien. Zool. Anz. 6: 220-222.

Odorico, D. M., and D. J. Miller. 1997. Internal and external relationships of the Cnidaria: implications of primary and predicted secondary structure of the 5'-end of the 23S-like rDNA. Proc. R. Soc. Lond. B 264: 77-82.

Posada, D. 2008. jModelTest: Phylogenetic Model Averaging. Mol. Biol. Evol. 25: 1253-1256.

Rambaut, A. 2009. Figtree v. 1.2.3. [Online]. Available: http://tree.bio.ed.ac.uk/software/figtree/(2010, November 5).

Richardson, A. J., A. Bakun, G. C. Hays, and M. J. Gibhons. 2009. The jellyfish joyride: causes, consequences and management responses to a more gelatinous future. Trends Ecol. Evol. 24: 312-322.

Rigby, S., and C. V. Milsom. 2000. Origins, evolution, and diversification of zooplankton. Annu. Rev. Ecol. Syst. 31: 293-313.

Roduit, N. 2008. JMicroVision: Image analysis toolbox for measuring and quantifying components of high-definition images. Version 1.2.2. [Online]. Available: http://www.jmicrovision.com/oldRelease.htm (March, 2010).

Russell, F. S. 1970. The Medusae of the British Isles. II. Pelagic Scyphozoa with a Supplement to the First Volume on Hydromedusae. Cambridge University Press, Cambridge.

Segura-Puertas, L., L. Celis, and L. Chiaverano. 2009. Medusozoans (Cnidaria: Cubozoa, Scyphozoa and Hydrozoa) of the Gulf of Mexico. Pp. 369-379 in Gulf of Mexico Origin, Waters, and Biota, Vol. 1, Biodiversity, J. W. Tunnell, Jr., D. L. Felder, and S. A. Earle. eds. Texas A&M University Press. Corpus Christi.

Stenseth, N. C., A. Mysterud, G. Ottersen, J. W. Hurrell, K. S. Chan, and M. Lima. 2002. Ecological effects of climate fluctuations. Science 297: 1292-1296.

Stephens, L. D., and D. R. Calder. 2006. Seafaring Scientist--Alfred Goldsborough Mayor, Pioneer in Marine Biology. University of South Carolina Press, Columbia.

Stiasny, G. 1921. Studien uber Rhizostomeen. Pp. 1-178 in Capita Zoologica, E. D. van Oort, ed. Martinus Njhoff, Gravenhage, Netherlands.

Stiasny, G. 1931. Die Rhizostomeen-Sammlung des British Museum (Natural History) in London. Zool. Meded. 14: 137-178.

Stiasny, G. 1940a. Uber Drymonema dalmatina Haeckel. Zool. Jahrb. Anal. 66: 437-462.

Stiasny, G. 1940b. Die Scyphomedusen. Dana Rep. 18: 1-28.

Swofford D. L. 2003. PAUP--Phylogenetic Analysis Using Parsimony (* and Other Methods), ver. 4.0b10. Sinauer Associates, Sunderland, MA.

Wainwright, P. C., and S. M. Reilly. 1994. Introduction. Pp. 1-9 in Ecological Morphology--Integrative Organismal Biology, P. C. Wainwright and S. M. Reilly, eds. University of Chicago Press, Chicago.

Williams, E. H., .Jr., L. Bunkley-Williams, C. G. Lilyestrom, R. J. Larson, N. A. Engstrom, E. A. R. Ortiz-Corps, and J. H. Timber. 2001. A population explosion of the rare tropical/subtropical purple sea mane, Drymonema dalmatinum, around Puerto Rico in the summer and fall of 1999. Caribb. J. Sci. 37: 127-130.

Willoughby, R. H., and R. A. Robison. 1979. Medusoids from the Middle Cambrian of Utah. J. Paleontol. 53: 494-500.

Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion, Ph.D. dissertation, the University of Texas at Austin.

KEITH M. BAYHA *, [dagger] AND MICHAEL N DAWSON

School of Natural Sciences, University of California at Merced, 5200 North Lake Road, Merced, California 95343

Received 23 March 2010; accepted 29 October 2010.

* To whom correspondence should be addressed. Email: kbayha@disl.org

[dagger] Current address: Dauphin Island Sea Lab, 101 Bienville Boulevard, Dauphin Island, AL 36528.
COPYRIGHT 2010 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Bayha, Keith M.; Dawson, Michael N.
Publication:The Biological Bulletin
Article Type:Report
Geographic Code:1USA
Date:Dec 1, 2010
Words:9204
Previous Article:Spikey bivalves: intra-periostracal crystal growth in anomalodesmatans.
Next Article:Refuge from predation, the benefit of living in an extreme acidic environment?
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters