Printer Friendly

Monitoring of hematopoietic chimerism by short tandem repeats, and the effect of CD selection on its sensitivity.

The assessment of chimerism, the ratio of donor to recipient cells, is critical for monitoring the engraftment of donor cells and determining the recurrence of the original disease after allogeneic bone marrow transplantation (BMT). Chimerism in patients after BMT has been assessed by several methods (1). Fluorescence in situ hybridization (FISH) analysis is particularly well established (1). Although FISH analysis is a highly sensitive and quantitative method, its application is restricted to cases with sex-mismatched BMT because the sex chromosome is the common chimerism marker (1).

Many minisatellites, such as short tandem repeats (STRs), are highly polymorphic because of allelic variation in repeat copy numbers (2, 3). A method that makes use of this polymorphism, PCR-based analysis of STRs (PCR-STR), which is a useful tool for human identification in forensic testing (4), has been used to monitor hematopoietic chimerism after BMT (5-13). In recent years, a method using real-time quantitative PCR has been developed (14). This method is more sensitive than PCR-STR, but it requires special instrumentation and expensive reagents and thus is unsuitable for routine assay in the clinical laboratory.

We investigated the assay characteristics of PCR-STR by comparing it with FISH analysis and examining the effect of cell selection (according to the immunophenotype of the original leukemic clone) on the ability of PCR-STR to detect chimerism.

Our institutional ethics committee approved this study, and participants gave informed consent before participation.

DNA was extracted from whole peripheral blood taken from two unrelated healthy volunteers (male and female), and from the fraction containing mononuclear cells and granulocytes, with use of DNA extractor WB (Wako Pure Chemicals).

The repeat regions of six STR loci were identically amplified by PCR (Table 1). We diluted the PCR products in distilled water and mixed them with deionized formamide (Nacalai Tesque, Inc.) and GENE SCAN-350 (ROX) size markers (Applied Biosystems). The prepared samples were electrophoresed on an ABI Prism 310 Genetic Analyzer (Applied Biosystems). After electrophoresis, fluorescence signals were analyzed with the aid of Gene Scan 3.1 software (Applied Biosystems).

FISH analysis was carried out using CEP X spectrum orange for chromosome X and CEP Y spectrum green for chromosome Y (Vysis) (15). We observed 500 interphase cells under the fluorescence microscope and counted the cells with either orange (for chromosome X) or green (for chromosome Y) signals.

We prepared serial dilutions of female-in-male DNA and female-in-male nuclear cells, respectively. We also extracted DNA from isolated CD3-positive cells. Briefly, CD3-positive cells were isolated by means of a magnetic cell-sorting technique, with a magnetic cell-separation system from Miltenyi Biotec GmbH. We then prepared serial dilutions of female CD3-positive cells in male whole leukocytes (0%, 0.5%, 1.0%, and 2.0%). We separated the mononuclear cell fractions from these mixed CD3-positive cells by density gradient centrifugation (d = 1.077), using Lymphoprep[TM] (AXIS-SHIELD Poc As) followed by isolation of CD3-positive T cells from these fractions by magnetic cell sorting. After purification of the CD3-positive T cells, DNA was extracted from the CD3-positive cells and from whole leukocytes.

Among six microsatellite loci, the von Willebrand factor (vWF; see Fig. 1-A in the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol50/issue12/) and D5S818 (Fig. 1-B in the online Data Supplement) loci were suitable for quantification of chimerism because these DNA fragments for males and females were distinguishable by at least two repeat units and were not influenced by stutter peaks.

We carried out PCR-STR analysis in three separate experiments using a 50% DNA mixture (mixture containing equal quantities of male and female DNAs) and compared the ratios of female fragments to male fragments calculated from peak heights and from peak areas (Table 1 in the online Data Supplement).

Although there was no difference in reproducibility, the means of the ratios calculated from peak heights were closer to the expected values than the means of those calculated from peak areas. We therefore used peak heights to calculate the peak ratios in this study.

We determined the within-run reproducibility for peak sizes in both male and female samples by making nine replicate measurements of the same PCR products; the CV was <0.1%. We determined the between-run reproducibility by performing five separate PCR analyses, and the CV was 0.1-0.3%.

We assessed the minimum detection limit of the PCR-STR method with use of prepared mixed-DNA samples or mixed-cell samples. The percentage of female DNA was calculated by use of the alleles distinguishable between male and female, according to the equation of Kreyenberg et al. (8): % female = (FP1 + FP2)/(MP1 + MP2 + FP1 + FP2) x 100, where MP and FP are the peak heights for the male and female alleles, respectively.

The PCR-STR analysis using mixed-DNA samples detected female DNA down to 2% female DNA in male DNA (Fig. 2 in the online Data Supplement). When we analyzed mixed-cell samples, the minor population was detected down to 0.5-5.0%. When the DNA extracted from CD3-positive cell was used, the detection limit for both the vWF and D5S818 loci was 0.5% (Fig. 1); we observed no difference in sensitivity between the vWF and D5S818 loci. The correlation coefficient between the calculated and expected peak heights was 0.994 for the vWF locus and 0.996 for the D5S818 locus (Fig. 3 in the online Data Supplement).

[FIGURE 1 OMITTED]

We investigated the relationships between the ratio of XX to XY signals as a percentage obtained by FISH analysis and the percentage female obtained by PCR-STR analysis by linear regression analysis. The linear regression equation for the vWF locus was: y = 0.945x - 0.749 (r = 0.996); that for the D5S818 locus was: y = 0.984x - 2.293 (r = 0.998; Fig. 4 in the online Data Supplement).

The PCR-STR method is increasingly being used for monitoring the engraftment of donor cells after stem cell transplantation (SCT) or BMT because it can be applied to both sex-matched and -mismatched BMT (5-13). When PCR-STR is used for analysis of chimerism in patients after BMT or SCT, the first requirement for monitoring a chimerism effectively is the selection of adequate loci to allow differentiation between recipient and donor.

In BMT, three major HLA antigens, HLA-A, -B, and -DR, are completely matched to prevent graft-vs-host disease (16-18). That being so, to allow clear differentiation between male and female cells, we selected six STR loci that exist in the introns separated from the alleles for these HLA antigens.

Allogenic SCT or BMT, after a conditioning regimen with high-dose cytostatic drugs and total-body irradiation, may induce severe transplantation-related complications, especially in older adults. Reduced-intensity hematopoietic SCT, the so-called minitransplantation, represents a milder form of therapy for chronic myeloid leukemia (CML) (19-23). Although graft rejection and intractable graft-vs-host disease remain great challenges, recent results with minitransplants in older patients with CML in the chronic phase have been relatively satisfactory (21-23). In chimerism analysis, quantification is of importance when examining patients who have received minitransplants because the number of donor cells is crucial and must be quantified in the patient's blood (which still contains high numbers of recipient cells indistinguishable by their phenotype) (6). Generally, the degree of mixed chimerism is quantified by use of a calibration curve (9, 10). Although in the current study we directly calculated the ratio of male to female alleles without use of a calibration curve, this allowed us to quantify the mixed chimerism and was almost the equal of FISH analysis in this sense.

Donor lymphocyte infusions (DLIs), which are based on the effects of graft-vs-leukemia (20), have been used to treat post-BMT leukemia relapse and have been shown to have a potent antileukemic effect that can lead to hematologic/ molecular remission in 75-80% of CML patients who relapse after BMT (23). The administration and follow-up of DLI therapy also require sensitive and specific techniques for the monitoring of minimum residual disease by quantification of the residual cells derived from the recipient (6). In the present study, the sensitivity of the STR-PCR performed with extracted DNA from whole blood cells was not inferior to that of FISH analysis and would be suitable for detection of an early relapse. Furthermore, when the extracted DNA from the CD3-positive cell fraction was used, the method could detect the minor population at concentrations ~10-fold lower than the minimum percentage that could be detected when DNA extracted from whole blood cells was used. As noted by Gardiner et al. (23), lineage-specific PCR-STR would allow early prediction of the response after DLI.

The recipient cells in the peripheral blood or bone marrow of relapsed patients after BMT include not only malignant cells, but also healthy hematopoietic cells. Thus, it is necessary to distinguish whether the mixed chimerism in the recipient is caused by the reappearance of normal recipient hematopoiesis or by the reoccurrence of malignant cells. However, performing PCR-STR analysis with DNA extracted from whole leukocytes would make it difficult to distinguish between these two possibilities because of the background derived from healthy hematopoietic cells. On the basis of this study, in which we admittedly addressed only CD3, if we analyzed for chimerism limited to specific leukocyte subsets according to the immunophenotype of the original leukemic clone, the minor population of the mixed chimerism derived from malignant cells might be detected earlier and more sensitively.

In conclusion, PCR-STR analysis, like FISH analysis, is a highly sensitive and quantitative method that could allow early detection of leukemia relapse after allogeneic SCT or BMT. In addition, to monitor hematologic chimerism, PCR-STR could be applied not only to recipients of a sex-mismatched transplantation, but also to those who have received sex-matched transplantation or minitransplantation-DLI therapy. Furthermore, use of leukemia-affected lineage cells could make this method more informative with regard to early reoccurrence of malignant cells.

References

(1.) Khan F, Agarwal A, Agarwal S. Significance of chimerism in hematopietic stem cell transplantation: new variations on an old theme. Bone Marrow Transplant 2004;34:1-12.

(2.) Jeffreys AJ, Wilson V, Thein SL. Hypervariable 'minisatellite' regions in human DNA. Nature 1985;314:67-73.

(3.) Jeffreys AJ, Wilson V, Thein SL. Individual-specific 'fingerprints' of human DNA. Nature 1985;316:76-9.

(4.) Kasai K, Nakamura Y, White R. Amplification of a variable number of tandem repeats (VNTR) locus (cMCT118) by the polymerase chain reaction (PCR) and its application to forensic science. J Forensic Sci 1990;35:1196-200.

(5.) Schraml E, Daxberger H, Watzinger F, Lion T. Quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR amplification of microsatellite markers and capillary electrophoresis with fluorescence detection: the Vienna experience. Leukemia 2003;17:224-7.

(6.) Chalandon Y, Vischer S, Helg C, Chapuis B, Roosnek E. Quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR amplification of microsatellite markers and capillary electrophoresis with fluorescence detection: the Geneva experience. Leukemia 2003;17:228-31.

(7.) Koehl U, Beck O, Esser R, Seifried E, Klingebiel T, Schwabe D, et al. Quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR amplification of microsatellite markers and capillary electrophoresis with fluorescence detection: the Frankfurt experience. Leukemia 2003;17: 232-6.

(8.) Kreyenberg H, Holle W, Mohrle S, Niethammer D, Bader P. Quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR amplification of microsatellite markers and capillary electrophoresis with fluorescence detection: the Tuebingen experience. Leukemia 2003;17: 237-40.

(9.) Acquaviva C, Duval M, Mirebeau D, Bertin R, Cave H. Quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR fluorescence detection: the Paris-Robert Debre experience. Leukemia 2003;17:241-6.

(10.) Hancock JP, Goulden NJ, Oakhill A, Steward CG. Quantitative analysis of chimerism after allogeneic bone marrow transplantation using immunomagnetic selection and fluorescent microsatellite PCR. Leukemia 2003;17: 247-51.

(11.) Lion T. Summary: reports on quantitative analysis of chimerism after allogeneic stem cell transplantation by PCR amplification of microsatellite markers and capillary electrophoresis with fluorescence detection. Leukemia 2003;17:252-4.

(12.) Wicki A, Malik N, Gratwohl A, Tichelli A, Meyer-Monard S, Muller H. Determination of the donor:host blood cell ratio after haematological stem cell transplant by means of semiquantitative detection of short tandem repeat polymorphisms. Swiss Med Wkly 2002;132:288-95.

(13.) Pindolia K, Janakiraman N, Kasten-Spotes C, Demanet C, Van Waeyenberge C, Pals G, et al. Enhanced assessment of allogeneic bone marrow transplant engraftment using automated fluorescent-based typing. Bone Marrow Transplant 1999;24:1235-41.

(14.) Alizadeh M, Bernard M, Danic B, Birebent B, Lapart C, Lamy T, et al. Quantitative assessment of hematopoietic chimerism after bone marrow transplantation by real-time quantitative polymerase chain reaction. Blood 2002;99:4618-25.

(15.) Furuwatari C, Yagi A, Yamagami O, Ishikawa M, Hidaka E, Ueno I, et al. A comprehensive system to explore p53 mutations. Am J Clin Pathol 1998; 110:368-73.

(16.) Kanda Y, Chiba S, Hirai H, Sakamaki H, Iseki T, Kodera Y, et al. Allogeneic hematopoietic stem cell transplantation from family members other than HLA-identical siblings over the last decade (1991-2000). Blood 2003;102: 1541-7.

(17.) Singhal S, Powles R, Treleaven J, Kulkarni S, Horton C, Mehta J. Long-term outcome of adult acute leukemia patients who are alive and well two years after allogeneic bone marrow transplantation from an HLA-identical sibling. Leuk Lymphoma 1999;34:287-94.

(18.) Carella AM, Beltrami G, Corsetti MT. Autografting in chronic myeloid leukemia. Semin Hematol 2003;40:72-8.

(19.) Georges GE, Storb R. Review of "minitransplantation": nonmyeloablative allogeneic hematopoietic stem cell transplantation. Int J Hematol 2003;77: 3-14.

(20.) Talmadge JE. Hematopoietic stem cell graft manipulation as a mechanism of immunotherapy. Int Immunopharmacol 2003;3:1121-43.

(21.) Gilleece MH, Dazzi F. Donor lymphocyte infusions for patients who relapse after allogeneic stem cell transplantation for chronic myeloid leukemia. Leuk Lymphoma 2003;44:23-8.

(22.) Leda M, Ladon D, Pieczonka A, Boruczkowski D, Jolkowska J, Witt M, et al. Donor lymphocyte infusion followed by interferon-[alpha] plus low dose cyclosporine A for modulation of donor CD3 cells activity with monitoring of minimal residual disease and cellular chimerism in a patient with first hematologic relapse of chronic myelogenous leukemia after allogeneic bone marrow transplantation. Leuk Res 2001;25:353-7.

(23.) Gardiner N, Lawler M, O'Riordan JM, Duggan C, De Arce M, McCann SR, et al. Monitoring of lineage-specific chimaerism allows early prediction of response following donor lymphocyte infusions for relapsed chronic myeloid leukemia. Bone Marrow Transplant 1998;21:711-9.

DOI: 10.1373/clinchem.2004.037580

Kazuyuki Matsuda, [1] Kazuyoshi Yamauchi, [1] * Minoru Tozuka, [2] Takefumi Suzuki, [1] Mitsutoshi Sugano, [1] Eiko Hidaka, [1] Kenji Sano, [1] and Tsutomu Katsuyama [3] ([1] Department of Laboratory Medicine, Shinshu University Hospital, Matsumoto, Japan; [2] Clinical Laboratory Center, The University of Tokyo Hospital, Tokyo, Japan; [3] Department of Laboratory Medicine, Shinshu University School of Medicine, Matsumoto, Japan; * address correspondence to this author at: Department of Laboratory Medicine, Shinshu University Hospital, 3-1-1 Asashi, Matsumoto 390-8621, Japan; fax 81-263-34-5316, e-mail yamauchi@hsp.md.shinshu-u.ac.jp)
Table 1. STR loci.

Locus Chromosome Common sequence Product
designation location motif size, bp

vWF 12p12-pter [(ATCT).sub.n] 102-132

FGA 4q28 [(TCTT).sub.n] 196-352

CSF 5q33-q34 [(AGAT).sub.n] 291-331

TPO 2p23-pter [(AATG).sub.n] 102-138

D5S818 5q21-q31 [(AGAT).sub.n] 133-169

TH 11p15 [(AATG).sub.n] 146-190

Locus Primer sequence, 5' [right arrow] 3'
designation

vWF Forward: FAM (a)-AGCTATATATCTATTTATCAT
 Reverse: AGATACATACATAGATATAGG

FGA Forward: FAM-CCATAGGTTTTGAACTCACAG
 Reverse: CTTCTCAGATCCTCTGACAC

CSF Forward: FAM-GAGTCTGCCAAGGACTAGC
 Reverse: CACACCACTGGCCATCTTC

TPO Forward: FAM-ACTAGCACCCAGAACCGTC
 Reverse: CTTGTCAGCGTTTATTTGCC

D5S818 Forward: FAM-AGGGTGATTTTCCTCTTTGGT
 Reverse: TGATTCCAATCATAGCCACA

TH Forward: FAM-GGCTGAAAAGCTCCCGATTA
 Reverse: TCCCATTGGCCTGTTCCT

(a) FAM, 6-carboxyfluorescein.
COPYRIGHT 2004 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Matsuda, Kazuyuki; Yamauchi, Kazuyoshi; Tozuka, Minoru; Suzuki, Takefumi; Sugano, Mitsutoshi; Hidaka
Publication:Clinical Chemistry
Date:Dec 1, 2004
Words:2559
Previous Article:Problem with detection of an insertion-type mutation in the BCHE gene in a patient with butyrylcholinesterase deficiency.
Next Article:Clinical Chemistry through Clinical Chemistry: a journal timeline.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |