Printer Friendly

Neutralizing Potential of Fab IgG Hybrid Antibody Against Dengue Virus (DENV-1,2,3,4) Expressed on Mesenchymal Stem Cells/Mezenkimal Kok Hucreler Uzerinde Dengue Virusune Karsi (DENV-1,2,3,4) Fab IgG Hibrit Antikorunun Notralize Edici Potansiyeli.

Introduction

Dengue virus, a single stranded RNA virus, has four serotypes with different properties and a homology of 60%-70%. In Indonesia, Dengue virus-infected-humans were found in 1968 in Jakarta and Surabaya, Java Island. Dengue then spread into all provinces. Dengue virus was primarily found in rural areas of Indonesia and in densely populated areas predominantly with serotypes 1, 2, and 3. In recent years, however, four serotypes were found in all provinces (Sumarmo, 1987; Putnak, 2003; Ong et al., 2008). Dengue virus has structural and non-structural proteins, like envelope protein (E), pre-membrane protein (PrM), non-structural proteins (NS1, NS3, and NS5) that can induce humoral immune response (Henchal and Putnak, 1990; Putnak et al., 2003). Dengue virus recognizes the target cell using E protein containing epitopes that can bind to the receptors of superficial membrane on the cell. Then, the RNA virus penetrates the cytoplasm of the target cell followed by the transcription, translation, and multiplication of the Dengue virus, a late stage of which releases from the cell. (Lai, et al., 2008). Although Dengue virus has properties with relative stability, in between serotypes has been found easy to displace. This caused the dominant serotype to replace the other serotype (Yamanaka, et al., 2011). Dengue virus has preferential affinity to dendritic cells and Langerhans cells and can produce permissive infection only by immature cells. Interferon types 1 and 2 play an important role during infection (Wu, et al., 2000; Sarathy et al., 2015).

Human infections by Dengue viruses have been increasing every year, especially in all provinces of Indonesia and in different countries with different serotypes (Ong, et al., 2008). Besides population density or environment, the other problem is that it is still difficult to find an effective antiviral agent for the treatment of Dengue virus infections, and vaccine development is still under investigation (Fried, et al., 2010). Dengue virus has four serotypes and each have different properties. Some of their proteins can induce protecting antibodies but do not constitute cross protection (Rothman, et al., 2010). On the other hand, during infections, immunoglobulins (Ig) play an important role in protecting people against infection. In this context, immunoglobulin G (IgG) has a special property as a neutralizing antibody in the Dengue virus infection. IgG antibodies are generated following class switching and maturation of the antibody response and thus participate predominantly in the secondary immune response (Meulenbroek and Zeijlmer, 1996; Rantam, et al., 2013). Based on these arguments, the IgG can be used for hyper immune therapy. This research was designed to produce IgG under an expression system using rat bone marrow mesenchymal stem cells (ratBMMSCs, Wistar rat strain). IgG can be secreted as a monomer that is small in size allowing it to easily perfuse tissues. IgG has a molecular weight of about 150 kDa and is made up of four peptide chains. It has two kinds of identical light chains which are 50 kDa and 25 kDa. Thus, a tetrameric quaternary structure makes it very easy to recognize Dengue virus epitopes with serotype specificity (Bielifeldt-Ohmann, et al., 2001). As such, extracted IgG hybrids can be used for the therapy of future Dengue virus infections. This research serves to express the fragment gene coded VL and VH of the FabIgG antibody in rat bone marrow mesenchymal stem cells (ratBM-MSCs).

Materials and Methods

This study was performed in the DHF Laboratory, Institute of Tropical Disease and Stem Cell Research and Development Center in 2015 and 2016 at Airlangga University, Surabaya, Indonesia. The Dengue virus was from DHF Laboratory, Institute of Tropical Disease Airlangga University, strain ITD UNAIR serotype 1,2,3 and 4.

Mesenchymal stem cells

The bone marrow mesenchymal stem cells (ratBMMSCs) were isolated from the short-term culture of the Wistar rat bone marrow. We performed stem cell isolation from the Wistar rat bone marrow in the stem cell laboratory of Airlangga University under the supervision of the animal ethics team of the veterinary faculty of Airlangga University. To maintain these cells, they were cultured using [alpha]-MEM (GIBCO, 12000-022) with 10% Fetal Bovine Serum (FBS) (GIBCO, 10270-106) (Rantam, et al., 2009). After seven passages, these cells were used to express a model of the FabIgG hybrid. F the reactivity assay of the hybrid product to DENV-1,2,3,4, vero cells (kindly supplied from Dr. Eric Van Gorp, Institute of Viroscience, Erasmus Medical Center, Rotterdam University) were used.

Primers

Fusion fragment genes of each Fab-VH and LH of IgG to E protein of DENV-1, 2, 3, and 4 were prepared by PCR methods using various specific primers. Our primer design with reference from NCBI with access number ab073322 for heavy chain and bc094049 for light chain, using BLAST primer at NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 1). For Fab-IgG, amino acids 200 residue was amplified from the lymphocytes of mice, which were immunized by mixing (70% adjuvant, 20% antigen, 10% water) the inactive virus strain ITD UNAIR serotype 1, 2, 3 and 4 with [Montanide.sup.TM] ISA 70 VG adjuvant (SEPPIC).

Construction of transfer vector for fusion of heavy and light chains' antibody genes

The template encoding the chimeric construct was selectively amplified using external primers (T3 Promoter, Forward primer GCAATTAACCCTCACTAAAGG, T7 promoter, forward primer TAATACGACTCACTATAGGG, T7 terminator, reverse primer GCTAGTTATTGCTCAGCGG). Each primer contains appropriated restriction sites (Amp and tet) for sub cloning into the GC5 vector as competent cells. The resulting PCR fragment genes were ligated into the pBR322 (Geneon, Germany, G30-325), and transferred into ratBMMSCs, which were selected. Next, the hinge, CH2 and CH3 domains (amino acid 200 residue) of rat FabIgG were amplified by RT-PCR from cells ratBMMSCs, using the following primers FGH1 and RGH1, as shown in Tabel 1. This PCR product was cloned and inserted into ratBMMSc by using the method modified from Liang and others (1997).

Purification of hybrid FabIgG

A modified method (Kihira and Aiba 1992; Leickt, et al., 1998; Huse, et al., 2002) was used to purify the FabIgG hybrid. Briefly, after the centrifugation of the supernatant of lysed cells at 20,000 x g (13,000 rpm in SS-34 rotor) at 4[degrees]C, the supernatant was filtered using a 0.45-[micro]m filter. Then, the pH of the MAb supernatant was adjusted to 8.0 by dialyzing against PBS using dialysis tubing (Serva, 44144.01). In the meantime, the protein A-Sepharose column was prepared and attached to the fraction collector, and then the column was equilibrated with PBS, pH 8.0, at room temperature. A layer antibody solution was washed into the resin bed column with several volumes of PBS, pH 8.0. It was then eluted with 0.1 M citric acid at pH 6.5. The eluent was collected in vials and dialyzed against PBS, pH 7.3 and was then used for analysis.

Enzyme linked immunosorbent assay (ELISA)

This method was used to analyze the antibody titer of the secreting FabIgG hybrid. After coating the ELISA plate with the Dengue virus antigen [10.sup.7], with each volume well at 100[micro]l, the plate was then incubated for 24 hour at 4[degrees]C. It was then washed three times with PBS containing 0.05% Tween 20 (PBS-T) and blocked with PBS-T containing 3% of skimmed milk for 1 hour at room temperature. After washing it three times with PBS-T, 100 [micro]L of the two fold dilutions of ratBMMSc culture supernatants were added to the wells. The plates were then incubated for 1 hour at 37[degrees]C and washed four times with PBS-T. In the next step, 100 [micro]L of 1:1600 dilution of HRP conjugated antimouse FC specific antibody (Invitrogen, 31430). The plate was then incubated for 1 hour at 37[degrees]C. After washing, 100 [micro]L of substrate (Invitrogen, 31430) was added and incubated at room temperature for 15 min. Finally, the absorbance was measured using an ELISA reader at 450 nm (Immuno Mini NJ-2300) (Chu, et al., 1994).

Immunoprecipitation of the FabIgG hybrid binding to E protein of Dengue virus

The immunoprecipitation was used to analyze reactivity between the epitop and the FabIgG hybrid expressed on ratB-MMSCs. Briefly, about 2x[10.sup.7] cells in 0.5 ml DMEM were on ice for 1 hour to maintain cells so as not to fragment. Then, cells were washed with PBS and lysed by 0.5 ml of ice using an NP-40 lysis buffer (50 mM Tris-buffer pH 7.4, 250 mM NaCl, 5mM EDTA, 0.1% NP-40, plus protease inhibitors) (Merck). After removing the insoluble cell debris by microcentrifugation (11,500 rpm for 1 hour at 4[degrees]C), the FabIgG hybrids were precipitated by protein G conjugated sheparose beads (Amersham Bioscience, 212-006-168) overnight. The beads were then washed with PBS and re-suspended with a loading buffer containing 0.1M DTT, and heated for 10 min at 75[degrees]C. They were then resolved in 10% Nu-PAGE (Invitrogen, NP0001) with a Morpholinepropanesulfonic acid (MOPS) running buffer. Finally, the FabIgG hybrid was mixed with a whole antigen of Dengue virus (strain ITD UNAIR serotype 1, 2, 3 and 4) and after that was immunoprecipitated with an anti-FabIgG hybrid (Yoshida, et al., 2010).

Neutralizing of FabIgG hybrid to E protein in cell culture

Neutralization assay was performed to determine the neutralizing capacity of purified the FabIgG hybrid. Briefly, the FabIgG hybrid was incubated with [10.sup.3] PFU of the whole Dengue virus (strain ITD UNAIR, DENV-1, 2, 3 and 4). A mixture of the FabIgG hybrid and the virus were diluted equally with a ratio of 300[micro]l After a 1-hour incubation at room temperature, they were then inoculated to the cell target by ratBMMSc derived from bone marrow stem cells, followed by another incubation at 37[degrees]C in a 5% C[O.sub.2] incubator for one hour. After the removal of the medium, a growth medium was added and incubated for 6 days at 37[degrees]C in a 5% C[O.sub.2] incubator. Finally, Dengue viruses released from infected cells were detected by indirect ELISA using conjugated FabIgG labeled with HRP (Invitrogen, SA5-10226). These activities were analyzed using a binding index of virus to ratBMSCs, and used Immunoassay. Abstractly cells were infected by strain ITD UNAIR Dengue virus; all serotype then reactivated using hybrid immunoglobulin and then staining using HRP (Pauli, et al., 1984). The neutralizing ability was used and compared with vero cells as positive control.

Results

Characterization of Bone Marrow - Mesenchymal Stem Cells (ratBMMSCs)

The ratBMMSCs cells were expanded in the Petri dish until they grow confluents about 90% as seen in Figure 1 and were characterized using CD105. The results were seen as in Figure 2: a characterization using CD105 was done to make sure the cell was a stem cell because CD105 are cell surface markers for Mesenchymal Stem Cells. The PCR product of the gene coded Fab-IgG as well, as in Figure 3, and showed 600 bp that were used to design the FabIgG hybrid expressed in ratBMMSCs.

The cloning product of the gene fragment of FabIgG DENV 1, 2, 3 and 4 was inserted into the plasmid pBR322, and was then transfected into ratBMMSc cells by using electrophorator. The results of FabIgG expression are shown in Figure 4.

The results of the purification of the FabIgG hybrid, those expressed in ratBMMSCs and analyzed using a western blot are shown in Figures 4A, B and C. The FabIgG hybrid showed a nearly identical pattern of protein bands under reduced conditions. The protein was found to have a molecular weight of 52 kDa, and seemed like a dominant band, which likely represents the monomer of the FabIgG hybrid in Figure 5.

Based on the reactivity of the FabIgG hybrid of DENV-1, 2, 3 and 4 to E protein, we designed an analysis on the neutralization effect of the FabIgG hybrid expressed using the ratBMMSCs model. The results suggested that the FabIgG hybrid can neutralize the Dengue virus serotypes 1, 2, 3 and 4 infected with ratBMMSCs. The whole of the reduction plaque neutralization test (PNRT) potential of IgG hybrid in cells is shown in Figure 6 and Figure 7.

Discussion

In this study, we characterize the ratBMSCs as shown in Figure 2, and the generated transformed ratBMMSCs that expressed the immunoglobulin (FabIgG) hybrid specific serotype of DEN-1, 2, 3, 4 as shown in Figure 1. The prototype of the hybrid showed that the coding gene of VH and LH immunoglobulin were cloned and ligated with others, that we called the FabIgG hybrid, but the mechanism of integration of genes into the ratBMMSc cells genome was not characterized. Although, the genome of ratB-MMSCs may enhance transcription, thereby improving the yield of foreign proteins obtained from transformed cell cultures.

The other tests performed in this research demonstrated a molecule of FabIgG using SDS-PAGE 12% with a molecular weight of 52 kDa as seen in Figure 4. They then analyzed the reactivity of the hybrid using Western blotting as shown in Figure 5. This reactivity showed that the FabIgG hybrid has a good function since the immunoglobulin hybrid can capture antigens of Dengue virus. These properties of the FabIgG hybrid can recognize antigen especially envelope (E) of all Dengue virus serotypes, because they were designed four hands powerful to capture of different serotypes like in Figure 6. That means these hybrids have potential for the development of passive vaccines for all serotypes of Dengue virus. However, the envelope (E) protein is a major antigen for inducing protective antibody (Ab) responses (Halstead, 1998; 2003) and can avoid the risk of Antibody-Dependent Enhancement (ADE). The strength of both molecule binding sites is in the Fab of variable heavy (VH) and light (VL). This way, they have the possibility of a very easy way to build an interaction with an antigen-antibody complex, which will stimulate immediate reactivity of macrophage to opsonisation. Then, peptide expression will follow on the superficial membrane cell through the major histocompatability complex I (MHC I), and then induce cell-mediated immune response through an endogenous process (Kehry and Castle, 1994). This mechanism may play an important role as a basic how-to design for a preventive model like a blocking agent (de Carvalho Nicacio, et al., 2000; Gigler et al., 1999; Gould et al., 2005).

If we compare the FabIgG hybrid and the active vaccine tetravalent, the hybrid cannot induce polyclonal antibodies, nor generate an immune system. The hybrid FabIgG, however, have to neutralize viral infections by binding to epitops of E protein of Dengue virus. This model has two kinds of functions. The first is a signaling of complex proteins to activation of cellular and humoral immune response through expression of tool-like receptors (TLR) on the surface membrane of macrophage. This pathway can usually provoke the activation of the [CD4.sup.+] T cell through MHC-II of antigen presenting cells (APC). Secondly, it can be used as neutralizing agent to prevent viral infection. Although, the effectiveness of the hybrid FabIgG is still in trial for certain pathogens (like HIV and Salmonella) (Abaitua, et al., 2006; Tagliabue and Rappuoli, 2008).

The results of the ability of the FabIgG hybrid in neutralizing have shown that the hybrid is good at working with this cell, although the neutralizing level still less then using polyclonal antibodies (data not shown). Based on this data, there is still a need to establish a hybrid model expression using a ratB-MMSCs cell system, although we have seen that they can work very well. On the other hand, the goal in this study here would be to provide an antibody that can protect immediately, although all theFabIgG hybrids show similar protective effects at local infection sites or in DENV-infected cell culture.

In conclusion, we have shown in this study that the neutralizing effect provided by the FabIgG hybrid against Dengue virus-infected rat bone marrow mesenchymal stem cell (ratBMMSCs) model do not cross-react with uninfected mesenchymal stem cells. Our findings suggest that the FabIgG hybrid may be an attractive strategy for developing a vaccine against Dengue virus as well as passive vaccine.

Acknowledgements: We are grateful to Dr. Eric Van Gorp, for helpful discussions and for providing Vero cells. Also to our team at Stem Cell Research and Development Center, Laboratory of DHF, Institute of Tropical Disease (ITD). This work was supported by grants from the RUPT Airlangga University (DIPA Ditlitabmas at 2015 No. 519/UN3/2015, March, 26, 2015 and No.018/SP2H/LT /DRPM/II/2016, February, 17, 2016.

References

Abaitua F., Rodriguez, J.R., Garzon, A., Rodriguez, D., Esteban, M. 2006. Improving recombinant MVA immune responses: potentiation of the immune responses to HIV-1 with MVA and DNA vectors expressing Env and the cytokines IL-12 and IFNgamma. Virus Res 116, 11-20. [CrossRef]

Bielefeldt-Ohmann, H., Meyer, M., Fitzpatrick, D.R., Mackenzie, J.S. 2001. Dengue virus binding to human leukocyte cell lines: receptor usage differs between cell types and virus strains. Virus Res 73(1), 81-9. [CrossRef]

Champion, J.M., Kean, R.B., Rupprecht, C.E., Notkins, A.L., Koprowski, H., Dietzschold, B., Hooper, D.C. 2000. The development of monoclonal human rabies virus-neutralizing antibodies as a substitute for pooled human immune globulin in the prophylactic treatment of rabies virus exposure. J. Immunol. Methods 235, 81-90. [CrossRef]

Chu., Y.K., Rossy, C., LeDuc, J.W., Lee, H.W., Schmaljohn, C.S., Dalrymple. 1994. Serological relationship among virus in the hanta virus genus family bunyaviridae virology 198, 196-204

Crameri, R., 2007. Allergy vaccines: dreams and reality. Expert Rev Vaccines 2007 Dec; 6(6), 991-9. [CrossRef]

de Carvalho Nicacio, C., Lundkvist, A., Sjolander, K.B., Plyusnin, A., Salonen, E.M,. Bjorling, E. 2000. A neutralizing recombinant human antibody Fab fragment against Puumala hantavirus. J Med Virol 60, 446-454. [CrossRef]

Fried, J.R., Gibbons, R.V., Kalayanarooj, S., Thomas, S.J., Srikiatkhachorn, A., Yoon, I.K., Jarman, R.G., Green, S., Rothman, A.L., Cummings, D.A. 2010. Serotype-specific differences in the risk of dengue hemorrhagic fever: an analysis of data collected in Bangkok, Thailand from 1994 to 2006. PLoS Negl Trop Dis 4(3), e617. [CrossRef]

Gigler A., Dorsch, S., Hemauer, A., Williams, C., Kim, S., Young,N.S., Zolla-Pazner, S., Wolf, H., Gorny M.K., Modrow, S. 1999. Generation of neutralizing human monoclonal antibodies against parvovirus B19 proteins. J Virol 73, 1974-1979.

Gould, L.H., Sui, J,. Foellmer, H., Oliphant, T., Wang, T., Ledizet, M., Murakami, A., Noonan, K., Lambeth, C., Kar, K., Anderson, J.F., de Silva, A.M., Diamond, M.S., Koski, R.A., Marasco, W.A., Fikrig, E. 2005. Protective and therapeutic capacity of human single-chain Fv-Fc fusion proteins against West Nile virus. J Virol 79, 14606-14613. [CrossRef]

Halstead, S.B. 1998. Pathogenesis of dengue: challenges to molecular biology. Science 239, 476-481. [CrossRef]

Halstead, S.B. 2003. Neutralization and antibody-dependent enhancement of dengue viruses. Adv Virus Res 60, 421-467. [CrossRef]

Henchal, E.A., Putnak, J.R. 1990. Dengue viruses. Clin Microbiol Rev 3, 376-396. [CrossRef]

Huse, K., Bohme, H.J., Scholz, G.H. 2002. Purification of antibodies by affinity chromatography. Journal of Biochemical and Biophysical Methods 51(3), 217-231. [CrossRef]

Kehry, M.R., Castle, B.E. 1994. Regulation of CD40 ligand expression and use of recombinantCD40 ligand for studyingBcell growth and differentiation. SeminImmunol 6, 287-294. [CrossRef]

Kihira, Y., Aiba, S. 1992. Artifical immunoglobulin G-binding protein mimetic to staphylococcal protein A. Its production and application to purification of immunoglobulin G. J Chromatogr B: Biomed Sci Appl 597, 277-283.

Lai, C.Y., Tsai, W.Y., Lin, S.R., Kao, C.L., Hu, H.P., King, C.C., Wu, H.C., Chang, G.J., Wang, W.K. 2008. Antibodies to envelope glycoprotein of dengue virus during the natural course of infection are predominantly cross-reactive and recognize epitopes containing highly conserved residues at the fusion loop of domain II. J Virol 82(13), 6631-6643. [CrossRef]

Leickt, L., Grubb, A., Ohlson, S. 1998. Screening for weak monoclonal antibodies in hybridoma technology. J Mol Recognit 11(1-6), 114-116. [CrossRef]

Liang, W.Q., Fournier, M.J. 1997. Synthesis of functional eukaryotic ribosomal RNAs in trans: development of a novel in vivo rDNA system for dissecting ribosome biogenesis. Proc Natl Acad Sci USA 94, 2864-2868. [CrossRef]

Meulenbroek, A.J., Zeijlemaker, W.P. 1996. Human IgG subclasses: useful diagnostic markers for immunocompetence. Amsterdam CLB, 1-51.

Ong, S.H., Yip, J.T., Chen, Y.L., Liu, W., Harun, S., Lystiyaningsih, E., Heriyanto, B., Beckett, C.G., Mitchell, W.P., Hibberd, M.L., Suwandono, A., Vasudevan, S.G., Schreiber, M.J. 2008. Periodic re-emergence of endemic strains with strong epidemic potential-a proposed explanation for the 2004 Indonesian dengue epidemic. Infect Genet Evol 8(2), 191-204. [CrossRef]

Pauli, G., Gregersen, J-P., Ludwig, H. 1984. Plaque/ focus immunoassay: a simple method for detecting antiviral monoclonal or other antibodies and viral antigens in cell. J Immunol Methods 74, 337-344. [CrossRef]

Putnak, R., Fuller, J., Vander Zanden, L., Innis, B.L., Vaughn, D.W. 2003. Vaccination of rhesus macaques against dengue-2 virus with a plasmid DNA vaccine encoding the viral pre-membrane and envelope genes. Am J Trop Med Hyg 68(4), 469-476.

Rantam, F.A., Purwati, Soegijanto, S., Susilowati, H., Sudiana, K., Hendrianto, E., Soetijipto. 2013. Analysis of recombinant, multivalent dengue virus containing envelope (E) proteins from serotypes - 1, - 3, and - 4 and expressed in baculovirus. Trials Vaccinol DOI: 10.1016/j.trivac.2013.10.001. [CrossRef]

Rantam, F.A., Ferdiansyah, Nasronudin, Purwati. 2009. Stem Cell Exploration. Airlangga University Press, Surabaya, 70-75.

Rothman, A.L. 2010. Cellular immunology of sequential dengue virus infection and its role in disease pathogenesis. Curr Top Microbiol Immunol 338, 83-98. [CrossRef]

Sarathy, V.V., White, M., Li, L., Gorder, S.R., Pyles, R.B., Campbell, G.A., Milligan, G.N., Bourne, N., Barrett, A.D. 2015. A lethal murine infection model for dengue virus 3 in AG129 mice deficient in type I and II interferon receptors leads to systemic disease. J Virol 89(2), 1254-1266. [CrossRef]

Sui, J., Li, W., Roberts, A., Matthews, L.J., Murakami, A., Vogel, L., Wong, S.K., Subbarao, K., Farzan, M., Marasco, W.A. 2005. Evaluation of human monoclonal antibody 80R for immunoprophylaxis of severe acute respiratory syndrome by an animal study, epitope mapping, and analysis of spike variants. J Virol 79, 5900-5906. [CrossRef]

Sumarmo, 1987. Dengue haemorrhagic fever in Indonesia. Southeast Asian J Trop Med Public Health 18, 269-274.

Tagliabue, A., Rappuoli, R. 2008. Vaccine adjuvants: the dream becomes real. Hum Vaccine 4, 347-349. [CrossRef]

Wu, S.J., Grouard-Vogel, G., Sun, W., Mascola, J.R., Brachtel, E., Putvatana, R., Louder, M.K., Filgueira, L., Marovich, M.A., Wong, H.K., Blauvelt, A., Murphy, G.S., Robb, M.L., Innes, B.L., Birx, D.L., Hayes, C.G,. Frankel, S.S. 2000. Human skin Langerhans cells are targets of dengue virus infection. Nat Med 6(7), 816-820. [CrossRef]

Yamanaka, A., Mulyatno, K.C., Susilowati, H., Hendrianto, E., Ginting, A.P., Sary, D.D., Rantam, F.A., Soegijanto, S., Konishi, E. 2011. Displacement of the predominant dengue virus from type 2 to type 1 with a subsequent genotype shift from IV to I in Surabaya, Indonesia 2008-2010. PLoS One 6, e27322. [CrossRef]

Yokoyama, T., Ayabe, S., Miyagi, H., Sugano, T., Otsu, A., Sato, H., Kageyama, S., Fujii, T., Shiraki, K. 2001. Varicella-zoster virus gH:gL contains a structure reactive with the anti-human gamma chain of IgG near the glycosylation site. J Gen Virol 82, 331-334. [CrossRef]

Yoshida, T., Yoshida, R., Ma, B.Y., Mikolajczak, S., Kelvin, D.J., Ochi. A. 2010. A novel mitogen fusion protein against CD40+ cells with potent vaccine adjuvant properties. Vaccine 28(21), 3688-3695. [CrossRef]

Fedik A. RANTAM (1,2,3) [iD], Rahaju ERNAWATI (1) [iD], Jola RAHMAHANI (1) [iD], Eryk HENDRIANTO (2,3) [iD], Helen SUSILOWATI (2,3) [iD], Rofqul A'LA (4,5) [iD], Rizki Kriestya MAYASARI (4) [iD], Lia Nur AINI (4) [iD]

(1) Virology and Immunology laboratory, Dep of Microbiology, Faculty of Vet Med. Airlangga University, Surabaya, Indonesia

(2) Stem Cell Research and Development Center, Airlangga University, Surabaya, Indonesia

(3) Dengue Hemorrhagic Fever (DHF) Laboratory, Institute of Tropical Disease, Airlangga University, Surabaya, Indonesia

(4) Vaccinology and Immunotherapeutica, Faculty of Veterinary Medicine, Airlangga University, Surabaya, Indonesia

(5) Institute of Animal and Plant Quarantine, General Director of Animal Service, Ministry of Agriculture, Indonesia

Cite this article as: Rantam, F.A., Ernawati, R., Rahmahani, J., Hendrianto, E., Susilowati, H., A'la, R., Mayasari, R.K., Aini, L.N., 2018. Neutralizing Potential of Fab IgG Hybrid Antibody Against Dengue Virus (DENV-1,2,3,4) Expressed on Mesenchymal Stem Cells. Acta Vet Eurasia 44: 12-19.

ORCID IDs of the authors: F.A.R. 0000-0001-8182-1465; R.E. 0000-0002-9371-7953; J.R. 0000-0001-9103-3200; E.H. 0000-0001-9723-8098; H.S. 0000-0002-3358-5231; R.A. 0000-0001-6057-2287; R.KM. 0000-0001-9309-5026; L.N.A. 0000-0002-3465-9618.

Address for Correspondence: Fedik A. RANTAM * E-mail: fedik.ar@gmail.com

Received Date: 31 December 2016 * Accepted Date: 04 December 2017 * DOI: 10.5152/actavet.2018.004
Table 1. Primers used to amplify the gene-coded immunoglobuline G

Code         Sequence nucleotide

Forward (F)  5'-TGGGGGTTCTCTGAGTCTCTC-3'
Reverse (R)  3'- CAGCTCTCAGGGCATTCATT-5'-
FGH1         5'-AGGTTCAGCTTCAGCAGTCT-3'
RGH1         3'-CGTAGTAAAAATCCTTTGAACAGTA-5'
FGH2         5' TGAAGAACTCTGCCGTCTATT-3'

RGH2         3'-GCACAATTTTCTTGTCCACT-5'
FGL1         5'-GTACCATCTTCCCACCATC-3'
RGL1         3'-CTCATTCCTGTTGAAGCTCT-5

FGL2         5'- GTCCAGTCAGAGCCTTTTAT-3'
RGL2         3'- TGGGGTAGAAGTTGTTCAAG-5'
FGL3         5'- GCCCAGGTTCTTATGTTACT-3'
RGL3         3'- GAGAGTGAAATCTGTCCCAG-5'.
FGH1         5'-AGGTTCAGCTTCAGCAGTCT-3'
RGH1         3' CGTAGTAAAAATCCTTTGAACAGTA-5'

Code         Function

Forward (F)  Primers for synthesis of cDNA
Reverse (R)
FGH1         Primers specific for heavy chain
RGH1
FGH2

RGH2
FGL1         Primers specific for light chain
RGL1

FGL2
RGL2
FGL3
RGL3
FGH1         Primers for second round PCR
RGH1

Table 2. Neutralizing activity of the FabIgG hybrid to all Dengue virus
serotypes

                                             Focus Forming Unit
Reagent                            Dilution  (FFU) (mean of reduction)

Vaccinated positive control serum  1:1         0 (100)
Negative control serum             1:1       100 (0)
The FabIgG hybrid                  1:1         0 (100)
                                   1:2        10
                                   1:4        21
                                   1:8        41
                                   1:16       81

Data Focus Forming Unit assay using Dengue virus serotypes 1, 2, 3, and
4 have shown the average of duplicate assays. The FabIgG hybrid was
diluted as shown in Table 2.
COPYRIGHT 2018 AVES
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Rantam, Fedik A.; Ernawati, Rahaju; Rahmahani, Jola; Hendrianto, Eryk; Susilowati, Helen; A'La, Rofq
Publication:Journal of the Faculty of Veterinary Medicine
Date:Jan 1, 2018
Words:4307
Previous Article:In Vitro Assessment of Milk Thistle Seeds as a Natural Anti-Aflatoxin [B.sub.1]/Meryemana Dikeni Tohumlarinin Dogal Anti-Aflatoksin [B.sub.1] Olarak...
Next Article:Genetic Diversity of Tendurek Mouflon Population/Tendurek Muflon Populasyonunun Genetik Cesitliligi.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters