Printer Friendly

Morbillivirus de los delfines: patogeno re-emergente en la poblacion de cetaceos.

Dolphin Morbillivirus: Re-emerging pathogen in cetacean population

Morbillivirus dos Golfinhos: Patogeno re-emergentes em populacoes de cetaceos

Introduccion

Desde finales de los anos 80 y hasta la actualidad, el Morbillivirus cetaceo ha emergido como el patogeno de mayor importancia en este grupo de animales causando grandes epidemias en los oceanos Atlantico, Pacifico y Mediterraneo principalmente (Fowler & Cubas 2001).

Hasta mediados de 1988 se penso que el genero Morbillivirus, perteneciente a la familia Paramixoviridae, estaba conformado por cuatro tipos de virus: el virus del sarampion (MV), el virus del moquillo canino (CDV), el virus de la peste bovina y el virus de la peste de los pequenos rumiantes; y es a partir de 1994 en que se anade a este genero una nueva especie: el morbillivirus cetaceo o "Cetacean morbillivirus" (CeMV) el cual se ha subdividido en tres grupos claramente diferenciados: el morbillivirus de las marsopas (PMV; Kennedy 1998), el morbillivirus de los delfines (DMV; Osterhaus et al. 1992, Barrett et al. 1993) y el morbillivirus de las ballenas piloto (PWMV; Taubenberger et al. 2000).

Recientemente, se ha visto un gran aumento de muertes o varamientos de delfines asociadas a la infeccion por el CeMV; por lo que la presente revision presenta una actualizacion critica sobre los aspectos basicos, clinicos y epidemiologicos de una de las infecciones emergentes mas importantes para la fauna cetacea mundial, haciendo especial enfasis en las alternativas actuales para su diagnostico y control. Para lograr este proposito se siguio una estrategia heuristica de busqueda bajo el uso de palabras clave de interes (Morbillivirus, Cetacean, Dolphin, etc.) en idioma ingles para ampliar la captura de informacion y sus combinaciones mediante el uso de conectores boleanos y funciones de limites en las bases de datos MedLine, SciELO, Scopus[R] y Google Scholar.

Caracterizacion de los CeMV: Los CeMV son virus de genoma RNA de una sola hebra de sentido negativo; puntualmente el DMV esta compuesto de 15.702 bases (NCBI Ref SeqNC_005283.1; Figura 1) que contiene seis genes los cuales codifican para ocho proteinas, dos no estructurales y seis estructurales que se organizan en sentido 3'- 5': nucleoproteina (N)--fosfoproteina (P)--proteina de la matriz (M)--proteina de fusion (F)--proteina hemaglutinina (H)--y (L) proteina grande (Rima et al. 2005).

[FIGURA 1 OMITIR]

El DMV fue descrito por primera vez en 1990, en un varamiento de delfines listados (Stemlla coeruleoalba) en la costa mediterranea de Espana; en dicho varamiento, las muertes comenzaron en la costa de Valencia y se extendieron a las costas mediterraneas francesas y del norte de Africa. Los principales hallazgos patologicos encontrados indicaron la presencia de encefalitis y neumonia intersticial difusa. En estos animales se encontro la presencia de antigenos de Morbillivirus en los pulmones, el cerebro, los ganglios linfaticos, y el epitelio biliar y fue posible aislar un Morbillivirus de algunos tejidos (Domingo et al. 1990).

El PMV se describio por primera vez en marsopas comunes (Phocoena phocoena) durante un brote de moquillo en la costa de Irlanda del Norte, en las cuales se detecto la presencia de antigeno de morbillivirus en inclusiones intracitoplasmaticas en neuronas y astrocitos al igual que en el epitelio bronquial y bronquiolar (Kennedy 1998).

Recientemente, estudios realizados en una ballena piloto de aleta larga (Gkbicephalus melai) varada en costas de New Jersey (USA), demostraron la presencia de lesiones macro y microscopicas indicativas de infeccion por un Morbillivirus (cuerpos de inclusion intracitoplasmaticos en diversos organos, encefalomielitis no supurativa, etc.) y la presencia de secuencias genomicas de una nueva cepa de Morbillivirus relacionado con los CeMV, el cual fue denominado PWMV (Taubenberger et al. 2000).

En 2005, siguiendo los criterios recomendados por la Organizacion Mundial de la Salud para la caracterizacion genotipica de aislamientos del MV, los cuales se basan en amplificacion y secuenciacion de la region C-terminal de la proteina N y la secuencia completa de la hemaglutinina viral, se demostro que, debido a la baja divergencia aminoacidica entre estos, el DMV y el PMV se consideran dos cepas de una misma especie viral (Van de Bildt et al. 2005).

Filogeneticamente, es posible evidenciar la relacion existente entre distintos morbillivirus de la familia Paramyxoviridae (Figura 2). Adicionalmente se puede notar como en el analisis de los genes N y P, el PMWV se agrupa en la misma ciada con los PMV y DMV, con un valor de soporte de rama de moderado a alto y claramente distante de otros morbillivirus de rumiantes y de carnivoros (Figura 2), lo cual sugiere que el PWMV posee un ancestro comun con el DMV o el PMV (Taubenberger et al. 2000).

[FIGURA 2 OMITIR]

Patogenesis de la infeccion: El DMV es uno de los virus mas patogenicos de los CeMV, afecta a diferentes especies de cetaceos, entre los cuales, los delfines mulares (Tursiops truncatus) y los delfines listados son las especies que presentan mayores tasas de mortalidad a causa del agente. Al igual que los demas miembros del genero Morbiluvirus, el DMV es un virus linfotropico, epiteliotropico y neurotropico, por tanto y como consecuencia de la infeccion, los animales presentan deplecion de ganglios linfaticos, lesiones pulmonares, lesiones en piel y serias alteraciones en el comportamiento que pueden ser la causa de los varamientos. Adicionalmente, se han reportado casos de delfines listados infectados, que presentan encefalitis no supurativa en grados de subaguda a cronica, con lesiones cerebrales que se asemejan mucho a las que se encuentra en humanos en la "panencefalitis esclerosante subaguda" (Domingo et al. 1995) y en caninos en las "encefalitis del perro viejo" (Soto et al. 2011). Cabe resaltar que dichas lesiones se han asociado al MV y CDV en humanos y caninos respectivamente.

Una interesante discusion se ha abierto en los ultimos anos acerca del mecanismo a traves del cual el DMV (y otros morbillivirus) logra cruzar la barrera hemato-encefalica previa a la invasion del parenquima cerebral del huesped junto a sus poblaciones neuronales residentes. Una posible respuesta parece residir en la existencia de cepas virales con comportamiento neurotropico selectivo y exclusivo, el cual debe estar determinado por la interaccion especifica del DMV con una molecula receptora de forma selectiva y consistentemente expresada por las neuronas (Di Guardo 2012, Di Guardo et al. 2013).

Tambien es importante mencionar que hasta el momento se desconoce como puede variar la sensibilidad a la infeccion por Morbillivirus entre una especie y otra de delfines, lo que si esta claro es que la molecula receptora a nivel de los linfocitos, conocida como SLAM, es la molecula encargada de permitir la invasion y propagacion del morbillivirus. Varios estudios han intentado clarificar cual es el papel del SLAM y han encontrado que variaciones en el dominio V de esta pueden acarrear mayor o menor afinidad por el morbillivirus, lo cual constituye un nuevo acercamiento en la determinacion de la vulnerabilidad que algunas especies puedan tener por la infeccion con este virus (Di Guardo 2012). Sin embargo, un estudio publicado (Belliere et al. 2009), con base en analisis filogeneticos de secuencias de los distintos tipos de CeMV y su asociacion con las tasas de mortalidad de los varamientos, la especie hospedadora y la distribucion geografica, indica que existe un grupo de CeMV (al cual pertenece el PWMV) cuyos virus tienen un rango de hospedador mas restringido, una distribucion geografica mas reducida, asi como un porcentaje de mortalidad menor en comparacion con los otros dos grupos en los cuales se encuentran los (PMV y DMV). En general, el DMV posee parametros epidemiologicos que pueden impactar seriamente a la poblacion de cetaceos (Belliere et al. 2009; Tabla 1).

El virus se transmite probablemente por via horizontal y por contacto directo. Hasta el momento no se ha reportado predisposicion por sexo, y se ha descrito que pueden presentarse infecciones mixtas entre diferentes tipos de morbillivirus (Taubenberger et al. 1996). Adicionalmente, se han reportado coinfecciones entre el DMV, brucella spp y Toxoplasma ?ondulas cuales pueden aumentar la patologia y el dano a los animales (VanBressem et al. 2009, Mazzariol et al. 2012). A pesar que hasta la fecha no se tienen reportes de algun potencial zoonotico del DMV (Dierauf & Gulland 2001), los saltos de especie vistos en esta y otras especies de Morbillivirus como el CDV han generado algunas de las investigaciones que se estan ejecutando actualmente, las cuales pretenden brindar nuevas perspectivas al respecto tanto para el DMV como para los demas CeMV (Ludlow et al. 2014).

Distribucion y epidemiologia: En America, 14 de las 18 especies de Odontocetos en el Atiantico Oeste, desde el Artico canadiense hasta el Golfo de Mexico, presentan anticuerpos contra el CeMV; en Centroamerica y Sudamerica, a pesar de no conocerse datos exactos respecto a la prevalencia del CeMV, existe evidencia serologica que demuestra la presencia de CeMV, particularmente en Peru (Van Bressem et al. 1998a). Lo anterior, plantea la posibilidad que tambien este presente en Centroamerica, dado que varias especies cetaceas migran anualmente en direccion norte-sur a lo largo del continente americano y estas pueden actuar como vectores y reservonos biologicos del CeMV Esta situacion supone un riesgo inminente para las demas especies de cetaceos ubicados en el centro y sur del continente americano (Fowler & Cubas 2001). Dentro de este contexto, el estudio se centro en el impacto que el DMV ha venido teniendo y tiene sobre la poblacion mundial de delfines.

En Norteamerica, la primera evidencia de anticuerpos contra Morbillivirus se obtuvo en delfines mulares en la costa atiantica de los Estados Unidos durante la primera epidemia ocurrida entre los anos 1987 y 1988 (Geraci 1989), aunque la cifra exacta no se conoce se estima que el 50% de la poblacion costera de estos delfines murieron durante este evento, lo que represento una mortalidad 10 veces mayor de lo normal (Scott et al. 1988, McLellan et al. 2002). Sin embargo, la mortalidad mas alta registrada por el DMV ocurrio en el periodo comprendido entre 1990 y 1992, en donde se registro un brote en el mar mediterraneo que afecto a los delfines listados (Aguilar & Raga 1993). En Grecia particularmente, 63 de estos delfines murieron junto con otros 66 de cinco especies diferentes desde julio de 1991 hasta finales de diciembre 1992. La propagacion del virus a lo largo de esta area continuo hacia el sur-este y luego hacia el norte-este del foco original en el mar Jonico (Daniel 1995). Anos mas tarde, un estudio confirmo la infeccion cronica por DMV en 42 delfines listados del mediterraneo, encontrando infecciones sistemicas en 36 individuos y lesiones locales cerebrales en 6 individuos (Domingo et al. 1995).

Mas recientemente, entre el 2006 y el 2008, se presentaron nuevos brotes a lo largo de la costa mediterranea espanola y francesa, en donde tres especies diferentes de cetaceos frieron infectados por el DMV: el delfin listado, el delfin mular y la ballena piloto de aleta larga (Globicephala melas; Belliere et al. 2011). La epidemia empezo afectando a las ballenas piloto de aleta larga en el Estrecho de Gibraltar entre octubre de 2006 y abril de 2007 (Fernandez et al. 2008). Especificamente, los resultados sugieren que el virus pudo realizar el salto de especie a la ballena piloto de aleta larga por la fijacion de una mutacion de una alanina por una valina en el dominio N -terminal de la proteina de iusion (Belliere et al. 2011). De igual modo, se reporto la infeccion por DMV en una foca en cautiverio (Phoca vitulina), con hallazgos patologicos consistentes con la infeccion por morbillivirus. El estudio confirmo la transmision de DMV entre especies de cetaceos y la infeccion en pinnipedos (Mazzariol et al. 2013). Este hallazgo es preocupante, dada la susceptibilidad documentada de las focas como la foca monje del Mediterraneo (Monachus monachus) y que estan en peligro de extincion (O'Mara et al. 1999), lo cual convierte a este virus en un potencial peligro para ciertas especies, como se ha visto con el moquillo canino (CDV) que se ha convertido en un riesgo para la conservacion de los tigres siberianos (Panthern tigis altaica,; Seimon et al. 2013) y nuevamente resalta la importancia del salto entre especies y el posible potencial zoonotico de estos agentes virales.

En el mismo brote, en el Mediterraneo espanol entre Julio y Octubre de 2007, se encontraron mas de 100 delfines listados varados: algunos muertos y en estado de descomposicion y otros vivos con serios problemas y lesiones neurologicas que murieron tras haber sido rescatados, y a finales del 2007 a lo largo de la costa francesa del Mediterraneo, el virus afecto a mas de cinco delfines mulares (Keck et al. 2010). Los resultados de los estudios realizados, mostraron que las cepas que ocasionaron las muertes de delfines y ballenas en este brote, son 99,9% identicas y deben ser consideradas el mismo DMV, ademas se encontro una similitud del 99,3 al 99,4% de ese virus con la cepa espanola que origino el brote de 1990 (Belliere et al. 2011). Teniendo en cuenta todo lo anterior, el estudio filogenetico y la zona geografica comun para los dos brotes, se sugiere que el DMV causante del brote de los anos 2006-2008, evoluciono a partir de la cepa responsable del brote de 1990. Algunos anos mas tarde, en 2011, a lo largo de la costa Valenciana mediterranea de Espana, se presento un varamiento masivo de delfines, que afecto por lo menos 26 delfines listados, tres delfines mulares y 8 delfines de especies no identificadas. Este evento, supero en solo dos meses la tasa de mortalidad normal de 28,4 delfines/ ano en esta costa (Gozalbes et al. 2010). Estudios histopatologicos y moleculares utilizando RT-PCR en tiempo real confirmaron la asociacion de estos varamientos con DMV (Rubio-Guerri et al. 2013b).

Sin embargo, apesar de los esfuerzos realizados en el estudio de la transmision y patogenesis del DMV tanto en Europa como en America, en Julio de 2013 se presenta un aumento de la mortalidad en delfines en la costa este de los Estados Unidos, principalmente en el area comprendida entre Nueva York y Virginia. Los resultados de estudios iniciales sugieren que este aumento corresponde a un nuevo brote del DMV que esta afectando a los delfines mulares. Los reportes indican que entre el 1 de Julio de 2013 y el 13 de abril de 2014 han resultado varados por lo menos 1219 delfines (Figura 3), en los cuales por lo menos 203 delfines se han confirmado como positivos para Morbillivirus (NOAA 2014).

Historicamente la mayor mortalidad reportada en la costa este de los EEUU, se alcanzo en el brote que duro desde junio de 1987 hasta mayo de 1988 en donde se tuvieron alrededor de 742 animales muertos. El comparar estos datos y determinar que este nuevo brote es uno de los mas agresivos de la historia, ha llevado a que el gobierno de los Estados Unidos haya declarado un "evento de mortalidad inusual", el cual se define como: "un varamiento inesperado que implica una significativa mortandad de cualquier poblacion de mamiferos marinos y exige una respuesta inmediata", una declaracion que desde el punto de vista legal permite enviar recursos federales y cientificos para ayudar a la contencion inmediata del evento (NOAA 2014).

[FIGURA 3 OMITIR]

Respecto a las causas reportadas de este "evento de mortalidad inusual", los resultados iniciales hacen pensar en la posibilidad que los brotes se estan presentando porque los huespedes se estan haciendo mas susceptibles inmunologicamente a la infeccion por el DMV debido a la contaminacion de su ambiente. En este sentido, un estudio recientemente publicado realizo una comparacion entre los dos grandes eventos epidemicos causados por el DMV (entre 1990-1992 y 2006-2008), y demostro que los niveles de organoclorados (OC) presentes en los delfines muestreados en el brote de 1990, fueron 10 veces mayores para bifenilos policlorados PCB y 6 veces mayores para DDT (Dicloro Difenil Tricloroetano), que los niveles de OC encontrados en los delfines del brote que comenzo en 2006. Sin embargo, esta investigacion tambien concluye que, debido a que la virulencia de la primera gran epidemia fue mucho menor, y que los delfines afectados no presentaron concentraciones de OC mas elevadas que los individuos aparentemente sanos. El aumento en los niveles de contaminantes organoclorados, no fue el factor primordial desencadenante del brote de 2006-2008 (Di Guardo et al. 2013).

Esta conclusion es controversial y debatida, ya que existen estudios que han logrado demostrar en investigaciones de campo, evidencia del efecto inmunotoxico de diferentes contaminantes ambientales en ballenas y delfines (Mori et al. 2006, 2008). Ademas, se ha reportado algunas propiedades inmunomoduladoras de diferentes xenobioticos persistentes en celulas linfoides de cetaceos tanto in vitro, como en modelos animales in vivo (Lahvis et al. 1995). Estos resultados, unidos a la opinion de varios autores (Van Bressem et al. 2009), proponen la contaminacion como un importante factor de riesgo frente a la infeccion de DMV en cetaceos. Sin embargo, la discusion sigue abierta, en espera de nuevos estudios que demuestren claramente la relacion entre estos contaminantes y la susceptibilidad de algunos cetaceos frente al DMV y otros CeMVs.

Endemia vs. Epidemia: Contrario a la fuerte presentacion epidemica reportada en la actualidad para la costa este de los Estados Unidos, la comparacion de los varamientos de delfines listados en el Mediterraneo occidental en los anos 1990, 2007 y 2011 sugiere un cambio en la epidemiologia del DMV; en 2011, la mortalidad fue aun mas baja, las lesiones fueron menos graves, y sobre todo los animales jovenes se vieron afectados (Rubio-Guerri et al. 2013a). Ya que las infecciones endemicas en la fauna se caracterizan por lesiones leves y cargas de patogenos mas bajas comparadas con las infecciones epidemicas (Sinclair et al. 2006), es posible que la epidemiologia del DMV en delfines listados en el Mediterraneo occidental este cambiando de una presentacion epidemica a una presentacion endemica, hecho que ha sido consistentemente reportado en los ultimos anos (Domingo et al. 1995, Belliere et al. 2011, Soto et al. 2011) al encontrarse cronicidad en la infeccion en animales post-brote; lo cual resalta la urgente necesidad de desarrollar estudios serologicos en poblaciones de delfines en estado libre que permitan esclarecer el nivel de presentacion y de circulacion del DMV en poblacion general, no solo en los varamientos.

Entre los diferentes estudios de los varamientos causados por DMV, se han presentado diferentes tactores de riesgo que se cree pueden desencadenar la emergencia de la infeccion en una zona geografica nueva o la aparicion en una zona en la que se consideraba controlada (re-emergencia). El estrecho contacto estrecho entre poblaciones costeras de delfines mulares con especies estuarinas (tanto de Tursiops tnmcatus como de Stenella coeruleoalba u otros) en las cuales el virus sea endemico (Duignan et al. 1996) puede llevar a la aparicion de un brote. La variacion geografica y la cepa asilada en los distintos brotes puede reflejar el movimiento de las especies de delfines y de los virus que las infectan; de hecho, recientemente se ha reportado que el solapamiento estacional de poblaciones costeras y estuarinas de delfines mulares en algunas epocas del ano puede favorecer la propagacion de la infeccion (Rosel et al. 2009). Igualmente se ha reportado que la densidad poblacional de delfines listados ha sido un factor determinante para el establecimiento de la infeccion de forma endemica en las costas mediterraneas (Forcada et al. 1994); indicando que densidad poblacional alta favoreceria la aparicion de una epidemia. En la re-emergencia de la infeccion en el Mediterraneo espanol en 2006-2007 (Raga et al. 2008, Van Bressem et al. 2009), se reporto que entre los individuos encontrados en los varamientos de delfines listados los individuos mayormente afectados han sido los juveniles (tanto machos como hembras) posiblemente debido a que los adultos habrian desarrollado inmunidad luego del anterior brote epidemico (Raga et al. 2008, Van Bressem et al. 2009); lo cual resalta la necesidad de desarrollar investigaciones en desarrollo e implementacion de vacunas que permitan desarrollar inmunidad especifica en dichas poblaciones.

Algunos factores de riesgo de tipo ambiental tambien han sido descritos como factores que pueden actuar de forma sinergica, aumentando la severidad de la infeccion y favoreciendo la re-emergencia de brotes en las poblaciones de delfines listados. Entre estos factores encontramos las interacciones conlapesca, la endogamia, las migraciones, las altas cargas de contaminantes en las aguas, el aumento de las temperaturas de la zona superficial del mar y la limitada disponibilidad de presas, las cuales han mostrado tener serios impactos acumulativos sobre la dinamica poblacional del delfin listado en las costas del mediterraneo (Van Bressem et al. 2009).

Diagnostico, prevencion y control: La base para sospechar que un varamiento es causado por el DMV son las lesiones macroscopicas encontradas a la necropsia de los animales. Estas lesiones abarcan entre otros, lesiones pulmonares con ausencia de colapso total de los pulmones, multiples focos de atelectasia y presencia ocasional de bronconeumonia exudativa en los lobulos apicales, con agrandamiento y edema de los ganglios linfaticos asociados al pulmon. Macroscopicamente se ha reportado la presencia de signos compatibles con encefalitis necrotizante multifocal y se ha observado estomatitis ulcerativa en la lengua o en las encias de los animales varados. Tambien es posible encontrar cambios en la coloracion de la grasa subcutanea con o sin presencia de edema subcutaneo acompanados de condiciones corporales pobres o suboptimas (Domingo et al. 1992, Di Guardo et al. 2013).

Desde el punto de vista histologico las lesiones mas frecuentemente reportadas son a nivel pulmonar la neumonia bronquiolo-intersticial y la presencia de celulas sincitiales en lesiones neumonicas. A nivel del sistema nervioso central la principal lesion reportada es la encefalitis no-supurativa difusa caracterizada principalmente por la presencia de manguitos perivasculares y presencia de sincitios en lesiones cerebrales, y a nivel del tejido linfoide la lesion principalmente reportada es la deplecion y necrosis con presencia de celulas sincitiales en nodulos linfoides mediastinicos, mesentericos y pre-escapulares (Domingo et al. 1992, Di Guardo et al. 2013).

En cuanto a la confirmacion molecular del DMV, el cerebro, los nodulos linfoides y los pulmones son los tejidos en los cuales el antigeno y genoma del Morbillivirus pueden ser detectados en delfines y en otros cetaceos como la ballena piloto de aleta larga (Fernandez et al. 2008). Para la deteccion del genoma, el metodo mas utilizado es la reaccion en cadena por polimerasa con transcripcion reversa (RT-PCR; Barrett et al. 1993, Reidarson et al. 1998), usando cebadores para el gen de la Fosfoproteina del DMV; y aunque para analisis filogeneticos posteriores, es posible utilizar secuencias de los genes de la nucleoproteina como de la fosfoproteina, este ultimo es el mas utilizado (Taubenberger et al. 2000; Figura 2). Se han disenado cebadores especificos para la deteccion del DMV mediante RT-PCR en tiempo real, los cuales tambien pueden ser utilizados en una RT-PCR convencional (Grant et al. 2009) con un producto de amplificacion esperado de 173 nucleotidos del domino C-terminal del gen N de los CeMV (Tabla 2) el cual permite diferenciar DMV de PMV Por sus caracteristicas tanto para diagnostico convencional como en PCR en tiempo real, esta es una de las pruebas mas recomendadas en la actualidad (Rubio-Guerri et al. 2013b). Sin embargo, recientemente se ha reportado una nueva variacion de RT-PCR en tiempo real que utiliza sondas pertenecientes a Universal Probe Library (UPL; Roche[R]) y cebadores especificos para CeMV que amplifican un segmento del gen que codifica para la proteina de fusion, la cual presenta mayor precision, sensibilidad y especificidad para la deteccion y diferenciacion de los DMV, PMV y PMWV (RubioGuerri et al. 2013b). Esta diferenciacion, cobra gran importancia cuando se presentan varamientos masivos y epidemias que afectan diversas especies de cetaceos y se requiere determinar el agente causal especifico involucrado. Se han descrito diferentes cebadores y sondas para realizar el diagnostico y caracterizacion tanto del DMV como de otros CeMV los cuales pueden ser utiles por su rapido y sensible resultado en condiciones de campo (Tabla 2).

La presencia de anticuerpos en suero puede confirmarse mediante el uso de pruebas como el ELISA indirecto (Van Bressem et al. 1998a), el ELISA competitivo y la seroneutralizacion (Saliki et al. 2002).

Las pruebas de ELISA tienen entre sus ventajas el hecho que adicional a no requerir manipulacion de virus infecciosos, permiten la deteccion de anticuerpos especificos para Morbillivirus en sueros hemolizados que pueden ser citotoxicos y, podrian impedir la deteccion de anticuerpos a bajas diluciones en pruebas de seroneutralizacion (Van Bressem et al. 1998a,b). Sin embargo, estudios recientes concluyen que las pruebas de ELISA tienen una especificidad relativa, dado que el DMV y otros virus del genero Morbillivirus, como el CDV de caninos y el PMV, tienen una relacion genetica y antigenica muy estrecha y por lo tanto reaccionan de forma cruzada (Tabla 3).

Todos los metodos anteriormente descritos son de uso aceptable dependiendo de las situaciones particulares para las cuales se necesite confirmar el diagnostico, el momento del brote y los recursos disponibles. Sin embargo, a la hora de confirmar el diagnostico del DMV, se sugiere la prueba de RT-PCR en tiempo real (Grant et al. 2009, Rubio-Guerri et al. 2013b), dada su mayor sensibilidad y especificidad que una RT-PCR convencional, ademas de su capacidad de diferenciacion entre los diferentes CeMV

Hasta ahora, no se tiene un tratamiento descrito que sea efectivo frente a la infeccion por el DMV Los individuos afectados, que se encuentran varados son tratados con terapia de mantenimiento, pero la gran mayoria de estos animales terminan con desenlaces fatales (Stone et al. 2011). Esto aumenta la necesidad de implementar medidas de prevencion y control para minimizar los efectos adversos en las poblaciones de cetaceos silvestres y en cautiverio; precisamente, una de las grandes preocupaciones y a la vez objetivos dentro de la medicina preventiva es la inmunizacion efectiva de las diferentes especies contra los patogenos; pensando en esto, se han utilizado ilegalmente diferentes vacunas contra el moquillo canino (a virus vivo modificado, virus inactivado o de subunidades) para tratar de contener los brotes e inmunizar a los animales. Sin embargo, a la fecha no existe ninguna vacuna con licencia para ser usada en cetaceos y pinnipedos.

En un esfuerzo por proteger dichas especies, el programa de conservacion de mamiferos marinos de la fuerza naval de los Estados Unidos en cooperacion con la industria y la academia, desarrollaron una vacuna de DNA que tiene como objetivo principal la proteccion contra el DMV mediante la efectiva induccion de respuesta tanto humoral como celular en delfines. El diseno de la vacuna se direcciono hacia dos genes blanco del DMV: la proteina de fusion y la hemaglutinina (Vaughan et al. 2007), dado que ya se ha demostrado el importante rol de dichas proteinas en la patogenicidad de los virus que comprenden la familia Paramyxoviridae.

En el mencionado estudio, dos grupos de delfines mulares, machos y hembras fueron inmunizados con los plasmidos vacunales (Pvr-DMV-F y Pvr- DMV-H) y con el vector solo como control negativo, usando un esquema de vacunacion a la semana 0, seguido por dos re-vacunaciones en la semanas 8 y 14 por via intramuscular. Tal como se esperaba, los delfines tuvieron un aumento significativo en los titulos de anticuerpos especificos contra DMV, entre la semana 0 y la semana 20 (Vaughan et al. 2007). Aunque dichos resultados son un avance significativo para la implementacion del proceso preventivo frente al DMV, se necesitan mas investigaciones en el campo de la inmunologia cetacea que permitan llevar estos resultados a la practica en grandes poblaciones, en las cuales se garantice mediante seguimiento, una inmunizacion efectiva. Estas nuevas investigaciones, por ejemplo, podrian ampliar el conocimiento sobre los tactores que contribuyen a la variacion de la respuesta inmune, como la edad y la heterogeneidad genetica; ya que por el momento solo un estudio ha reportado cambios entre la edad y la funcion inmunitaria en delfines mulares (Blanchard et al. 2003). Toda esta informacion es de vital importancia a la hora de disenar modelos de prevencion y control para virus con alto potencial patogenico como el DMV

Conclusion

Respecto a la importancia del morbilivirus de los Delfines (DMV) como patogeno re-emergente en la poblacion mundial de delfines, es posible aseverar que no es solo a la poblacion de delfines a la que el DMV viene afectando, sino a otras especies, algunas incluso en peligro de extincion como la foca Monje del mediterraneo (Monachus monachus). Es de resaltar que durante la revision de la literatura, se encuentran cada vez mayor cantidad de reportes sobre brotes y varamientos ocasionados por DMV tanto en America como en Europa. Por otro lado, la presente revision nos permitio concluir que las poblaciones mas afectadas a traves de los anos por este virus, han sido los delfines mulares y delfines listados de las costas de los EEUU y del mediterraneo. Actualmente, estas poblaciones se encuentran mas vulnerables, debido a factores antropogenicos, menor disponibilidad de alimento y contaminacion ambiental con sustancias toxicas. Es de vital importancia, que los estudios de diagnostico y caracterizacion tanto del DMV como de los demas CeMV, trasciendan del estudio de varamientos y conteo de tasas de ataque y de mortalidad de los diferentes brotes y sirvan para lograr conocer el panorama real de circulacion de estos agentes en poblaciones silvestres de cetaceos, su epidemiologia, los factores de riesgo y determinantes de emergencia y re-emergencia. Con toda esta informacion se podria desarrollar, lo mas pronto posible, medidas efectivas de prevencion y control que permitan mantener estas poblaciones en equilibrio biologico y que eviten la perdida de vidas animales en especies tan importantes para los ecosistemas marinos.

doi: 10.11144/Javeriana.SC20-1.mdpr

Agradecimientos

Nuestros agradecimientos al grupo de Investigacion en Ciencias Veterinarias CENTAURO y al profesor Jairo Rivera del ARC Centre of Excellence for Coral Reefs Studies James Cook University/Australian Institute of Marine Science por sus correcciones y aportes al manuscrito. Este trabajo fue patrocinado por el "Programa de Sostenibilidad 2013-2014" del Comite para el Desarrollo de la Investigacion--CODI de la Universidad de Antioquia.

Conflictos de intereses

Los autores declaran que no tiene ningun conflicto de intereses.

Referencias

Aguilar A, Raga JA (1993) The striped dolphin epizootic in the Mediterranean Sea. Ambio. 524-528

Barrett T, Visser IK, Mamaev L, Goatley L, Van Bressem MF, Osterhaust AD (1993) Dolphin and porpoise morbillivirus es are genetically distinct from. phocine distemper virus. Virology 193(2):1010-1012

Belliere E, Esperon F, Sanchez-Vizcaino JM (2009) Estudio molecular de una nueva cepa de morbillivirus de cetaceo aislada de un calderon tropical. Revista Complutense de Ciencias Veterinarias 3(2):112-118

Belliere E, Esperon F, Sanchez-Vizcaino JM (2011) Genetic comparison among dolphin morbillivirus in the 1990-1992 and 2006-2008 Mediterranean outbreaks. Infection, Genetics and Evolution 11(8):1913-1920 doi:10.1016/j. meegid.2011.08.018

Blanchard MT, Funke C, Stott JS (2003) Lymphocyte profile of free-ranging dolphins (Tursiops truncatus) in Sarasota Bay, Florida. In: Proceedings of the International Association for Aquatic Animal Medicine (IAAAM), Waikoloa, Hawaii

Daniel C (1995) The striped dolphin Stenella coeruleoalba epizootic in Greece, 1991-1992 Biological Conservation 74(2):143-145

Di Guardo G (2012) Morbillivirus-host interaction: lessons from aquatic mammals. Frontiers in microbiology 3:431 doi:10.3389/fmicb.2012.00431

Di Guardo G, Di Francesco CE, Eleni C, Cocumelli C, Scholl F, et al. (2013) Morbillivirus infection in cetaceans stranded along the Italian coastline: pathological, immunohistochemical and biomolecular findings. Research in Veterinary Science 94(1):132-7 doi:10.1016/j. rvsc.2012.07.030

Dierauf FL, Gulland F (2001) Viral diseases. In: Handbook of Marine Mammal Medicine. Second edition. Editorial CRC Press, New York, USA, pp 296-298

Domingo M, Ferrer L, Pumarola M, Marco A, Plana J, et al. (1990) Morbillivirus in dolphins. Nature 348:21

Domingo M, Vilafranca M, Visa J, Prats N, Trudgett A, Visser I (1995) Evidence for chronic morbillivirus infection in the Mediterranean striped dolphin (Stenella coeruleoalba). Veterinary Microbiology 44:229-239

Domingo M, Visa J, Pumarola M, Marco AJ, Ferrer L, et al. (1992) Pathologic and immunocytochemical studies of morbillivirus infection in striped dolphins (Stenella coeruleoalba).Veterinary Pathology 29(1):1-10

Duignan PJ, House C, Odell DK, Wells RS, Hansen W, et al. (1996) Morbillivirus in bottlenose dolphins: evidence for recurrent epizootics in the western Atlantic and Gulf of Mexico. Marine Mammal Science 12:499-515

Fernandez A, Esperon F, Herraez P, de Los Monteros AE, Clavel C, et al. (2008) Morbillivirus and pilot whale deaths, Mediterranean Sea. Emerging Infectious Diseases. 14(5):792-794 doi:10.3201/eid1405.070948

Forcada J, Aguilar A, Hammond PS, Pastor X, Aguilar R (1994) Distribution and numbers of striped dolphins in the western Mediterranean Sea after the 1990 epizootic outbreak. Marine Mammal Science 10:137-150

Fowler M, Cubas Z (2001) Orders Cetacea and Pinnipedia (whales, dolphins, porpoises, seals, fur seals, sea lions). In: Biology, Surgery and Medicine of South American Wild Animals. Saunders Company, pp 332-352

Geraci JR (1989) Clinical investigation of the 1987-1988 mass mortality of bottlenose dolphins along the US Central and south Atlantic coast. Final Report to the National Marine Fisheries Service, US Navy (Office of Naval Research) and Marine Mammal Commission, pp 63-64

Grant RJ, Banyard AC, Barrett T, Saliki JT, Romero CH (2009) Realtime RT-PCR assays for the rapid and differential detection of dolphin and porpoise morbillivirus es. Journal of virological methods 156(1):117-123 doi:10.1016/j. jviromet.2008.11.008

Gozalbes P, Jimenez J, Raga JA, Esteban JA, Tomas J, Gomez JA, Eymar J (2010) Cetaceos y tortugas marinas en la Comunidad Valenciana. 20 anos de seguimiento. Colleccio Treballs Tecnics de Biodiversitat, 3. Conselleria de Medio Ambiente, Agua, Urbanismo y Vivienda. Generalitat Valenciana. Valenciana, Espana

Keck N, Kwiatek O, Dhermain F, Dupraz F, Boulet H, et al. (2010) Resurgence of Morbillivirus infection in Mediterranean dolphins off the French coast. The Veterinary record 166(21):654-655 doi:10.1136/vr.b4837

Kennedy S (1998) Morbillivirus infections in aquatic mammals. Journal of comparative pathology 119(3):201-225 Lahvis G, Wells RS, Kuehl DW, Stewart JL, Rhinehard HL, Via CS (1995) Decreased lymphocyte response in free-ranging bottlenose dolphins (Tursiops truncatus) are associated with increased concentrations of PCBs and DDT in peripheral blood. Environmental Health Perspectives 103(Suppl. 4):67-72

Ludlow M, Rennick LJ, Nambulli S, de Swart RL, Paul Duprex W (2014) Using the ferret model to study morbillivirus entry, spread, transmission and crossspecies infection. Current Opinion in Virology 4:15-23 doi:10.1016/j.coviro.2013.11.001

McLellan WA, Friedlander AS, Mead JG, Potter CW, Pabst DA (2002) Analysing 25 years of bottlenose dolphin (Tursiops truncatus) strandings along the Atlantic coast of the USA: do historic records support the coastal migratory stock hypothesis? Journal of Cetacean Research and Management 4(3):297-304

Mazzariol S, Marcer F, Mignone W, Serracca L, Goria M, et al. (2012) Dolphin Morbillivirus and Toxoplasma gondii coinfection in a Mediterranean fin whale (Balaenoptera physalus). BMC veterinary research 8(1):20 doi:10.1186/1746-6148-8-20

Mazzariol S, Peletto S, Mondin A, Centelleghe C, Di Guardo G, et al. (2013) Dolphin morbillivirus infection in a captive harbor seal (Phoca vitulina). Journal of clinical microbiology 51(2):708-11 doi:10.1128/JCM.02710-12

Mori C, Morsey B, Levin M, Gorton TS, De Guise S (2008) Effects of organochlorines, individually and in mixtures, on B-cell proliferation in marine mammals and mice. Journal of Toxicology and Environmental Health 71(4):266-275 doi:10.1080/15287390701612860

Mori C, Morsey B, Levin M, Nambiar PR, De Guise S (2006) Immunomodulatory effects of in vitro exposure to organochlorines on T-cell proliferation in marine mammals and mice. Journal of Toxicology and Environmental Health 69:283-302

NOAA--National Marine Fisheries Service (2014) Bottlenose Dolphin Unusual Mortality Event in the Mid-Atlantic. http://www.nmfs.noaa.gov/pr/health/mmume/ midatldolphins2013.html Retrieved Abril 23, 2014

O'Mara FP, Coyle JE, Drennan MJ, Young P, Caffrey PJ, et al. (1999) Morbillivirus es in Mediterranean monk seals. Veterinary microbiology 69(1):19-21

Osterhaus AD, Visser IK, de Swart RL, Van Bressem MF, Van de Bildt, MW, et al. (1992) Morbillivirus threat to Mediterranean monk seals? The Veterinary record 130(7):141-142

Raga JA, Banyard A, Domingo M, Corteyn M, Van Bressem MF, et al. (2008) Dolphin morbillivirus epizootic resurgence, Mediterranean Sea. Emerging infectious diseases 14(3):471-473 doi:10.3201/eid1403.071230

Reidarson TH, McBain J, House C, King DP, Stott JL, et al. (1998) Morbillivirus infection in stranded common dolphins from the Pacific Ocean. Journal of wildlife diseases 34(4):771-776

Rima BK, Collin AM, Earle JA (2005) Completion of the sequence of a Cetacean morbillivirus and comparative analysis of the complete genome sequences of four morbillivirus es. Virus Genes 30(1):113-119

Rosel PE, Hansen L, Hohn AA (2009) Restricted dispersal in a continuously distributed marine species: common bottlenose dolphins Tursiops truncatus in coastal waters of the western North Atlantic. Molecular Ecology 18(24):5030-5045 doi:10.1111/j.1365-294X.2009.04413.x

Rubio-Guerri C, Melero M, Esperon F, Belliere EN, Arbelo M, et al. (2013a) Unusual striped dolphin mass mortality episode related to cetacean morbillivirus in the Spanish Mediterranean Sea. BMC veterinary research 9(1):106 doi:10.1186/1746-6148-9-106

Rubio-Guerri C, Melero M, Rivera-Arroyo B, Belliere EN, Crespo JL, et al. (2013b) Simultaneous diagnosis of Cetacean morbillivirus infection in dolphins stranded in the Spanish Mediterranean sea in 2011 using a novel Universal Probe Library (UPL) RT-PCR assay. Veterinary microbiology 165(1-2):109-114 doi:10.1016/j. vetmic.2012.12.031

Saliki JT, Cooper EJ, Gustavson JP (2002) Emerging Morbillivirus Infections of Marine Mammal. Annals of the New York Academy of Sciences 969(1):51-59

Scott GP, Burn DM, Hansen LJ (1998) The dolphin dieoff Long term effects and recovery of the population. Oceans '88 Proceedings 3:819-823

Seimon TA, Miquelle DG, Chang TY, Newton AL, Korotkova I, et al. (2013) Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica). MBio 4(4):410-13 doi:10.1128/ mBio.00410-13

Sinclair AR, Fryxell JM, Caughley G (2006) Parasites and pathogens. In Wildlife ecology, conservation, and management. Oxford: Wiley-Blackwell, pp 179-195

Soto S, Alba A, Ganges L, Vidal E, Raga JA, et al. (2011) Post-epizootic chronic dolphin morbillivirus infection in Mediterranean striped dolphins Stenella coeruleoalba. Diseases of aquatic organisms 96(3):187-94 doi:10.3354/ dao02387

Stone BM, Blyde DJ, Saliki JT, Blas-Machado U, Bingham J, et al. (2011) Fatal cetacean morbillivirus infection in an Australian offshore bottlenose dolphin (Tursiops truncatus). Australian Veterinary Journal 89(11):452-7 doi:10.1111/j.1751-0813.2011.00849.x

Taubenberger JK, Tsai MM, Kraft AE, Lichy JH, Reid AH, Schulman FY (1996) Two morbillivirus implicates in bottlenose epizootics. Emerging Infectious Diseases 2(3):213

Taubenberger JK, Tsai MM, Atkin TJ, Fanning TG, Krafft AE, et al. (2000) Molecular genetic evidence of a novel morbillivirus in a long-finned pilot whale (Globicephalus melas). Emerging Infectious Diseases 6(1):42-45

Van Bressem MF, Van Waerebeek K, Fleming M, Barrett T (1998a) Serological evidence of morbillivirus infection in small cetaceans from the Southeast Pacific. Veterinary microbiology 59(2-3):89-98

Van Bressem MF, Jepson P, Barrett T (1998b) Further insight on the epidemiology of cetacean morbillivirus in the Northeastern Atlantic. Marine Mammal Science 14(3):605-613

Van Bressem MF, Raga JA, Di Guardo G, Jepson PD, Duignan P, et al. (2009) Emerging infectious diseases in cetaceans worldwide and the role of environmental stressors. Diseases of aquatic organisms 86(2):143-57 doi:10.3354/dao02101

Van de Bildt MW, Kuiken T, Osterhaus AD. (2005). Cetacean morbilliviruses are phylogenetically divergent. Archives of Virology 150(3):577-83. doi:10.1007/s00705-004-0426-4

Vaughan K, Del Crew J, Hermanson G, Wloch MK, Riffenburgh RH, et al. (2007) A DNA vaccine against dolphin morbillivirus is immunogenic in bottlenose dolphins.Veterinary immunology and immunopathology 120 (3-4):260-266 doi:10.1016/j.vetimm.2007.06.036

Manuela Echeverri-Zuluaga (1), Yeison H. Duque-Garcia (1), Julian Ruiz-Saenz (2, [correo])

Edited by Alberto Acosta ([correo])

(1.) Grupo de Investigacion CENTAURO, Facultad de Ciencias Agrarias, Universidad de Antioquia, Medellin, Colombia.

(2) Grupo de Investigacion en Ciencias Animales--GRICA, Facultad de Medicina Veterinaria y Zootecnia, Universidad Cooperativa de Colombia, sede Bucaramanga.

Received: 26-04-2014 Accepted: 12-05-2014

Published on line: 10-07-2014

Funding: Programa de Sostenibilidad 2013-2014 del Comite para el Desarrollo de la Investigacion--CODI de la Universidad de Antioquia.

Electronic supplementary material: N/A
Tabla 1. Caracteristicas patologicas ligadas a los
diferentes grupos de CeMV. DMV: morbillivirus de los
delfines; PMV: morbillivirus de las marsopas; PWMV:
morbillivirus de las ballenas piloto. (+++): Alta; (++):
Moderada; (+): Baja. Tomado de Belliere et al. (2009).

               DMV   PMV   PWMV

Rango de       +++   ++     +
hospedador

Distribucion   +++   ++     +
geografica

Virulencia     +++   ++     +

Tabla 2. Cebadores y sondas usadas para la amplificacion y
diferenciacion de CeMV. Adaptado de Grant et al. (2009) y Rubio-
Guerri et al. (2013b). UPL, Universal Probe Library; FAM, 6-
carboxyfluorescein Roche[R].

Virus   Cebador/ sonda   Secuencia 5'-3                    Tamano
                                                           amplicon

        DMV-UPL25F       TCTAGAGAATGTCAGGAGAAGTTCC
DMV y   DMV-UPL25-R      AAGCTCCTGCACATACAAGGAT            71
PMV     UPL#25           6FAM-TGGAGGAG-dark quencher dye
        PWMV-UPL92-F     GGAGGGGCAATGTATATAGGG
PWMV    PWMV-UPL92-R     CAGCAGTATATCAACACGCATAG           74
        UPL#92           6FAM-CAGGAGCC-dark quencher dye
        DMV-N-FP         TGCCAGTACTCCAGGGAACATCCTTC
DMV     DMV-N-RP         TTGGGTCGTCAGTGTTGTCGGACCGTT       173
        DMV-N-probe      Cy3-A+CA+CCAAA+AGGGA+CA-IBFQ
        PMV-N-FP         GTCTAGTGCTCCGGGGAATATCCCTA
PMV     PMV-N-RP         CTGGATCATCAGCGTTGTCAGATTGCC       173
        PMV-N-probe      FAM-C+CA+TA+CCA+AG+AGGT-IBFQ
DMV y   RT-FP            GGTCGITCTTACTTIGACCC              461
        (convencional)

PMV     C-term-RP        TTGGTTTTCIAITAGCTTGGC
        (convencional)

Tabla 3. Desempeno diagnostico (sensibilidad y especificidad) de la
prueba de ELISA competitivo en relacion con la
seroneutralizacion (VNT). Adaptado de Saliki et al. (2002).

Anticuerpos   Grupo animal       Sensibilidad   Especificidad   Indice
especificos                                                     Kappa
por VNT

              Canidos            100.0          91.4            0.94
CDV, PDV Y    Pinnipedos         90.0           99.0            0.78
CDV/PDV       Canido/Pinnipedo   98.8           98.4            0.95

DMV, PMV,     Cetaceos           69.2           95.2            0.62
DMV/PMV
COPYRIGHT 2015 Pontificia Universidad Javeriana
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Echeverri-Zuluaga, Manuela; Duque-Garcia, Yeison H.; Ruiz-Saenz, Julian
Publication:Revista Universitas Scientarum
Date:Jan 1, 2015
Words:7355
Previous Article:Avaliacao da producao biologica de acido latico em um meio sintetico e no processamento de subprodutos de Aloe vera (L.) Burm. f.
Next Article:Metabolitos activos del genero Piper contra Aedes aegypti: fuentes alternativas naturales para el control de vectores de dengue.

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters