Printer Friendly

Mutation analysis for detection of drug resistance in mycobacterium tuberculosis isolates from Khyber Pakhtunkhwa, Pakistan.

Byline: Bashir Ahmad, Muhammad Idrees, Kafeel Ahmad, Shumaila Bashir, Sajjad Ahmad and Huang Lin-fang


Objective: To examine the frequency and distribution of mutations in the 'hot spot regions' of drug-resistant genes.

Methods: The study was conducted at Provincial Tuberculosis Reference Laboratory, Peshawar, Pakistan, from April 2015 to March 2016, and comprised sputum samples. Isolates were tested for drug susceptibility and resistant isolates were investigated for mutations analysis in the 'hot spot regions' of rpoB, rpsL, embB, pncA, gyrA and gyrB genes.

Results: Of the 163 isolates, 47(28.8%) isolates were resistant to streptomycin, 56(34.36%) to rifampicin, 31(19%) to ethambutol, 16(9.82%) to pyrazinamide and 59(36.2%) isolates were resistant to ofloxacin. Resistant isolates were randomly selected for mutation analysis. Moreover, 14(25%) rifampicin-resistant isolates were analyed for mutation in rpoB gene. Ser450Leu, Asp435Gly, Ser450Gln, Gly455Asp and Pro454His mutations were detected in the selected isolates. Furthermore, 16(34%) streptomycin-resistant isolates were analysed for mutation in rpsL gene. Lys43Arg, Lys88Arg and Lys111Ile mutations were detected in rpsL gene of 6(37.5%) isolates. Besides, 16(51.6%) ethambutol-resistant isolates were analysed for mutations in embB mutation; Ala281val, Met306Leu and Met306Val mutations were detected in 10(10(62.5%) isolates. Also, 8(50%) pyrazinamide-resistant isolates were analysed for mutation in pncA gene.

Conclusion: Some novel mutations were found in rpoB, rpsL and pncA genes.

Keywords: Mycobacterium tuberculosis, Antibiotic resistance, Mutation, Sequencing. (JPMA 67: 1684; 2017)


Tuberculosis is a global health problem common in developing countries and its early detection and proper treatment is important to save human life. Mycobacterium (M.) tuberculosis transfers from patient to healthy individuals through air.1 In one year it can infect 10 to 15 people if left untreated. Tuberculosis (TB) could be easily acquired by people living in regions where TB is endemic, those in direct contact with TB patients and those having weak immune system.As first treatment option, the first-line TB drugs are normally used against M. tuberculosis. Multiple drug-resistant tuberculosis (MDR-TB) strains have been evolved that are resistant to at least two first-line drugs. MDR-TB is treated with second-line drugs.

The first-line drug rifampicin binds to the beta (b)-subunit of ribonucleic acid (RNA) polymerase which blocks the elongation of messenger RNA. Mutations in hyper-variable regions of rpoBgene result in rifampicin-resistant strains.2 Streptomycin is an aminocyclitol glycoside antibiotic that was the first antibiotic used in the treatment of TB. Its mechanism of action is to bind with 16S ribosomal ribonucleic acid (rRNA) and inhibit translation initiation.3 Streptomycin resistance develops due to mutations in rpsL and rrS genes which are involved in the synthesis of ribosomal proteins.4 Ethambutol (EMB) targets the cell wall of M. tuberculosis through interfering with arabinosyl transferases which are encoded by embB gene and are involved in cell wall synthesis.

EmbB gene mutations at codons 306, 406 and 497 are accountable for low and moderate levels of EMB resistance.5,6 Pyrazinamide (PZA) is a structural analogue of nicotinamide. It is converted to pyrazinoic acid (active form of pyrazinamide) by the enzyme pyrazinamidase/nicotinamidase that is coded by pncA gene. Mutations in pncA gene contribute to pyrazinamide resistance in M. tuberculosis. The second-line drug ofloxacin inactivates M. tuberculosis by binding to gyrase-deoxyribonucleic acid (DNA) complexes and inhibiting DNA replication. Ofloxacin-resistant strains develop through mutations in quinolone resistance-determining regions of gyrA and gyrB genes which code for DNA topoisomerase gyrase.

Khyber Pakhtunkhwa (KPK) province of Pakistan is a high burden TB region of Pakistan. The current study was planned to examine the frequency and distribution of mutations in the 'hot spot regions' of rpoB, rpsL, embB, pncA, gyrA and gyrB genes among clinical isolates.

Materials and Methods

The study was conducted at Provincial TB Reference Laboratory, Peshawar, Pakistan, from April 2015 to March 2016, and comprised sputum samples. Informed consent was obtained from all participants. Approval was obtained by the ethics committee of the Centre of Biotechnology and Microbiology, University of Peshawar. BACTEC 960 was used for culturing M. tuberculosis. Drug susceptibility testing (DST) of positive isolates was performed using BD BACTEC MGIT 960 SIRE kit (Cat No: 245123, Becton, Dickinson).

Heat and sonication method for DNA extraction was used to isolate DNA from M. tuberculosis.7,8 Amplification of the hotspot regions of rpoB, rpsL, embB, pncA, gyrA and gyrB genes was carried out in a thermal cycler [Eppendorf AG 22331 Hamburg] using pre-made master mix (Solis BioDyne-5X FIREPolA(r) Master mix) according to the manufacturer's instructions. Briefly, 4mL master mix (Solis BioDyne-5X FIREPolA(r) Master mix), 0.5mL reverse and forward primer each and 15mL polymerase chain reaction (PCR) grade water were used to make 25ml reaction. The hotspot region of rpoB gene was amplified using primers described by Telanti et al.9 The reaction profile for rpoB gene consisted of: initial denaturation at 94AdegC for 5 minutes followed by 20 cycles of denaturation at 94AdegC for 1minute, annealing at 52.9AdegC for 1 minute and extension at 72AdegC for 1 minute, and final elongation at 72AdegC for 8 minutes.

The hotspot region of rpsL gene was amplified using primers described by Elif et al.10 The reaction profile for rpsL gene consisted of: initial denaturation at 94AdegC for 5 minutes, followed by 35 cycles of denaturation at 94AdegC for 1 minute, annealing at 57AdegC for 1 minute and extension at 72AdegC for 1 minute, and final extension at 72AdegC for 10 minute. The reaction profile for embB gene consisted of: initial denaturation at 95AdegC for 10 minutes, followed by 35 cycles of denaturation at 95AdegC for 45 seconds, annealing at 56AdegC for 1 minute and extension at 72AdegC for 40 seconds, and final elongation at 72AdegC for 8 minutes. Primers for gyrA and gyrB genes amplifications were designed as shown in Table-1.

Table-1: Primers used for amplifications and sequencing.

Genes###Primers###Sequences 5'g3'###Product size (bp)###Reference

rpoB###TR8###TGCACGTCGCGGACCTCCA###157###Talenti et al. (1997)9


rpsL###rpsl1###GGCCGCAACAGAACGT###500###(Elif et al., 2005)10


embB###emBF###CGTGGTGATATTCGGCTTCC###900###(Self designed)


pncA###H37Rv-F###GGCGTTGATCATCGTCGAC###528###(Self designed)


gyrA###gyrA. F###ACCGGTTGACATCGAGCA###626###(Self designed)


gyrB###gyrB.F###CCCACTGGTTTGAAGCCAA###628###(Self designed)


The reaction profiles for both genes consisted of initial denaturation at 94AdegC for 5 min followed by 35 cycles of denaturation at 94AdegC for 30 seconds, annealing at 55AdegC for 40 sec and extensiton at 72AdegC for 50 seconds, and final elongation at 72AdegC for 8 min. Primers were designed for pncA gene amplification as given in Table-1. The reaction profile was similar to gyrA and gyrB genes except annealing temperature of 59AdegC. PCR products were analyzed by gel electrophoresis using 1.5% agarose concentration. Gel documentation system (SYNGENE Serial number SYDR/2138) was used for visualization.

PCR products of each gene were sequenced through Macrogen (Korea) using both forward and reverse primers. ExoSAP purification kit was used for PCR product purification. The purified products were sequenced both with forward and reverse primers using BigDye Terminator V3.1 kit and ABI 3730xl DNA analyser (96 capillary type). The sequencing results were compared with reference M. tuberculosis H37Rv sequence using BioEdit sequence alignment editor (version


Of the 794 samples, 163(20.53%) were positive. Of them, 56(34.36%) samples showed resistance to rifampicin, 47(28.8%) samples to streptomycin, 31(19%) to ethambutol, 16(9.82%) to pyrazinamide and 59(36.2%) to ofloxacin (Table-2).

Table-2: Multidrug resistance profiles of Mycobacterium tuberculosis isolates.

S.No###Conc (ug/mL)###Drugs###Resistant strains###Sensitive strains






Moreover, 14(25%) rifampicin-resistant isolates were randomly selected and analysed for mutation in rpoB gene. All of them showed mutations in rpoB gene. Ser450Leu mutation was detected in 6(42.9%) isolates, Asp435Gly mutation in 2(14.3%) isolates, Ser450Gln mutation in 2(14.3%) isolates, double mutation of Ser450Leu and Pro454His in 2(14.3%) isolates, and double mutation of Ser450Leu and Gly455Asp was detected in 2(14.3%) isolates.

Furthermore, 16(34%) streptomycin-resistant isolates were analysed for mutation in rpsL gene. Of them, 6(37.5%) isolates showed rpsL gene mutations. Lys43Arg mutation was observed in 2(12.5%) isolates. Lys88Arg mutation was detected in 2(12.5%) isolates. A novel Lys111Ile mutation was observed in 2(12.5%) isolates.

Also, 16(51.6%) ethambutol-resistant isolates were analysed for mutation in embB gene. Of them, 10(62.5%) isolates showed embB mutation at either codon 281 or 306 or both. Ala281val mutation was observed in 4(25%) isolates and Met306Leu mutation was observed in 2(12.5%) isolates. Double mutation of Met306val and Ala281val was observed in 2(12.5%) isolates. Another double mutation of Met306Leu and Ala281val was also observed in 2(12.5%) isolates.

Besides, 8(50%) pyrazinamide-resistant isolates were analysed for mutation in pncA gene. Of them, 6(75%) isolates had mutations. Insertion of G at position 392 was observed in 2(25%) isolates. Gln141Pro mutation was observed in 1(12.5%) isolate. Double mutation of Ser65Ser* and Gly132Ser was observed in 1(12.5%) isolate. Double mutation of Ser65Ser and Cys138Stop was observed in 1(12.5%) isolate. Among 20(33.9%) ofloxacin-resistant isolates analysed for mutation in gyrA gene, 9(45%) isolates showed Asp94Gly mutation. All isolates showed Ser95Thr mutation.

No mutation was found in gyrB gene among the 20(33.9%) ofloxacin-resistant isolates analysed for mutation in gyrB gene (Table-3).

Table-3: Mutations in M. tuberculosis genes that confer resistance to 1st and 2nd line drugs.

Gene###Codon/nucleotide change(s)###Amino acid/nucleotide change(s)###Total. No of isolates

rpoB###TCG to TTG###Ser450Leu###6

###GAC to GGC###Asp435Gly###2

###TCG to CAG###Ser450Gln###2

###TCG to TTG and###Ser450Leu1 and Pro454His###2

###CCC to CAC

###TCG to TTG and###Ser450Leu and Gly455Asp###2

###GGC to GAC

rpsL###AAG to AGG###Lys43Arg###2

###AAG to AGG###Lys88Arg###2

###AAA to ATA###Lys111Ile###2

embB###ATG to CTG###Met306Leu###2

###GCC to GTC###Ala281Val###4

###ATG to GTG and###Met306val and Ala281Val###2

###GCC to GTC

###ATG to CTG and###Met306Leu and Ala281Val###2

###GCC to GTC

pncA###CAG to CCG###Gln141Pro###1

###TCC to TCT and###Ser65Ser* and Gly132Ser###1

###GGT to AGT

###G insertion###Frame shift+392G###2

###TCC to TCT###Ser65Ser* and Cys138Stop###1

###and TGT to TGA

gyrA###GAC to GGC###Asp94Gly###9

The mutation results are shown in Table-3.

Novel sequences determined in the current study were recently deposited in the gene bank database (accession no. KX501217, KX501218 and KX501219).


Mutations in M. tuberculosis genome play an important role in the development of resistance against antibiotics used for treatment of tuberculosis. Reports across the globe have highlighted this aspect of M. tuberculosis adoptability to resist various treatment options. The KPK province is a high-burden TB region of Pakistan, but little information is available about the molecular characteristics of M. tuberculosis strains prevailing. Current research reports for the first time the molecular characterisation of extensive drug resistance among TB isolates from Khyber Pakhtunkhwa province of Pakistan.

Among all the available anti-tuberculosis drugs, molecular mechanisms of rifampicin resistance mechanisms is most completely understood and it is recognised that mutations within the hotspot region of rpoB occur in 95% or more of rifampicin-resistant isolates.7,8 Rifampicin resistance due to common mutation at codons 531, 516, and 526 of the rpoB gene is consistent with data from Pakistan and other countries.11-15 We observed a high frequency of mutations at codon 450, 435, 454 and 455 of rpoB gene. Mutations reported in the current study are not commonly observed mutations, however, they have been reported in studies conducted in South Africa and Mexico.16,17 One novel mutation, i.e. Gly455Asp, in rpoB gene was reported in the current study. Phenotypic resistance to rifampicin was 100% correlated with mutations in the hot spot region of rpoB gene indicating a need for studying molecular characteristics of the isolates along with conventional drug susceptibility testing.

Streptomycin-resistant strains are developed due to mutations in rpsL and rrS genes. We found 37.5% mutation frequency in rpsL gene in streptomycin-resistant isolates, similar to a study performed in Barcelona which reported 24.6% rpsL gene frequency.18 The most common (Lys43Arg and Lys88Arg) mutations in rpsL gene reported in our study have also been reported in isolates from patients in Punjab, Pakistan, and from Barcelona.1,18 Lys111Ile novel mutation detected in streptomycin-resistant isolates could have a role in streptomycin resistance.

The importance of mutations in embB gene, particularly those at codon 306, had been controversial because similar kinds of mutations have been detected in both ethambutol-resistant and susceptible isolates.19 The most common mutations in embB gene observed in our study were Met306Leu, Met306val and Ala281Val. The results of the current study are in line with previous studies from Poland and India.20-22

We also observed different types of pncA mutations associated with PZA resistance. Mutations in pncA gene found in the current study have also been reported worldwide.23-26

Resistance to fluoroquinolones in M. tuberculosis has been mostly attributed to gyrA mutations. Asp94Gly mutation frequency was 48.7% in a study conducted in China which is similar to our study (45%).27 Asp94Gly mutation has been reported both regionally and globally.11,28 All the isolates studied showed Ser95Thr mutation which is a naturally occurring mutation that is not linked to fluoroquinolone resistance, as it occurs in both fluoroquinolone-susceptible and fluoroquinolone-resistant strains. In the current study no mutation was found in gyrB gene among ofloxacin-resistant isolates.

Distributions of various mutations associated with drug resistance in the studied population are somehow different from those reported globally. These variations in mutations coupled with drug resistance might be due to geographical distribution of the distinct strains."


Distributions of various mutations associated with drug resistance were somehow different from those reported globally. Some novel mutations in rpoB, rpsL and pncA genes were also observed.


We are grateful to Sajid Ali for providing facilities at Provincial TB Reference Laboratory, Peshawar, Pakistan.

Disclaimer: None.

Conflict of Interest: Dr. Bashir Ahmad, the author of the manuscript, signed the ethical statement. He was the head of ethical committee. He was the senior most professor and according to rules and regulations the senior most professor should be the head of ethical committee.

Source of Funding: The project was supported by the Higher Education Commission under the 5000 Indigenous Scholarship Scheme.


1. Khan SN, Niemann S, Gulfraz M, Qayyum M, Siddiqi S, Mirza ZS, et al. Molecular characterization of multidrug-resistant isolates of Mycobacterium tuberculosis from patients in Punjab, Pakistan. Pak J Zool. 2013; 45: 93-100.

2. KuninCM.Antimicrobial activity of rifabutin. Clin Infect Dis. 1996; 22: S3-14.

3. Moazed D, Noller HF. Interaction of antibiotics with functional sites in 16S ribosomal RNA. Nature. 1987; 327: 389-94.

4. Springer B, Kidan YG, Prammananan T, Ellrott K, Bottger EC, Sander P. Mechanisms of streptomycin resistance: selection of mutations in the 16S rRNA gene conferring resistance. Antimicrob Agents Chemother. 2001; 45: 2877-84.

5. Safi H, Fleischmann RD, Peterson SN, Jones MB, Jarrahi B, AllandD.Allelic exchange and mutant selection demonstrate that common clinical embCAB gene mutations only modestly increase resistance to ethambutol in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2010; 54: 103-8.

6. Plinke C, Walter K, Aly S, Ehlers S, NiemannS. Mycobacterium tuberculosis embB codon 306 mutations confer moderately increased resistance to ethambutol in vitro and in vivo. Antimicrob Agents Chemother. 2011; 55: 2891-6.

7. Buck GE, O'Hara LC, Summersgill JT. Rapid, simple method for treating clinical specimens containing Mycobacterium tuberculosis to remove DNA for polymerase chain reaction. J Clin Microbiol. 1992; 30: 1331-4.

8. Kirschner P, Springer B, Vogel U, Meier A, Wrede A, KiekenbeckM,etal. Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year experience in a clinical laboratory. J Clin Microbiol 1993; 31: 2882-9.

9. Telenti A, Honore N, Bernasconi CA, March J, Ortega A, Heym B, et al. Genotypic assessment of isoniazid and rifampin resistance in Mycobacterium tuberculosis: a blind study at reference laboratory level. J Clin Microbiol 1997; 35: 719-23.

10. ElifOzturk C, AhmetSanic, Demet Kaya, Ismail Ceyhan. Molecular analysis of Isoniazid, Rifampicin and Streptomycin Resistance in Mycobacterium tuberculosis isolates from Patients with Tuberculosis in Duzce, Turkey. Jpn J Infect Dis. 2005; 58: 309-12.

11. Campbell PJ, Morlock GP, Sikes RD, Dalton TL, Metchock B, Starks AM, et al. Molecular detection of mutations associated with first-and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2011; 55: 2032-41.

12. Parsons LM, Somoskovi A, Gutierrez C, Lee E, Paramasivan CN, Abimiku AL, et al. Laboratory diagnosis of tuberculosis in resource-poor countries: challenges and opportunities. Clin Microbiol Rev. 2011; 24: 314-50.

13. Ajbani KC, Rodrigues, Shenai S, Mehta A. Mutation detection and accurate diagnosis of extensively drug-resistant tuberculosis: report from a tertiary care center in India. J Clin Microbiol. 2011; 49: 1588-90.

14. Ali A, Hasan Z, Moatter T, Tanveer M, Hasan RM. tuberculosis Central Asian Strain 1 MDR isolates have more mutations in rpoB and katG genes compared with other genotypes. Scand J Infect Dis. 2009; 41: 37-44.

15. Sun Z. Characterization of extensively drug-resistant Mycobacterium tuberculosis clinical isolates in China. J Clin Microbiol. 2008; 46: 4075-7.

16. Ramaswamy SV, Dou SJ, Rendon A, Yang Z, Cave MD, Graviss EA. Genotypic analysis of multidrug-resistant Mycobacterium tuberculosis isolates from Monterrey, Mexico. J Med Microbiol. 2004; 53: 107-13.

17. Ioerger TR, Koo S, No EG, Chen X, Larsen MH, Jacobs WR Jr, et al. Genome analysis of multi and extensively-drug-resistant tuberculosis from KwaZulu-Natal, South Africa. PLoS One. 2009; 4: e7778.

18. Tudo G, Rey E, Borrell S, Alcaide F, Codina G, Coll P, et al. Characterization of mutations in streptomycin-resistant Mycobacterium tuberculosis clinical isolates in the area of Barcelona. J Antimicrob Chemother. 2010; 65: 2341-6.

19. Srivastava S, Ayyagari A, Dhole TN, Nyati KK, Dwivedi SK. emb nucleotide polymorphisms and the role of embB 306 mutations in Mycobacterium tuberculosis resistance to ethambutol. Int J Med Microbiol. 2009; 299: 269-80.

20. Bakula Z, Napiorkowska A, Bielecki J, Augustynowicz-Kopec E, Zwolska Z, Jagielski T. Mutations in the embB gene and their association with ethambutol resistance in multidrug-resistant Mycobacterium tuberculosis clinical isolates from Poland. Biomed Res Int 2013. [Online] [Cited 2013 Nov 21]. Available from URL:

21. Garg A, Srivastava S, Ayyagari A, Katoch VM, DholeT N. embB gene mutations associated with ethambutolresistance in Indian strains of Mycobacterium tuberculosis. Curr Sci. 2006; 91: 1512.

22. Jain A, Mondal R, Srivastava S, Prasad R, Singh K, Ahuja RC. Novel mutations in emb B gene of ethambutol resistant isolates of Mycobacterium tuberculosis: a preliminary report. Ind J Med Res. 2008; 128: 634.

23. Marttila HJ, Marjamaki M, Vyshnevskaya E, Vyshnevskiy BI, Otten TF, Vasilyef AV, et al. pncA Mutations in Pyrazinamide-Resistant Mycobacterium tuberculosis Isolates from Northwestern Russia. Antimicrob Agents Chemother.1999; 43: 1764-6.

24. Somoskovi A, Dormandy J, Parsons LM, Kaswa M, Goh KS, Rastogi N, et al. Sequencing of the pncA gene in members of the Mycobacterium tuberculosis complex has important diagnostic applications: identification of a species-specific pncA mutation in "Mycobacterium canettii" and the reliable and rapid predictor of pyrazinamide resistance. J ClinMicrobiol.2007;45:595-9.

25. Miotto P, Cabibbe AM, Feuerriegel S, Casali N, Drobniewski F, Rodionova Y, et al. Mycobacterium tuberculosis pyrazinamide resistance determinants: a multicenter study. MBio. 2014; 5: e01819-14.

26. Zhang H, Bi LJ, Li CY, Sun ZG, Deng JY, Zhang XE. Mutations found in the pncA gene of Mycobacterium tuberculosis in clinical pyrazinamide-resistant isolates from a local region of China. J Int Med Res. 2009; 37: 1430-5.

27. Yuan X, Zhang T, Kawakami K, Zhu J, Li H, Lei J,et al. Molecular characterization of multidrug and extensively drug-resistant Mycobacterium tuberculosis strains in Jiangxi, China. J Clin Microbiol. 2012; 50: 2404-13.

28. Ali A, Hasan R, Jabeen K, Jabeen N, Qadeer E, Hasan Z. Characterization of mutations conferring extensive drug resistance to M. tuberculosis isolates in Pakistan. Antimicrob Agents Chemother. 2011; 55: 5654-9.
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Pakistan Medical Association
Geographic Code:9PAKI
Date:Nov 30, 2017
Previous Article:Prognostic importance of paraoxonase, arylesterase and mean platelet volume efficiency in acute ischaemic stroke.
Next Article:Frequency and pattern of common primary headache among depressed patients at tertiary care centre, Karachi.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters