Printer Friendly

NF-[kappa]B dependent anti-inflammatory activity of chlorojanerin isolated from Saussurea heteromalla.

ABSTRACT

Medicinal plants have shown great promise as a source of novel drug compounds for the treatment of inflammatory disorders. In our search for new entities with anti-inflammatory potential, the extracts of the whole plant of Saussureci heteromaula (family-Asteraceae), collected from Himalayas, were evaluated in the high throughput screen for TNF-[alpha] and IL-6 inhibitors. The extract blocked TNF-[alpha] and 1L-6 production in LPS stimulated THP-l cells (human acute monocyte leukemia cell line) completely at 10 and 30 [mu]g/mL. The plant has been found as a new source of chiorojanerin, a guaianolide type of sesquiterpene lactone. Chiorojanerin was shown to be significantly effective in inhibiting TNF- and IL-6 production in LPS-stimulated THP-1 cells ([IC.sub.50] = 2.3 [+ or -] 0.2 [mu]M and 1.8 [+ or -] 0.7 [mu]M respectively). The compound also blocked TNF-a and IL-6 production from LPS-stimulated human monocytes (IC50 = 1.5 [+ or -] 0.4 and 0.7 [+ or -] 0.2 1iM respectively) and synovial cells from a patient with rheumatoid arthritis ([IC.sub.50] <0.03 and 0.5 [mu]M respectively). Transcriptional profiling of the LPS stimulated THP-1 cells revealed that chiorojanerin exerted its anti-inflammatory effect by inhibiting the expression of 8 genes involved in activating the transcription factor -- NF-KB. Real time analysis of these genes validated the effect of chiorojanerin on the classical downstream targets of NF-KB. Thus, this study clearly delineated 8 genes which were specifically mitigated due to the effect of chlorojanerin on NF-KB induced signaling at the mRNA level. Further, chlorojanerin at 5 [mu]M also inhibited the binding of NF-KB in a GFP reporter assay system by 55.5% thus validating the microarray gene expression data. This work is a step towards the isolation and characterization of lead anti-inflammatory agents from the extract of Saussurea heteromaula, which can be developed into better therapeutic molecules targeted towards some specific inflammatory diseases.

[R] 2012 Elsevier GmbH. All rights reserved.

ARTICIE INFO

Keywords: TNF-[alpha] IL-6 N F-KB Saussurea heterornalla Inflammatory disorders

Introduction

The genus Saussurea DC. (Family - Asteraceae), comprising of about 410 species, is a native of cooler regions of North America, Europe and Asia with the highest diversity in the Himalayas and central Asia. Saussurea heteromalla (D. Don) Hand.-Mazz is found in the Shivalik ranges in the foothills of Himalayas (Saklani and Rao 2000). Saussurea costus (Falc.) Lipschitz, is widely used in Ayurveda. The crude ethanolic extract of the plant reduces inflammation and the sesquiterpene fraction of the extract reduces several molecular markers of inflammation (Adhikari et al. 2010; Pandey et al. 2007). Hence, we decided to explore the anti-inflammatory potential of this extract.

Clinical inflammatory conditions such as RA, colitis, psoriasis are attributed to the exacerbate expression of cytokines like tumor necrosis factor-alpha (TNF-[alpha]) and interleukin-6 (IL-6) (Feldmann et al. 1996). Human inflammatory disorders such as autoimmunity, rheumatoid arthritis and sepsis are characterized by a dysregula-tion of the pro-versus anti-inflammatory cytokine balance dictated by proliferation and activation of T helper (Th) 1 versus Th2 cells. These immune dysfunctions play a role in the pathogenesis of atopic/allergic and autoimmune diseases, obesity, depression, and atherosclerosis. Since the discovery of TNF-[alpha] antibody for the treatment of RA (Feldmann et al. 1996) biologists are targeting TNF-[alpha] to reduce inflammatory reactions in the body and restore the cytokine balance. Tociluzumab, a humanized anti-IL-6 receptor antibody has achieved a very good ACR70 response in human clinical trials for RA (Smolen and Maini 2006). Thus, anti-IL-6 treatment is also considered an important strategy for therapeutic intervention. The clinical success of these anti-cytokine strategies has increased the focus of pharmaceutical drug discovery on targeting TNF-[alpha] and IL-6 to identify small molecule inhibitors of these cytokines (Kulkarni-Almeida et al. 2008).

In the present work, the effect of the Saussurea heteromalla extract was studied on the production of TNF-[alpha]. and IL-6. The extract showed dual cytokine inhibition in lipopolysaccharide (LPS) stimulated THP-1 monocytes (human acute monocyte leukemia cell line). Bioactivity guided isolation identified chlorojanerin as the active principle which showed significant inhibition of induced inflammatory cytokines. The compound also blocked TNF-[alpha] and IL-6 production from LPS stimulated primary human monocytes. Previ-ously, chlorojanerin isolated from Centaurea solsitialis was found to be the active ingredient in ethanol-induced ulcerogenesis model in rats and is reported as a cytotoxic agent directed towards cancerous cells. Gurbuz and Yesilada (2007) showed that chlorojanerin was effective in preventing the induction of lesions by ethanol. However, there were no previous reports on the effect of chlorojanerin on the molecular events involved in the inflammatory cascade. We report for the first time that chlorojanerin, isolated from S. heteromalla, inhibits the cytokine secretion in LPS-stimulated human monocytic cells and synovial cells isolated from RA patients. This effect is exerted through the inhibition of NF-KB and its regulated genes involved in cytokine secretion of TNF-[alpha] and IL-6.

Materials and methods

Plant source

The whole plants of Saussurea heteromalla were collected from the Himalayan district - Nainital in Uttarakhand, India in the month of May 2008 and taxonomically classified. The voucher specimens (Collection No. -AS00255), for future reference, are deposited with the herbarium of Department of Natural Products - Botany, Piramal Life Sciences Limited, Mumbai.

Extraction and isolation

The air-dried and powdered material of the whole plant Saussurea heteromalla (400 g) was extracted with 2 lit dichloromethane:methanol (1:1) at room temperature for 12 h and filtered. The process was repeated twice with the mart. The three filtrates were then combined and dried on a rotary evaporator under reduced pressure to give a dark brown residue (15 g). The dark brown crude extract was partitioned between water methanol mixture (8.5:1.5) and petroleum ether (300 ml x 5) followed by ethyl acetate (300 ml x 5). The ethyl acetate layer was dried on a rotary evaporator under reduced pressure to give a brown color residue 5.5 gm. This was further purified by RediSep silica flash-column using CombiFlash instrument. The column was eluted with chloroform and methanol to obtain three fractions (F1-F3).

Cell lines

The human monocytic cell line THP-1 (ATCC, Manassas, VA) was maintained in RPMI-1640 (Bioconcept) supplemented with 10% FBS (GIBCO). Prior to LPS-stimulation, 25,000 cells per well were cultured for 24 hours in the presence of 10 ng/ml of phorbol 1 2-myristate 13-acetate (PMA, Sigma-Aldrich) to enhance their response to activation stimuli (Kulkarni-Almeida et al. 2008). These cells were then stimulated with 1 [mu]g/m1 LPS (Sigma-Aldrich) for 24 h in presence or absence of compound doses at 0.5% DMSO concentration. At the end of 24 h the cell supernatant was used for cytokine measurements and the cells used for determining the toxic effects of the compounds by exposure to CCK-8 (Dojindo). For all experiments, the THP-1 monocytes were used only upto passage # 25 and were utilized within two months post revival of a new vial.

Isolation of human monocytes

Blood specimens were obtained with consent from a minimum of three healthy human volunteers (aged between 20 and 50 years) after informed consent and approval from the Ethics Committee of Piramal Life Sciences Limited. Human peripheral blood mononuclear cells (hPBMCs) were harvested using density gradient centrifugation and monocytes were isolated from the hPBMCs by the process of adherence at a cell seeding density of 25,000 cells/well (Dagia et al. 2010). The monocyte purity routinely consisted of > 85% CD14+ cells, <1.5% CD3+ cells as determined by flow cytometry (Kulkarni-Almeida et al. 2008). Cytokine stimulation experiments were conducted similar to the THP-1 protocol in presence and absence of the compound exposure of 5 h. At the end of the incubation period the cell supernatant was evaluated for the cytokine response and the cells checked for cytotoxicity by CCK-8 method (Kulkarni-Almeida et al. 2008).

Synovial cell assay

The procedure followed was as reported by Dagia et al. (2010). After informed consent and approval from the Ethics Committee of Piramal Life Sciences Limited, synovial tissue was obtained from one RA patient undergoing knee replacement surgery. The tissue was minced into small pieces and digested in RPM! medium containing 100 U/ml penicillin G, 100 [mu]g/ml streptomycin, 50 ng/ml amphotericin B (GIBCO), 1.33 mg/ml collagenase type I (Worthington Biochemical), 0.5 [mu].g/ml DNAse type I (Sigma Aldrich), and 8.33 U/ml heparin (Biological E) for 3 hat 37 [degrees]C, 5% [CO.sub.2]. The digested tissue was filtered through a membrane (mesh size 70 pin; BD Biosciences). Subsequently, the cells were washed thrice and resus-pended in medium composed of RPM! supplemented with 5% FBS and 5% human serum AB_at a concentration of 1 x [10.sup.6] cells/ml. For the experiment, 1 x [10.sup.5] cells were added to the wells of a 96-well culture plate. Chlorojanerin or 0.5% DMSO was then added to the cells. SB-203580 (20 p.14; Calbiochem) was used as a positive control for inhibition of TNF-[lapha] and IL-6 production. The cells were incubated for 16 h at 37 [degrees]C 5% [CO.sub.2], following which supernatants were collected, stored at -70 [degrees]C, and assayed later for IL-6 and TNF-[lapha] by ELISA.

Cytokine determination

The monocytes were maintained in RPMI-1640 supplemented with 10% FBS and cytokine expression in presence or absence of the compound was determined. The levels of cytokines generated were assessed by ELISA from BD Biosciences having a sensitivity thresh-old of 4.6 pg/ml for IL-6 and 7.8 pg/ml for TNF[lapha]. Simultaneously, assays were performed to determine the effect of the compound on cellular toxicity using CCK-8; a dehydrogenase activity measurement kit from DoJindo.

RNA extraction

THP-1 cells, 107/ml were treated with drugs for 8 hours following which total ribonucleic acid (RNA) was isolated. The cells were harvested and lysed using Trizol Reagent (Invitrogen Corporation, Carlsbad, USA) and used for RNA extraction by chloroform-ethanol precipitation protocol as described previously (Bouras et al. 2002) followed by column purification using RNeasy Mini kit (Qiagen GmbH, Hilden, Germany). The total RNA isolated from THP-1 cells was quantified using Nanodrop (ND-1000, USA). The quality of the RNA was verified by evaluating the 260/280 and 260/230 ratios. The RNA used in our study had values of between 1.8 and 2.1 indicating reliable purity, devoid of any DNA or organic contaminations. In addition, the integrity of the RNA samples were evaluated by cap-illary electrophoresis method as described previously (Schroeder et al. 2006) using the Bioanalyzer (Agilent, USA). The RIN number indicates the integrity of RNA and the samples used in the current study had RIN numbers within the range of 8.6-9.4. This ensured that the RNA samples were free from degradation and devoid of any contamination that might hamper the downstream cDNA con-versions and fluorescent labeling.

Microarray assay

Microarray based gene expression data was generated for a set of 265 genes from major cell signaling pathways printed on 16 chambered subarray chip from Schott Nexterion Slides MPX 16 (Schott AG, Mainz, Germany) as 70-mer oligonucleotides (Bioserve Biotechnologies, India). 5-7 [mu]g of total RNA was used for conversion of cDNA and subsequent labeling with Promega Chipshot Labeling kit as per the manufacturer's protocol. The cDNA was generated using aminoallyl dUTP's and labeled with Cy3 ester dyes (GE Healthcare). The arrayed slides were subjected to pre and post hybridization washes as per the manufacturer's protocol using Universal Microarray Hybridization kit (Corning Incorporated, NY, USA). The chip was hybridized in an automated GeneTAC Hyb-station with a step down protocol of 42 [degrees]C for 6 hours, 35 [degrees]C for 6 hours and 30 [degrees]C for 6 hours. Hybridized slides were scanned using GeneTAC GT UC scanner (Genomic Solutions Inc., USA). All microarray experiments were conducted in duplicates and data analyzed independently for each sample data set. The raw data from the microarray experiment, comprising of the chip details and normalized signal intensity has been submitted to Gene expression omnibus (GEO) database at NCBI as per the guidelines and templates advised by MIAME compliance. The data is available on GEO with accession numbers GSE34180 and GPL14963 at NCBI database.

Microarray data analysis

Image analysis and image quantification of scanned data were done using GeneTAC Integrator software and the data has been analyzed using GeneSpring GX-9 (Agilent Technologies, Santa Clara, California). After normalizing with average intensity of 12 housekeeping genes, Log2 Ratio of intensities [Test/control] was calculated and the average expression ratio determined. Genes with >0.05 p-value threshold in parametric T-test and [greater than or equal to] 1.5 fold difference from control samples, were considered as differentially regulated genes and used for unsupervised hierarchical clustering.

Gene expression by RTq-PCR

The microarray data was further validated by conducting Realtime quantitative PCR of the responsive gene population. Differentiated THP-1 were treated with drugs for 8 hours following which total ribonucleic acid (RNA) was isolated using Trizol reagent (Gibco/lnvitrogen) in accordance with the manufacturer's instructions. The primers were designed using Primer3 software. The following primers were used: IL-6, forward: TGCCAGC-CTGCTGACGAAGC, reverse: TGCCGAAGAGCCCTCAGGCT, IRF1, forward: AGTCGAGGCAAGACGTGCGCC, reverse: AGAAGGCAGAG-GTMCCGGGTT, NF-KBI, forward: ACTGCCAACAGCAGATGGCCCA, reverse: GCACCAGGTAGTCCACCATGGGAT, IL-18, forward: TCCCCAGCTTGCTGAGCCCTT, reverse: GTTGGCAGCCAGGAGGGCAA, TNFSF10, forward: AGCAGCTCACATAACTGGGACCAG, reverse: TGCGGCCCAGAGCCTTTTCAT, PTGS2, forward: TGAGCGTCAGGAGCACGTCCA, reverse: CTGAGGGCGTCTGGCTGTGG and BCL2, forward: AGCGTCAACCGGGAGATGTCG, reverse: ACAAAGGCATCCCAGCCTCCGTT. The Real time PCR was carried out using forward and reverse primer concentration of 10 [mu]M in total volume of 20 [mu]l RNA was further reverse transcribed to cDNA using super-script III (Invitrogen Corporation, Carlsbad, USA). Real time PCR was performed on the resulting cDNA using quantifast cybrgreen kit. Realtime quantitative PCR (RTq-PCR) was carried out using Realplex Mastercycler System (Eppendorf, Germany) and fluo-rescent dye SYBER green (Invitrogen Corporation, Carlsbad, USA) following the manufacture's protocol. Expression of all the genes was normalized with GAPDH and the relative expression of each gene was calculated using relative Ct method with the formula [2.sup.-[deta][deta]Ct] (where [deta][deta]]Ct = [deta]Ct sample--[deta]Ct reference), where Ct is the number of cycles required to reach the threshold.

NF-[kappa]B transcription assay

The effect of chlorojanerin on NF-KB binding was studied using the CEM-KB cell line (a kind gift from Dr. Shigeki Miyamoto, University of Wisconsin, Madison, WI ). The assay was conducted as per our published protocol (Dagia et al. 2010). The CEM-KB cell line is transfected with a plasmid that has incorporated the KB binding element and is linked to the green fluorescent protein (GFP) promoter. NF-KB activation by TNF-[lapha] is measured as a direct measure of GFP fluorescence. The CEM-KB cells were maintained in RPMI in the presence of G418 (Sigma Aldrich). The cells were plated at a density of 50,000 cells/ml and treated with chlorojanerin at vari-ous concentrations or 0.5% DMSO. These cells were then stimulated with or without TNF-[lapha] (1 ng/ml; R&D Systems, Minneapolis, MN), and the extent of NF-KB expression was observed after 16 h. The reduction of GFP fluorescence signifies the extent of inhibition of NF-KB expression in the cells in the presence of chlorojanerin. In every experiment, BAY 11-7082 (Calbiochem) was used as a posi-tive control for inhibition of NF-KB activation.

Statistical analysis

The results are presented as Mean [+ or -] S.E.M. and Mean [+ or -] SD (Supplementary data Table S1 ). Data were analyzed using the GraphPad Prism Software Version 5.0. A comparative analysis between the control and treated groups was conducted using the ANOVA one way test and their significance established. Difference of p < 0.05 was considered statistically significant.

Results

For all assays, initially detailed experimentation was performed to ascertain the optimal time-point for assessing the antiinflammatory effects of chlorojanerin. Kinetic (time-course) studies with LPS-stimulated human monocytic THP-1 cells, LPS-stimulated human monocytes and human synovial tissue cells revealed that pro-inflammatory cytokine production was submaximal (-60% of maximum value) and within the "linear" increase range at 24 h, 5 h, and 16 h time-point, respectively, for the afore-mentioned three assays. Accordingly, the anticytokine effects of chlorojanerin were investigated at these particular time-points in pertinent assays. Because the generation of mRNA precedes the production of protein, we investigated the effects of chloro-janerin on various transcripts at 12 h time-point (sufficiently prior to the 24 h. timepoint that was utilized for assessing the effects of chlorojanerin at protein level in THP-1 cells). Lastly, kinetic NF-KB reporter studies demonstrated that at 16 h time-point the TNF-[lapha] stimulation of NF-KB was sub-maximal (-60% of maximum value) and within the "linear" increase range. Hence, the effects of chlorojanerin on TNF-[lapha]-induced activation of NF-KB were studied in CEM-KB cell line at 16 h (Fig. 1).

Inhibition of TNF-[lapha] and IL-6 by S. heteromalla extract in LPS stimulated THP-1 cells

The ethyl acetate extract of S. heteromalla potently inhibited the production of TNF-[lapha] and IL-6. The crude extract showed 100% TNF-[lapha] and IL-6 inhibition at 10 and 30 [mu]g/ml(Fig. 2) and a very low level of cytotoxicity (24.2 [+ or -] 2.5 and 13[mu]g/ml at the respective concentrations). Since blocking of these cytokines has been shown to be therapeutically effective isolation of the active principle from the extracts was initiated.

Dexamethasone was used as a standard compound in all assays. It is also known to inhibit proinflammatory cytokine production in THP-1 cells as well as in human PBMCs (Mogensen et al. 2008). In our studies, we used dexamethasone at 1 [mu]M concentration as a standard in all subsequent experiments. At 1 [mu]M, dexamethasone inhibited the production of IL-6 and TNF-[lapha] in THP-1 cells by 92 [+ or -] 5% and 83 [+ or -] 6% respectively.

Bioactivity guided isolation of chlorojanerin

The ethyl acetate extract of S. heteromalla was subjected to fractionation as described in materials and methods. At each step of the fractionation, the fractions were assayed for TNF-[lapha] and IL-6 inhibition. Purification of the active fraction on Strata-X 33 polymeric RP cartridge (Phenomenex) using mixture of water & acetonitrile in step gradient mode resulted in isolation of the compound chlorojanerin as white crystals. This was further subjected to preparative HPLC (mobile system:water/acetonitrile (98:2), to 100% actetonitrile for 30 minutes; detection 220 nm; flow rate 5 ml/min) to give 69 mg of a white crystalline powder with > 98% purity. The HPLC chromatogram of chlorojanerin was conducted with a lichrosphere column, RP-18 (125 mm x 4 mm, 5 p,m), using an initial mobile phase gradient of 2% acetonitrile to 100% acetonitrile for 15 minutes against water at a flow rate of 1 ml/minute and was detected at UV 220 nm (Fig. 3).

Structure elucidation of chlorojanerin

The isolated principle was a white crystalline compound with UV (MeOH) Amax 190, 214 nrn, LC--MS (MW): 397 [M--H], 399 [M+H]+, 421 [M+Na]+, 423 [M+Na+2]+, 437 [M+K]+. The molecular formula was defined as C191-123C107.

(1) H NMR [sigma] ([CDC1.sub.3], ppm): 3.1 (ddd, J= 9 and 8.5, H-1), 2.5 (m, Ha-2), 1.6 (dd, J= 15, Hb-2), 4.18 (brd, J=6.8, H-3), 2.35 (di= 10, H-5), 4.75 (dd, J= 11 and 9, H-6), 3.18 (m, H-7), 5.16 (m, H-8), 2.68 (dd, J= 15 and 4.5, Ha-9), 2.4 (d, J= 15, Hb-9), 6.2 (d, J = 3.6, Ha-13), 5.6 (d, J= 3.0, Hb-13), 5.17 (brs, Ha-14), 4.8 (brs, Hb-14), 4.33 (d, J= 11.6, Ha-15), 3.95(d, J=12, Hb-15), 6.3 (s, Ha-18), 5.9 (s, Hb-18), 4.1 (brs, H-19).

(13) C NMR [sigma] (CDC13, ppm): 47.12 (C-1), 37.2 (C-2), 77.2 (C-3), 84 (C-4), 57 (C-5), 77.2 (C-6),47.12 (C-7), 76.12 (C-8), 35.11 (C-9), 141.6 (C-10), 136.2 (C-11), 169 (C-12), 122.8 (C-13), 118.04 (C-14), 47.3 (C-15), 164.8 (C-16, 136.2 (C-17), 126.3 (C-18), 61.8 (C-19).

All the spectral data viz.; UV Mass and NMR ((1) H & (13) C) were in agreement with that of the published data (El-Assal et al. 1970) on chlorojanerin. Hence the structure of the compound was assigned as chlorojanerin (Fig. 4). This was in accordance with the informadon available in the Dictionary of Natural Products on DVD, Version 2, 2010. Taylor & Francis, CRC Press.

Thus, Saussurea heteromalla has been found as a new source for chlorojanerin. Our subsequent data defines the mechanism of action of chlorojanerin in inhibiting cytokine production in LPS-stimulated THP-1 cells, LPS-stimulated human monocytes as well as in clinically relevant synovial cells from a rheumatoid arthritis patient.

Effect of chlorojanerin on the production of TNF-[lapha] and IL-6 in LPS stimulated THP-1 cells

Chlorojanerin inhibited release of TNF-[lapha] and IL-6 by LPS stim-ulated THP-1 cells with an IC50 of 2.3 [+ or -] 0.4,11/1 and 1.8 [+ or -] 0.7[micro]M (Fig. 5, *p < 0.05), without significantly causing toxicity to the cell population. Since THP-1 cells are lymphocytic derived myeloid cells, we sought to evaluate the cytokine inhibitory potential of chlorojanerin in primary human monocytes isolated from healthy donors and stimulated by LPS. Similarly synovial cells from a RA patient were also challenged with a dose response of chlorojanerin to determine the effect on proinflammatory cytokines produced by these cells.

Effect of chlorojanerin on the production of TNF-[lapha] and IL-6 in LPS stimulated isolated human monocytes and synovial cells from RA patient

Chorojanerin inhibits cytokine secretion in LPS stimulated human monocytes and in RA synovial tissue thus, confirming its effect on primary cells. Chlorojanerin invoked a dose-dependent inhibition of LPS-induced TNF-[lapha] (1050 =1.5 [+ or -] 0.4 p,M) and IL-6 (IC50 = 0.7 [+ or -] 0.2 ti,M) production in primary human monocytes (Fig. 6a; *p <0.05). Further, the compound also blocked the proinflammatory cytokine secretion by rheumatoid synovial cells. TNF-[alpha] release by the synovial cells was potently blocked ([IC.sub.50] < 0.03 [mu]M) and IL-6 release was also binhibited with [IC.sub.50] = 0.4[mu]M. (Fig. 6b; *p < 0.05). This effect of chlorojanerin is significant since the synovial cells are representative of a clinical condition. Our findings with clinically-relevant synovial cells are promising and warrant further research.

This mitigation of TNF-a and IL-6 which was detected in a LPS stimulated cell line based screen and further reproduced in LPS stimulated primary human monocytes as well as in synovial cells from a rheumatoid patient highlights the potential of this compound as an anti-inflammatory agent. We further conducted microarray based gene expression studies to determine the possible mechanism of action of this compound.

Pathway focused gene expression profiling

The microarray based gene expression profiling was conducted using a gene chip focused on major cell signaling pathways. THP-1 cells were treated with chlorojanerin or dexamethasone in duplicate followed by stimulation with LPS. Gene expression analysis revealed that 128 transcripts were differentially expressed in THP-1 cells after stimulation with LPS (Fig. 7a, Supplementary data Table Si, Fig. 1) wherein 37 transcripts showed significant elevation and 92 transcripts were down regulated. Chlorojanerin significantly modified the expression pattern of 81 among 128 genes which were dysregulated by LPS (Fig. 7a). We observed that chlorojanerin inhibited the expression of ten genes whereas 71 genes were upreg-ulated as compared to the LPS stimulated conditions (Fig. 7a).

Chlorojanerin inhibits genes containing known KB sites in LPS stimulated THP-1 cells

Analysis of the 37 genes using the GSEA (Gene Set Enrichment Analysis) software revealed 13 genes which are NF-KB downstream targets and are up regulated by LPS treatment. Treatment with chlorojanerin inhibits expression of 8 transcripts significantly (Fig. 7b and c). These include Bcl2, CCND1, CXCL1, CXCL3, IL-18, IL-6, IRF1, NF-KB1, PTGS2, TNF-[alpha], TNFSF10, TRADD, and TRAF1. The promoter elements of Bcl2 and CCND1 have KB binding sites and are directly regulated by activation of the TNF-[alpha]/NF-KB sig-naling pathway (Catz and Johnson 2001; Toulabi-Abed et al. 2008). NF-KB binding upstream of the IRF-1 gene is also the rate limit-ing factor in TNF-[alpha] induced IRF-1 gene expression (Robinson et al. 2005). Similarly, the chemokinesicytokines CXCL1, CXCL3, TNF-[alpha], IL-6, IL-18, TNFSF10, and PTGS2 secretion are all protein expression events subsequent to NF-KB activation and p50/p65 translocation (Ohtsuka et al. 1996; Ackerman et al. 2008; Lee et al. 2005; Matsuda et al. 2005). TRAF1 is one of the several genes upregulated by these cytokines (Schwenzer et al. 1999) and NFKB1 being a self regu-lated gene is also blocked by the action of chlorojanerin (Ten et al., 1992). Given that each of these genes are directly controlled by KB binding to the DNA sequence, we validated the microarray data by RTq-PCR on a panel of 5 genes which are the classical markers for NF-KB activation (TNF-[alpha], TNFSF10, IL-6, IRF-1, and NF-KB1) and observed that the expression pattern was in concordance with the microarray profile (Fig. 8a and b).

The RTqPCR data validated the microarray study and highlighted the effect of chlorojanerin on genes which are regulated by NF-KB activation and binding to the KB DNA binding elements. These genes include TNF, TNFSF10, IL-6, IRF-1, and NF-KB1 which directly dictate the translation of the cytokines TNF-[alpha] and IL-6. We there-fore investigated the effect of chlorojanerin on activation of TNF-[alpha] induced NF-KB in a GFP reporter system which incorporates the KB binding regions in close proximity to the GFP promoter.

Effect of chlorojanerin on TNF-[alpha] induced NF-KB activation in CEM-KB cells transfected with the KB element: NF-KB activation by TNF-[alpha] at 1 ng/m1 is estimated as a direct measure of GFP fluores-cence and the extent of NF-KB expression was observed after 16 h incubation. We observed that chlorojanerin significantly inhibited activation of NF-KB and the effect was comparable to that of BAY11-7082 (Fig. 9a and b).

The above data provides evidence for the ability of chlorojanerin to mitigate cytokine responses in inflammatory cells by abrogation of NF-KB induced signaling.

Discussion

The objective of this study was to define the anti-inflammatory effects of Saussurea heteromalla on the cytokines TNF-[alpha] and IL-6. Exposure of macrophages to bacterial endotoxin or lipopolysaccahride is well known to orchestrate a cataclysm of inflammatory gene expression events which lead to inflammatory cytokine production. Since, the THP-1 mononuclear cell line is a promonocytic cell line which most closely reflects the behavior of human peripheral blood derived mononuclear cells (Sharif et al. 2007) we utilized these cells for conducting routine bioactivity guided isolation of the active principle. Our data clearly indicates that chlorojanerin isolated from S. heteromalki blocks TNF-[alpha] and 1L-6 production not only in THP-1 cells but also in LPS stimulated primary human monocytes and clinically relevant synovial cells from a RA patient (Figs. 5 and 6). The signaling events leading to cytokine synthesis and release following LPS exposure are well established (West et al. 2006). Binding of LPS is mediated through LPS binding protein (LBP) and CD14 receptors expressed on the cell surface of cells belonging to the macrophage lineage. This binding triggers to toll-like receptor 4 (TLR4) signaling pathways, distinguished by their convergence onto activation of the transcription factor, nuclear factor KB (NE-KB), a central regulator of the LPS, cytokine and stress responses in many cell types, including macrophages (Sharif et al. 2007; Shakhov et al. 1990). The endpoint of these signaling cascades is secretion of cytokines such as TNF-[alpha], IL-6. Our data with chlorojanerin distinctly proves that the compound effect is mediated by its potential to block the binding of the KB elements to the NE-KB binding site on the DNA (Figs. 7-9). Chlorojanerin inhibits not only the LPS-induced mRNA transcription of NF-KB dependent genes for TNFSF10, IL-6, TNF-[alpha], IRA, PTGS2, BCL-2, 1L-18, and NFKB1A (Figs. 7 and 8) but also exerts direct translational effects in blocking the secretion of TNF-[alpha] and 1L-6 (Figs. 5 and 6a and b) in a dose dependent man-ner. Thus, this study examined key genes from inflammatory and proliferation pathway that are induced by LPS treatment and the subsequent effect of the compound on LPS induction which in turn helped us to understand the mechanism of action of chlorojanerin.

Overexpression and secretion of cytokines plays a key role in the pathogenesis of autoimmune disease, chronic inflammatory proliferative disease, bone resorption and joint diseases (Katsuhiko and Toshio 2006). INF-[alpha]being a potent paracrine molecule can induce other proinflammatory cytokines like IL-1[beta] and GMCSF and hence plays a pivotal role in the pathogenesis of RA and other inflammatory conditions (Feldmann et al. 1996). On the other hand, IL-6 is a survival factor and implicated in inducing the differentiation of monocytes to macrophages. IL-6 together with monocyte colony stimulating factor promotes the differentiation of monocytes to macrophages rather than dendritic cells (Chomarat et al. 2000). Activation of the monocyte lineage is associated with production of cytokines like IL-1[beta], IL-6, TNFa, etc. Hence specifically mitigating macrophage activation is considered an effi-cacious approach to prevent local as well as systemic inflammatory disorders (Kinne et al. 2002). NF-KB is the master transcriptional regulator which mediates the secretion of TNF-[alpha] and IL-6 in the monocyte--macrophage lineage. Since this transcription factor is cell specific and plays a crucial role in cell differentiation and regulation of specific cellular responses, mitigation of this regulatory factor is considered a good therapeutic option for inflammation (Barnes and Karin 1997).

The present studies have clearly indicated that the crude extract as well as the isolated pure molecule "chlorojanerin" shows inhibition of TNF-ot and 1L-6 (Figs. 2, 5 and 6) by blocking activation of the transcription factor, NF-KB (Figs. 7-9). A wide range of antiinflammatory agents including several NF-KB inhibitors have been reported to modify the immune and inflammatory responses both in vitro and in vivo (Juliana et al. 2010; Perolin et al. 2008). Thus, there is a large potential for such inhibitors to be developed into drugs. In the clinical setting, many extracts from plant sources have contributed to herbal medicines; e.g., tinefcon, which is used in psoriasis and has significant anti-TNF-[alpha], IL-6 as well as NF-KB effects (Chauhan et al. 2007).

Transcriptional profiling analysis demonstrated 128 transcripts differentially expressed between LPS stimulation and unstimulated THP-1 cells. These genes had significant overlap with previously established studies for understanding the LPS induced inflammatory pathways in immune cells (Sharif et al. 2007). Key findings of this study included the upregulation of the IRF1, IL-6 and the TNF adapter protein TNFSF10 as well as the TNF receptor family members TRADD and TRAF1 and the other known inflammation-related transcripts such as PTGS2, BCL2, and CCND1 on LPS stimulation. While dexamethasone a known immunosuppressive agent has shown potent inhibition of most genes, chlorojanerin has selectively inhibited a set of 10 genes. Chlorojanerin treatment induced modest abrogation of key inflammatory transcripts of IL-6 (FC = 0.9) as compared to dexamethasone (FC = 3.2). This correlates well with the previously established data (Mianji et al. 1996) that dexamethasone potently abrogates the 1L-6 signals, when stimulated by LPS. We observed that the inhibition of TNFSF10 transcripts by chloro-janerin was more pronounced as compared to dexamethasone implying that chlorojanerin induces preferential dysregulation of the TNF signaling in immune cells. In addition, chlorojanerin exclusively inhibits IL-6, IRF1, NF-KBI, IL-18, TNFSF10, PTGS2, and BCL2 all of which are well elucidated downstream targets of NF-KB (Catz and Johnson 2001; Toulabi-Abed et al. 2008; Ohtsuka et al. 1996; Lee et al. 2005; Robinson et al. 2005; Ackerman et al. 2008; Matsuda et al. 2005; Schwenzer et al. 1999). Validation of the microarray study by real time analysis showed that mRNA expression ofTNF-a, IL-6, NF-KB1, and IRF1 (all of which are downstream targets of NF-KB binding) was significantly inhibited in presence of chlorojanerin (Fig. 8). The gene expression data was supported by our findings of NF-KB protein binding in CEM-KB cells (Fig. 9). Further, the effect on NF-KB correlated well with the effect of chlorojanerin observed on spontaneous TNF-[alpha]and IL-6 production by the synovial cells isolated from a RA patient. Our data bears significance since these synovial cells are representative of a clinically affected population. This comprehensively shows that the transcriptional and translational inhibition of the protein machinery by chlorojanerin in the LPS induced inflammatory cascade corresponds to effective abrogation of signals to NF-KB in these cells. The mitigation of these specific targets of NF-KB by chlorojanerin demonstrates its potency as a NF-KB inhibitor. Since NF-KB inhibition is considered a major therapeutic strategy for inflammation, chlorojanerin may serve as a "starting point scaffold" for chemical modifications.

Conclusion

Altogether, our data with "chlorojanerin" in clinically and pathologically relevant primary human monocytes and synovial cells from a RA patient highlights its effectiveness in countering the proinflammatory responses. Chlorojanerin is a guaianolide type of sesquiterpene lactone which is known to mediate its effect out of being a good Michael acceptor. We suggest that since the activity of this compound is well distinguished from its toxicity, chemical modification of this molecule may be attempted to provide good scaffolds with anti-inflammatory potential that are interfering with the activation of the monocyte-macrophage under inflammatory conditions.

Conflict of interest

The authors have no conflict of interest.

Disclosure statement: The authors have nothing to disclose.

Acknowledgments

The authors wish to thank the management of Piramal Health-care Limited, India for supporting this study and providing the infrastructure needed for carrying out the research work reported in this paper. We also thank Mr. Manas Sahoo and Mahesh Nambiar for their technical support.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.phymed.2012.05.016.

References

Ackerman, W.E., Summerfield, T.L.S., Vandre, D.D., Robinson, J.M., Kniss, D.A., 2008. Nuclear factor-[kappa]B regulates inducible prostaglandin E synthase expression in human amnion mesenchymat cells. Biology of Reproduction 78, 68-76.

Adhikari, B.S., Babu, M.M., Saklani, P.L., Rawat, G.S., 2010. Medicinal plants diversity and their conservation status in Wildlife Institute of India (WII) campus, Dehradun. Ethnobotanical Leaflets 14, 46.

Barnes, P.J., Karin, M., 1997. Nuclear Factor-KB - a pivotal transcription factor in chronic inflammatory diseases. New England Journal of Medicine 336 (15), 1066-1071.

Bouras, T., Southey, M.C., Chang, A.C., Reddel, R.R., Willhite, D., Glynne, R., Henderson, M.A., Armes, J.E., Venter, DJ., 2002. Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer. Cancer Research 62, 1289-1295.

Catz, S.D., Johnson, J.L., 2001. Transcriptional regulation of bcl-2 by nuclear factor KB and its significance in prostate cancer. Oncogene 20, 7342-7351.

Chauhan, V., Suthar, A., Sapre, D., Bal-Tembe, S., Gangopadhyay, A.K., Kulkarni-Almeida, A., Parikh, S., 2007. Herbal composition for inflammatory disorders. Patent # WO/2007/036900.

Chomarat, P., Bachereau, J., Davoust, J., Palucka, A.K., 2000. IL-6 switches the differentiation of monocytes from dendritic cells to macrophages. Nature Immunology 1 (6), 510-514.

Dagia, N.M., Agarwal, G., Kamath, D.V., Chetrapal-Kunwar, A., Gupte, R.D., Jadhay, M.G., Dadarkar, 5.5., Trivedi, J., Kulkarni-Almeida, A.A., Kharas, F., Fonseca, L.C., Kumar, S., Bhonde, M.R., 2010. A preferential p110{alpha}l{gamma} PI3K inhibitor attenuates experimental inflammation by suppressing the production of proinflammatory mediators in a NF-[kappa]B-dependent manner. American Journal of Physiology. Cell Physiology 298, 929-941.

El-Assal, Lanson, S., Shehab, A.H.. 1970. Stobbe condensation. VIII: cyclization of cis-3-methoxycarbonyl 4-(2,3-dimethoxyphenyl)but-3-enoic acid to the corresponding polysubstituted naphthalene derivatives. United Arab Republic Journal of Chemistry 13, 249-251.

Feldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in rheumatoid arthritis. Annual Reviews of Immunology 14, 397-440.

Gurbuz, I., Yesilada, E., 2007. Evaluation of the anti-ulcerogenic effect of sesquiterpene lactones from Centaurea solstitialis L ssp. solstitialis by using various in vivo and biochemical techniques. Journal of Ethnopharmacology 112, 284-291.

Juliana, C., Fernandes-Alnemri, T., Wu, J., Datta, P., Solorzano, L, Yu, J.W~ Meng, R., Quong, A.A., Latz, E., Scott, C.P., Alnemri, ES., 2010. Anti-inflammatory compounds parthenolide and Bay 11-7082 are direct inhibitors of the inflammasome. Journal of Biological Chemistry 285 (13), 9792-9802.

Katsuhiko, I., Toshio, H., 2006. IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine and Growth Factor Reviews 13, 357-368.

Kulkarni-Almeida, A., Suthar, A., Goswami, H., Vishwakarma, R., Chauhan, V., Balakrishnan, A., Sharma, S., 2008. Novel leads from Heliorropium ovalifolium, 4,7,8-trimethoxy-naphthalene-2-carboxylic acid and 6-hydroxy-5,7-dimethoxy-naphthalene-2-carbaldehyde show specific IL-6 inhibitory activity in THP-1 cells and primary human monocytes. Phytomedicine 15, 1079-1086.

Kinne, R.W., Brauer, R., Stuhlmuller, B., Palombo-Kinne, E., Bumester, G.R., 2002. Macrophages in rheumatoid arthritis. Arthritis Research 2, 189-202.

Lee, B.C., Kim, S.H., Choi, S.H., Kim, T.S., 2005. Induction of interleukin-8 production via nuclear factor-KB activation in human intestinal epithelial cells infected with Vibrio vulniJicus. Immunology 115, 506-515.

Matsuda, T., Almasan, A., Tomita, M., Uchihara, J., Masuda, M., Ohshiro, K., Takasu, N., Yagita, H., Ohta, T., Mori, N., 2005. Resistance to Apo2 Ligand (Apo2L)(Tumor Necrosis Factor-Related Apoptosis-lnducing Ligand (TRAIL)-Mediated Apoptosis and Constitutive Expression of Apo2L/TRAIL in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines. Journal of Virology 79 (3), 1367-1378.

Mianji, S., Hamasaki, Y., Yamamoto, S., Miyazaki, S., 1996. Inhibition by dexamethasone of the lipopolysaccharide induced increase in IL-6 mRNA abundance and IL-6 production in human polymorphonuclear leukocytes. International Journal of lmmunopharmacology 18 (5), 339-346.

Mogensen, T.H., Berg, R.S., Paludan, S.R., Ostergaard, L, 2008. Mechanisms of dexamethasone-mediated inhibition of toll-like receptor signaling induced by Neisseria meningitidis and Streptococcus pneumoniae. Infection and Immunity 76 (1), 189-197.

Ohtsuka, T., Kubota, A., Hirano, T., Watanabe, K., Yoshida, H., Tsurufuji, M., lizuka, Y., Konishi, K., Tsurufuji, S., 1996. Glucocorticoid-mediated gene suppression of rat cytokine-induced neutrophil chemoattractant CINC/gro, a member of the interleukin-8 family, through impairment of NF-[kappa]B activation. Journal of Biological Chemistry 271 (3), 1651-1659.

Pandey, M.M., Rastogi, S., Rawat, A.K.S., 2007. Saussurea costus: botanical, chemical and pharmacological review of an ayurvedic medicinal plant. Journal of Ethnopharmacology 110, 379-390.

Perolin, C.-C., Billiet, L, Bauge, E., Copin, C., Scott-Algara, D., Genze, F.. Buchele, B., Syrovets, T., Simmet, T., Rouis, M., 2008. Antiinflammatory and antiatherogenic effects of the NF-KB inhibitor acetyl-11-feto-p-boswellic acid in LPS-challenged ApoE-/-mice. Arteriosclerosis, Thrombosis, and Vascular Biology 28, 272-277.

Robinson, C.M., Hale, P.T., Carlin, J.M., 2005. NF-KB activation contributes to indoleamine dioxygenase transcriptional synergy induced by IFN-y and tumor necrosis factor-a. Cytokine 35, 53-61.

Saklani, A., Rao, R.R., 2000. In: Pangtey, Y.P.S. (Ed.), High Altitudes of the Himalayas. 11: (Biodiversity, Ecology & Environment)., ed. 2. Gyanodaya Prakashan, Nainital, India, p. 323.

Schroeder, A., Mueller, 0., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., Ragg, T., 2006. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Molecular Biology 7, 3.

Schwenzer, R., Siemienski, K., Liptay, S., Schubert, G., Peters, N., Scheurich, P., Schmid, R.M., Wajant, H., 1999. The Human Tumor Necrosis Factor (TNF) Receptor-associated Factor 1 Gene (TRAF1) is up-regulated by cytokines of the TNF ligand family and modulates TNF-induced activation of NF-KB and c-Jun N-terminal kinase. Journal of Biological Chemistry 274 (27), 19368-19374.

Shakhov, A.N., Martine, A., Collart, S., Vassali, P., Nedospasov, S.A., Jongneel, V., 1990. KB enhancers are involved in lipopolysaccharide mediated transcriptional activation of the Tumor Necrosis Factor-alpha gene in primary macrophages. Journal of Experimental Medicine 171, 35-47.

Sharif, O., Bolshakov, V.N., Raines, S., Newham, P., Perkins, N.D., 2007. Transcriptional profiling of the LPS induced NF-KB response in macrophages. BMC 8, 1. Smolen, J.S., Maini, R.N., 2006. Interleukin-6: a new therapeutic target. Arthritis Research and Therapy 8 (Suppl. 2), 85.

Ten, R.M., Payal, C.V., Israel, N., Bail, 0.L., Mattei, M.G., Virelizier, J.-L., Kourilsky, P., Israel, A., 1992. The characterization of the promoter of the gene encoding the p50 subunit of NF-kB indicates that it participates in its own regulation. The EMBO Journal 1 (1), 195-203.

Toulabi-Abed, K., Daniel, F., Gul ler, M.C., Legrand, A., Mauriz, J.L., Mauvie, A., Bernuau, D., 2008. Jun D cooperates with p65 to activate the proximal KB site of the cyclin D1 promoter: role of PI3K/PDK-1. Carcinogenesis 29 (3), 536-543.

West, A.P., Koblansky, A.A., Ghosh, S., 2006. Recognition and signaling by toll-like receptors. Annual Review of Cell and Developmental Biology 22, 409-437.

Arvind Saklani (a), Bindu Hegde (b), Prabha Mishra (c), Ruchi Singh (a), Monica Mendon (b), Debarshi Chakrabarty (c), Divya V. Kamath (d), Aurelio Lobo (c), Prabhu Dutt Mishra (e), Nilesh M. Dagia (d), Muralidhara Padigaru (c), Asha A. Kulkarni-Almeida (b), *

(a) Department of Natural Products - Botany, Piramal Healthcare Limited, 1 Nirlon Complex, Goregaon (East), Mumbai 400063, India I)

(b) Department of High Throughput Screening, Piramal Healthcare Limited, I Nirlon Complex, Goregaon (East), Mumbai 400063, India r

(c) Department of Biomarkers, Piramal Healthcare Limited, 1 Nirlon Complex, Goregaon (East), Mumbai 400063, India

(d) Department of Pharmacology, Piramal Healthcare Limited, 1 Nirlon Complex, Goregaon (East), Mumbai 400063, India

(e) Department of Natural Products - Chemistry, Piramal Healthcare Limited, 1 Nirlon Complex, Goregaon (East), Mumbai 400063, India

Abbreviations: TNF-[alpha], tumor necrosis factor-alpha; IL-6, interleukin-6; LPS, lipopolysaccharide; RA, rheumatoid arthritis; interleukin-1 beta; ACR70, American College of Rheumatology 70% response index; PMA, phorbol 12-myristate 13-acetate; RPMI 1640, Roswell Park Memorial Institute 1640; FBS, fetal bovine serum; hPBMC, human peripheral blood mononuclear cells; ELISA, enzyme linked immunosorbent assay; NF-KB, nuclear factor-[kappa]B; GFP, green fluorescence protein; TNFSF10, tumor necrosis factor superfamily-10; IRF1, Interferon regulatory factor 1; PTGS2, prostaglandin-endoperoxide synthase 2; BCL-2, B-cell lymphoma 2; IL-18, interleukin-18; NF-KB1A, nuclear factor-[kappa]B IA; TRADD, TNF receptor type 1-associated death domain protein; TRAF-1, TNF receptor-associated factor-1; CCND1, cyclin D1.

* Corresponding author at: Department of High Throughput Screening, Piramal Healthcare Limited, 1 Nirlon Complex, Goregaon (East), Mumbai 400063, India. Tel.: +91 22 30818419; fax: +91 22 30818036.

E-mail addresses: asha.almeida@piramal.com, asha_almeida@yahoo.co.in (A.A. Kulkarni-Almeida).

0944-7113/$ - see front matter [c] 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2012.05.016
COPYRIGHT 2012 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:nuclear factor kappa B
Author:Saklani, Arvind; Hegde, Bindu; Mishra, Prabha; Singh, Ruchi; Mendon, Monica; Chakrabarty, Debarshi;
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9INDI
Date:Aug 15, 2012
Words:7004
Previous Article:Carotenoids reverse multidrug resistance in cancer cells by interfering with ABC-transporters.
Next Article:Anti-inflammatory effects and hepatotoxicity of Tripterygium-loaded solid lipid nanoparticles on adjuvant-induced arthritis in rats.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters