Printer Friendly

Molecular evidence of anti-leukemia activity of gypenosides on human myeloid leukemia HL-60 cells in vitro and in vivo using a HL-60 cells murine xenograft model.

ARTICLE INFO

doi: 10.1016/j.phymed.2011.03.009

Keywords:

Gypenosides

Gynostemma pentaphyllum

Anti-leukemia

HL-60 cells

Apoptosis

In vitro

In vivo

ABSTRACT

We have shown that gypenosides (Gyp) induced cell cycle arrest and apoptosis in many human cancer cell lines. However, there are no reports showing that show Gyp acts on human leukemia HL-6O cells in vitro and in a murine xenograft model in vivo. In the present study effects of Gyp on cell morphological changes and viability, cell cycle arrest and induction of apoptosis in vitro and effects on Gyp in an in vivo murine xenograft model. Results indicated that Gyp induced morphological changes, decreased cell viability, induced G0/Gl arrest. DNA fragmentation and apoptosis (sub-Gl phase) in HL-60 cells. Gyp increased reactive oxygen species production and [Ca.sup.2+] levels but reduced mitochondrial membrane potential in a dose- and time-dependent manner. Gyp also changed one of the primary indicators of endoplasmic reticulum (ER) stress due to the promotion of ATF6-[alpha] and ATF4-[alpha] associated with [Ca.sup.2+] release. Gyp reduced the ratio of Bcl-2 to Bax due to an increase in the pro-apoptotic protein Bax and inhibited levels of the anti-apoptotic protein Bcl-2. Oral consumption of Gyp reduced tumor size of HL-60 cell xenograft mode mice in vivo. These results provide new information on understanding mechanisms by which Gyp induces cell cycle arrest and apoptosis in vitro and in vivo.

Introduction

Leukemia is one of the common causes of death and the worldwide incidence of this cancer is increasing. In the U.S. about 3.7 per 100.000 individuals die annually from leukemia (Jensen et al. 2004). In Taiwan, reports from the Department of Health, Executive Yuan. R.O.C. (Taiwan) indicated that about 4.0 per 100.000 individuals die annually from leukemia. Treatment for leukemia has not had wide-spread success. The majority of human cancers can be prevented through the modification in lifestyle, including diet (Norman et al. 2004). Dietary chemopreventive agents could inhibit, delay, or reverse multistage carcinogenesis (Bode and Dong 2004). Consumption of plant-based diets, reduced development of colon cancer (Mutoh et al. 2000; Wenzel et al. 2000) and which is consistent with the notion that herbal-based dietary supplements promote pathways related to cancer suppression.

Gypenosides (Gyp) have been used as a traditional popular folk medicine in the Chinese population for centuries to treat cancer (Hou et al. 1991). cardiovascular disease (Purmova and Opletal 1995). hepatitis (Lin et al. 2000) and hyperlipoproteinemia (la Cour et al. 1995; Yu et al. 1996). Gyp are not a single compound, and exhibit the major component of saponin extract derived from the Gynostemmo pentaphyllum Makino, containing approximately 90 dammarane-type saponin glycosides (named gypenosides) have been identified phytochemically (Cui et a). 1999; Schild et al. 2010, 2009). Furthermore, Gyp have anti-inflammatory and anti-oxidative (Li et al. 1993), anti-thrombotic (Tan et al. 1993) and anticancer effects (Hu et al. 1996; Schild et al. 2010; Wang et al. 1995,2002; Zhou et al. 1996). Gyp have hepatoprotective and antifibrotic effects in rats (Chen et al. 2000) and this compound has anti-proliferative effects in rat hepatic stellate cells (Chen et al. 2008). Also, Gyp induced apoptosis in human hepatoma cells (Wang et al. 2007), colon cancer cells (Chen et al. 2006) and human tongue cancer SCC-4 cells through endoplasmic reticulum stress and mitochondria-dependent pathways (Chen et al. 2006).

[FIGURE 1 OMITTED]

There is no information on effects of Gyp-induced apoptosis in models of human leukemia in vitro and in an in vivo xenograft mouse model. In the present study, effects of GYP on human leukemic cells were investigated in vitro and in vivo using a xenograft model mouse. Gyp induced apoptosis in HL-60 cells and importantly decreased the tumor size of HL-60 cells in a xenograft mouse model.

Materials and methods

Chemicals and reagents

Gyp was kindly provided by Dr. Jung-Chou Chen (Department of Chinese Medicine, China Medical University). Dimethyl sulfoxide (DMSO). Trypan blue and Triton X-100, propidium iodide (PI), ribonuclease-A and Tris-HCl were obtained from Sigma Chemical Co. (St. Louis, MO, USA). 2,7-Dichlorodihydrofluorescein diacetate, DiOC6 and Indo 1/AM were obtained from Molecular Probe/Invitrogen (Carlsbad, CA, USA). RPMI-1640 medium, L-glutamine, fetal bovine serum (FBS), penicillin-streptomycin and trypsin-EDTA were obtained from Gibco/lnvitrogen (Carlsbad, CA, USA).

Part I. In vitro studies

Cell culture

The HL-60 cell line was obtained from the Food Industry Research and Development Institute (Hsinchu, Taiwan). Cells were cultured in RPMl-1640 medium containing 10% FBS. 1% penicillin-streptomycin (100 U/ml penicillin and 100 [micro]/ml streptomycin) and 2mM L-glutamine in 75 c[m.sup.2] tissue culture flasks under a humidified 5% C[O.sub.2] and 95% air atmosphere at 37 [degrees]C as described elsewhere (Lu et al. 2007).

Assessment of cell morphology and viability after Gyp treatment

HL-60 cells were cultured in 24-well plates and incubated at 37 [degrees]C for 24 h before each well were individually treated with 0, 60, 90, 120, 150 and I80 [micro]g/ml Gyp for 24 and 48h. DMSO (solvent for Gyp) was used as the solvent control. Determination of cell morphology was made using a phase-contrast microscope (Lu etal. 2010a; Tsou et al. 2009). For cell viability, cells were harvested and analyzed by flow cytometric protocol as previously described (Chiang et aL 2011; Tsou et al. 2009).

Flow cytometry analysis for cell cycle distribution and sub-Gl group

HL-60 cells in 12-well plates were incubated with 0 and 150p.g/ml Gyp for 0. 6, 12, 24 and 48 h. Cells were harvested by centrifugation and the percentage of cells in the sub-G1 (apoptosis), G0/G1-, S- and G2/M-phases were determined by flow cytometry as previously described (Chen et al. 2006; Yang et al. 2010).

[FIGURE 2 OMITTED]

DAPI staining for apoptosis

Cells in 12-well plates were treated with or without 0, 8O, 120, 180 and 200 [micro]g/ml Gyp for 48 h. Cells were then stained by using 4.6-diamidino-2-phenylindole dihydrochloride (DAPI) as previously described (Chen et al. 2006).

DNA gel electrophoresis for DNA fragmentation

Cells in 12-well plates were incubated with 0 and 150[micro]g/ml Gyp for 0,6,12,24 and 48 h. Cells were harvested by centrifugation and DNA was isolated before DNA fragmentation was determined by DNA gel electrophoresis as previously described (Lu et al. 2010b).

Comet assay for DNA damage

Cells in 12-well plates were treated with or without 0, 60, 90, 120,150 and 180 [micro]g/ml Gyp for 24 h. Cells were then harvested and DNA damage was determined with the Comet assay as previously described (Chen et al. 2009a: Lu et al. 2010d).

Detection of reactive oxygen species (ROS), [Ca.sup.2+] levels and mitochondrial membrane potential ([DELTA][[PSI].sub.m]) in HL-60 cells

Cells in 12-well plates were pre-treated with or without N-acetylcysteine (NAC) prior to being treated with 150 [micro]g/ml Gyp for 0, 1, 3, 6,12 and 24 h. Cells were harvested by centrifugation and washed twice by PBS for determination of viability as described above or re-suspended in 500 [micro]M of 2.7-dichlorodihydrofluorescein diacetate (10 [micro]M)(DCFH-DA, Sigma)and Indo 1 /AM (3 [micro]g/ml) (dye contains fluorescence for staining of [Ca.sup.+2] and DiOC6 (1 [micro]mol/l) (dye contains fluorescence for staining of [DELTA][[PSI].sub.m]). The cells were then incubated at 37 [degrees]C for 30 min to detect percentage of changes in ROS, [Ca.sup.2+] and [DELTA][[PSI].sub.m] using flow cytometry as previously described (Lu et al. 2010c; Wen et al. 2010).

[FIGURE 3 OMITTED]

Detection ofcaspase-8 and -3 activities in HL-60 cells

Cells in 12-well plates were pre-treated with or without caspase-8 and -3 inhibitors (Z-IETD-FMK and Z-DEVE-FMK) and they were then treated with 150 [micro]g/ml Gyp for 0,12 and 24 h. The cells were harvested and washed twice for determination of the activities of caspase-8 and -3 by adding substrates CaspaLux8-L1D2 and PhiPhiLux-G1D2, respectively, then the activities of caspase-8 and -3 and the percentage of viability of HL-60 cells were determined by using flow cytometric assay as described above or in our earlier reports (Ji et al. 2009; Lai et al. 2009).

Cell cycle and apoptosis associated protein levels in HL-60 cells

Cells in 12-well plates were treated with 150[micro]g/ml of Gyp for 0, 6, 12, 24, 48 and 72 h. Cells were harvested by centrifugation and lysed. The total amount of cell protein was determined as previously described (Ji et al. 2009; Lu et al. 2010c). Western blotting was used for determining specific protein levels associated with cell cycle (chk2, p53, p21, pl6, cdk6, cyclin D2 and cyclin E) and apoptosis (Bax, Bcl-2, Bcl-xl/xs, cytochrome c, caspase-9, -3. AlF and Endo-G, TRAIL, caspase-8, Bid, GRP78 and caspase-12). All samples were separated by sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gel electrophoresis as previously described (Ji et al. 2009; Lu et al. 2010c).

Protein translocation determined using confocal laser scanning microscopy

Cells were cultured on 4-well chamber slides and were then treated with or without 150 [micro]g/ml Gyp for 24 h. The cells were fixed in 4% formaldehyde in PBS for 15 min, permeabilized with 0.3% Triton X-100 in PBS for 1 h with blocking of non-specific binding sites using 2% BSA. Fixed cells were stained with primary antibodies to AIF. Endo G and GADD153 (1:100 dilution) (green fluorescence) overnight then washed twice with PBS and then were stained with secondary antibody (FITC-conjugated goat anti-mouse IgG at 1:100 dilution) followed by DNA staining with PI (red fluorescence). Photomicrographs were obtained using a Leica TCS SP2 Confocal Spectral Microscope (Lin et al. 2008).

Real-time polymerase chain reaction (PCR)for caspase-8 and -9

Cells were cultured on 6-well culture plates and treated with 180 [micro]g/ml Gyp for 24 and 48 h. Cells were lysed and total RNA was extracted using the Qiagen RNeasy Mini Kit as previously described (Ji et al. 2009). Each total RNA sample was reverse-transcribed for 30 min at 42 [degrees]C with High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems). Quantitative PCR was performed using the following conditions: 2min at 50 [degrees]C. 10 min at 95 [degrees]C, and 40 cycles of 15 s at 95 [degrees]C, 1 min at 60 [degrees]C using 1 [micro]l of the cDNA reverse-transcribed as described above, 2x SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of forward and reverse primers such as Caspase-8-F: GGATGGCCACTGTGAATAACTG; caspase-8-R: TCGAGGACATCGCTCTCTCA; caspase-9-F: TGTCCTACTCTACTTTCCCAGGTTTT; caspase-9-R: GTGAGCCCACTGCTCAAAGAT; GAPDH-F: ACACCCACTCCTCCACCTTT; GAPDH-R: TAGCCAAATTCGTFGTCATACC. Each assay was run on an Applied Biosystems 7300 Real-Time PCR system in triplicate and expression fold-changes were derived using the comparative [C.sub.T] method (Chiang et al. 2011; Ji et al.2009).

[FIGURE 4 OMITTED]

Part II. In vivo studies

Mouse xenograft model for examining the effects of Gyp on HL-60 cells in vivo

Twenty-four six-week-old female athymic nude mice were obtained from the Laboratory Animal Center of National Applied Research Laboratories (Taipei, Taiwan). All mice were housed in Standard vinyl cages with air filter tops and in a filtered laminar air flow room, where water and food were autoclaved and provided ad libitum. HL-60 cells (1 x [10.sup.7]) in cultured RPMl-1640 medium were subcutaneously injected into the flanks of mice. After 7 days, mice bearing tumors were randomly assigned to treatment groups (eight mice per group) and treatment initiated when xenografts reached volumes of about 150 m[m.sup.3] and then were intraperitoneally (i.p.) injected every three days (in the morning) with 30[micro]l of control vehicle (DMSO) and Gyp (5 and 20mg/kg)(Ji et al. 2009; Lin et al. 2011). Mice exhibiting tumors were then monitored, counted, and tumor size measured initially after 2 weeks, with the final measurement taken 4 weeks after tumor cell inoculation. Body weights were measured once every three days but more frequently measured during the first 3 weeks to monitor potential drug-related toxicity. At 4 weeks after cell inoculation, animals were sacrificed; tumors were removed, measured and weighted. All animal studies were conducted according to institutional guidelines approved by the Animal Care and Use Committee of China Medical University (Taichung, Taiwan).

[FIGURE 5 OMITTED]

Statistical analysis

All data were expressed as mean [+ or -]S.D. from at least three separate experiments. Statistical calculations of the data were performed using an unpaired Student's t-test. Statistical significance was set at P[Less than]0.05.

Results

Part I. In vitro studies

Effects of Gyp on viability, cell cycle arrest and apoptosis in HL-60 cells

Cells were treated with various concentrations of Gyp for different time-periods. Data in Fig. 1A and B show that Gyp reduced cell viability when compared to control groups and that these effects were dose- and time-dependent (P[Less than]0.05). Cell cycle and sub-G1 phase of HL-60 cells were altered by Gyp as shown in Fig. 1C and D. There was an increase in the percentage of cells in G0/G1 and a decrease in the percentage of cells in S phase. The sub-G1 groups appeared in the cell cycle distribution, suggesting that Gyp induced apoptosis in HL-60 cells (Fig. 1D). Increased time of Gyp incubation led to an increase in G0/G1- and sub-G1-phases in the HL-60 cells (P[Less than]0.05).

Gyp alters morphology, apoptosis, DNA damage and DNA fragmentation in HL-60 cells

HL-60 cells were treated with various concentrations of Gyp for different time-periods. The results shown in Fig. 2A indicated that HL-60 cells were morphologically altered by Gyp treatment and these effects were dose-dependent. Fig. 2B indicated that Gyp induced apoptosis in HL-60 cells, and the results showed less cell number compared to control. Gyp induced apoptosis which was consistent with data showing that DNA fragmentation occurred as seen in Fig. 2C. Higher concentrations of Gyp led to a longer tail (DNA damage). Further supporting the fact that Gyp induced apoptosis in HL-60 cells are data in Fig. 2D showing DNA gel electrophoresis of DNA fragmentation which was enhanced with increasing exposure to Gyp.

Effects of Gyp on levels of reactive oxygen species (ROS) and [Ca.sup.2+] and mitochondria membrane potential ([DELTA][[PSI].sub.m])

Gyp induced ROS production quite early and (Fig. 3A) up to 12 h of treatment after which time there was a reduction in ROS levels at 24 h treatment. Pretreatment with NAC reduced effects of Gyp on production of ROS as shown in Fig. 3B. Gyp increased [Ca.sup.2+] levels in HL-60 cells and this effect was time-dependent (Fig. 3C). We also found that Gyp reduced the mitochondrial [DELTA][[PSI].sub.m] in a time-dependent manner (Fig. 3D).

Gyp increases caspase-8, -9 and -3

It can be seen in Fig. 4, that 150 [micro]M Gyp promoted caspase-3. -8 and -9 activities in a time-dependent manner (Fig. 4A and B). However, cells that were pretreated with inhibitors of caspase-3, -8 and -9. respectively reduced effects of Gyp resulting in more viable cells (Fig. 4C and D). Results indicated that Gyp promoted gene expression of caspase-8 and -9 mRNA in HL-60 cells and these effects are time-dependent as shown in Fig. 7.

[FIGURE 7 OMITTED]

Effects of Gyp on levels of proteins associated with cell cycle and apoptosis

Data presented in Fig. 5A-C indicate that the levels of cyclin D, cyclin E. CDK2, CDK6 (Fig. 5A). Bcl-2 and xIAP (Fig. 5B) were decreased. However, the levels of pl6, p21 and p27 (Fig. 5A), Fas, Fas ligand, caspase-8, t-Bid, Bax, AIF and Endo G (Fig. 5B) PARP and (Fig. 3C) and caspase-12 (Fig. 3E) were decreased. Protein levels of p53, p21 and p26 (Fig. 3A), Bax and Bcl-xl (Fig. 3B), GADD153, GRP78, PERK, IRE-[alpha], ATF6-[alpha] and ATF6-[alpha] (Fig. 5C) were increased.

[FIGURE 8 OMITTED]

[FIGURE 9 OMITTED]

Gyp alters distribution of AIF. Endo-G and GADD153 in HL-60 cells

The results shown in Fig. 6A-C show that AIF (Fig. 6A). Endo-G (Fig. 6B) and GADD153 (Fig. 6C) were released from mitochondria translocated to the nucleus.

Part II. In vivo studies

Antitumor activity of Gyp against HL-60 tumors

Fig. 9A shows a representative with tumor who had been injected with HL-60 cells. Gyp treatment did not alter body weight. Gyp significantly decreased the tumor weight compared to controls (Fig. 98) and the percentages of tumor inhibition are shown in Fig. 9C. The results indicated that Gyp caused a 56% inhibition of tumors compared to control mice. Tumors in the treatment groups were significantly smaller as compared with the control group.

Discussion

In our laboratory, we have shown that Gyp suppressed the activity and gene expression of N-acetyltransferase in human cervical cancer Ca Ski cells (Chiu et al. 2003) and induced apoptosis in human colon cancer colo 205 cells (Chen et al. 2006), human tongue cancer SCC-4 cells (Chen et al. 2009a) and mouse leukemia WEHI-3 cells in vitro and in vivo (Hsu et al. 2010).

There is however, no available information on Gyp affecting human leukemia cells. In the present study, we showed that Gyp induced G0/G1 arrest and apoptosis in human leukemia HL-60 cells and Gyp reduced HL-60 tumors in mice. The in vivo studies provide a useful model system and it underscores the idea that Gyp may have therapeutic efficacy in the treatment of human leukemia. We showed in our in vitro studies that Gyp-induced morphological changes, decreased the percentage of viable cells, induced G0/G1 arrest and induced apoptosis in HL-60 cells which were dose- and time-dependent manners. This is in agreement with our earlier reports in SCC-4 cells (Chen et al. 2009a) and WEHI-3 cells (Hsu et al. 2010).

Gyp inhibits cell cycle progression and phase distribution of HL-60 cells via blocking the transition from Gl- to S-phase. Results from Western blotting indicated that Gyp inhibited the protein levels of cyclin D1 and E, cyclin-dependent kinases cdk2 and cdk6 (Fig. 5A). These results are in agreement with other reports which have shown that cyclin D1 is expressed in G1 cells and it binds to the cdk4 and cdk6 to activate cdk4 and cdk6 (Sherr 1995, 1996; Vink et al. 1993). It is well documented that cells from the G1- to the S-phase is regulated by cdk2 associated with cyclin E (Geng et al. 1999: Guadagno and Newport 1996). Western blot analysis revealed that the Gyp-mediated G0/G1 arrest in HL-60 cells was accompanied by the down-regulation of p21, pl6, p27, cyclin Dl and cyclin E and also through the inhibition of Cdk2 and Cdk6. Many reports have shown that the protein p21 (also named WAF1, CAP20. Cip1, or Sdi 1) is the founding member of the Cip/Kip family of cyclin-dependent kinase inhibitors, which also includes p27 (el-Deiry et al. 1993; Harper et al. 1993; Noda et al. 1994; Xiong et al. 1993). The p21 protein plays an essential role ingrowth arrest after DNA damage (Brugarolas et al. 1995; Deng et al. 1995; Dulic et al. 1994) and overexpression of p21 leads to G1 arrest (Niculescu et al. 1998). It was also reported that p21, besides regulating normal cell cycle progression, also integrates genotoxic signal insults into apoptotic signaling pathways (Weinberg and Denning 2002).

The analysis of DNA content versus light scatter of the Gyp-treated HL-60 cells indicated that Gyp induced G0/G1 -phase arrest and induced sub-G1 (apoptosis) phase. This finding was also confirmed by DAPI staining (Fig. 2B)and DNA gel electrophoresis (DNA fragmentation) (Fig. 2C). Western blotting assay indicated that Gyp decreased the amounts of Bcl-2 anti-apoptotic protein (Fig. 5B) but increased the amount of Bax pro-apoptotic protein (Fig. 5B) facilitating apoptosis. The results also showed that Gyp promoted the levels of Fas, FasL, AIF and Endo-G (Fig. 5B) suggesting that Gyp may act through the Fas receptor leading to mitochondrial dysfunction and release of AIF and Endo G resulting in apoptosis. Results also showed that Gyp increased ROS and [Ca.sup.2+] levels and decreased the mitochondrial membrane potential which was associated with cytochrome c release, and activation of caspase-9 and -3, and AIF and Endo G release. Those effects showed that AIF and Endo G migrated from mitochondria into nuclei.

Results indicated that Gyp stimulated expression of GADD153 and GRP78 (Fig. 7) which may be associated with the release of [Ca.sup.2+] (Fig. 4) and a decrease in levels of [DELTA][[PSI].sub.m] (Fig. 4) in HL-60 cells. GADD153 and GRP78 are hallmarks of ER stress (Chen et al. 2009b) and the induction of GADD153 is highly responsive to ER stress. Based on all the results from in vitro studies, we find that Gyp induced apoptosis in human leukemia HL-60 cells through ER stress, mitochondrial-and caspases-dependent pathway; moreover, we investigated whether or not Gyp can affect HL-60 cells in vivo. Therefore, we injected HL-60 cells by s.c. into the mice for generating leukemia tumor xenograft model. This model had been used for monitoring agent affecting tumor in vivo. Our results also showed that dietary Gyp decreased the tumor size and weights of HL-60 tumor in vivo.

However the most crucial discovery is that we found that Gyp administered orally reduced HL-60 tumors in a xenograft animal model. Tumors in mice receiving Gyp at 5 and 20 mg/kg showed a reduction of tumors by 34% and 57%, respectively compared with a control group (Fig. 9A and

B). Our earlier studies have been shown that Gyp was not toxic at the doses administered in the present study (36). It is important to note that complete regression of HL-60 cells xenografts was not achieved with a single Gyp treatment. Therefore, multiple treatments may be needed to completely inhibit tumor growth. In conclusion, the present results demonstrated that Gyp induced ER stress due to increased GADD153 and GRP78, promoted ROS and [Ca.sup.2+] production, changed the ratio of Bax/Bcl-2 (increased the levels of Bax but decreased the levels of Bcl-2) resulting in a decrease in the levels of [DELTA][[PSI].sub.m],and cytochrome c. Release of AIF and Endo G from mitochondria was stimulated followed by the activation of caspase-9 and -3 and finally inducing apoptosis in HL-60 cells in vitro as shown in Fig. 8. The results from injecting HL-60 cells in vivo demonstrated that Gyp decreased both the tumor size and weight in the xenograft mouse model. Taken together, these findings provide new insight (Fig. 8) into mechanisms of Gyp function on human myeloid leukemia HL-60 cells in vitro and a xenograft mouse model.

Acknowledgements

This work was supported by the grant from Taiwan Department of Health, China Medical University Hospital, Cancer Research Center of Excellence (DOH100-TD-C-111-005).

References

Bode, A.M., Dong, Z., 2004, Targeting signal transduction pathways by chemopreventive agents. Mutat. Res.555, 33-51

Brugarolas, J., Chandrasekaran,C., Gordon, J.I., Beach, D., Jacks, T., Hannon,G.J., 1995. Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature 377, 552-557.

Chen,J.C., Lu, K.W., Lee,J.H., Yeh, C.C., Chung.J.G., 2006. Gypenosides induced apoptosis in human colon cancer cells through the mitochondria-dependent pathways and activation of caspase-3. Anticancer Res. 26, 4313-4326.

Chen. J.C, Lu, K.W., Tsai, M.L., Hsu, S.C., Kuo. C.L., Yang, J.S., Hsia, T.C., Yu, C.S., Chou, S.T., Kao, M.C., Chung, J.G., Wood, W.G., 2009a. Gypenosides induced G0/G1 arrest via CHk2 and apoptosis through endoplasmic reticulum stress and mitochondria-dependent pathways in human tongue cancer SCC-4 cells. Oral Oncol. 45, 273-283.

Chen, J.C., Tsai, C.C., Chen, L.D., Chen, H.H., Wang, W.C., 2000. Therapeutic effect of gypenoside on chronic liver injury and fibrosis induced by CCl4 in rats. Am. J. Chin. Med. 28.175-185.

Chen, M.H., Chen, S.H., Wang, Q.F., Chen, J.C., Chang, D.C., Hsu, S.L., Chen, C.H.,.Sheue. C.R., Liu, Y.W., 2008. The molecular mechanism of gypenosides-induced G1 growth arrest of rat hepatic stellate cells. J. Ethnopharmacol. 117, 309-317.

Chen, T.C., Lai, K.C., Yang, J.S., Liao, C.L., Hsia, T.C., Chen, G.,W., Lin, J.J., Lin, H.,J., Chiu. T.H., Tang, Y.J., Chung, J.G., 2009b. Involvement of reactive oxygen species and caspase-dependent pathway in berberine-induccd cell cycle arrest and apoptosis in C6 rat glioma cells. Int. J. Oncol. 34, 1681 -1690.

Chiang.J.H., Yang,J.S., Ma, C.Y., Yang M,D., Huang H.Y., Hsia.T.C., Kuo, H.M., Wu, P.P., Lee, T.H., Chung, J.G., 2011. Danthron, an anthraquinone derivative, induces DNA damage and caspase cascades-mediated apoptosis in SNU-1 human gastric cancer cells through mitochondrial permeability transition pores and Bax-triggered pathways, Chem. Res. Toxicol. 24, 20-29.

Chiu, T.H., Chen, J.C., Chung, J.G., 2003, N-acetyltransferase is involved in gypenosides-induced N-acetylation of 2-aminofluorene and DNA adduct formation in human cervix epidermoid carcinoma cells (Ca Ski). In Vivo 17, 281-288.

Cui, J., Eneroth, P., Bruhn, J.G., 1999. Gynostemma pentaphyllum: identification of major sapogenins and differentiation from Panax species. Eur. J. Pharm. Sci. 8, 187-191.

Deng, C., Zhang, P., Harper, J.W., Elledge, S.J., Leder, P., 1995. Mice lacking p21ClPl/WAFl undergo normal development, but are defective in G1 checkpoint control. Cell 82, 675-684.

Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W., Elledge, S.J., Reed. S.I., 1994. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell 76, 1013-1023.

el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent. J.M., Lin, D., Mercer, W.E., Kinzler, K.W., Vogelstein, B., 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-825.

Geng, Y., Whoriskey, W., Park, M.Y., Bronson, R.T., Medema, R.H., Li. T., Weinberg, R.A., Sicinski, P., 1999. Rescue of cyclin D1 deficiency by knockin cyclin E. Cell 97. 767-777.

Guadagno. T.M., Newport. J.W., 1996. Cdk2 kinase is required for entry into mitosis as a positive regulator of Cdc2-cyclin B kinase activity. Cell 84, 73-82.

Harper.J.W., Adami, G.R., Wei, N., Keyomarsi, K., Elledge, S.J., 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75, 805-816.

Hou. J., Liu, S., Ma, Z., Lang, X., Wang, J., Liang, Z., 1991. Effects of Gynostemma pentaphyllum makino on the immunological function of cancer patients, J. Tradit. Chin- Med. 11,47-52.

Hsu, H.Y., Yang,J.S., Lu, K.W., Yu, C.S., Chou, S.T., Lin,J.J., Chen, Y.Y., Lin, M.L., Chueh, F.S., Chen, S.S., Chung, J.G., 2010. An experimental study on the antileukemia effects of gypenosides in vitro and in vivo. Integr. Cancer Ther.

Hu, L., Chen, Z., Xie, Y., 1996. New triterpenoid saponins from Gynostemma pentaphyllum. J. Nat. Prod. 59, 1143-1145.

Jensen,C.D., Block. G., Buffler. P., Ma, X., Selvin, S., Month, S., 2004. Maternal dietary risk factors in childhood acute lymphoblastic leukemia (United States), Cancer Causes Control 15,559-570.

Ji, B.C., Hsu, W.H., Yang, J.S., Hsia, T.C., Lu, C.C., Chiang, J.H., Yang, J.L., Lin, C.H., Lin, J.J., Suen, L.J., Gibson Wood, W., Chung, J.G., 2009. Gallic acid induces apoptosis via caspase-3 and mitochondrion-dependent pathways in vitro and suppresses lung xenograft tumor growth in vivo. J. Agric. Food Chem. 57, 7596-7604.

la Cour, B., Molgaard, P., Yi, Z., 1995. Traditional Chinese medicine in treatment of hyperlipidaemia. J. Ethnopharmacol. 46, 125-129.

Lai, W.W., Yang,J.S., Lai, K.C., Kuo, C.L. Hsu, C.K., Wang, C.K., Chang, C.Y., Lin,J.J., Tang, N,Y., Chen, P,Y., Huang, W. W., Chung, J. G., 2009. Rhein induced apoptosis through the endoplasmic reticulum stress, caspase- and mitochondria-dependent pathways in SCC-4 human tongue squamous cancer cells. In Vivo 23,309-316.

Li. L.,Jiao, L., Lau, B.H., 1993. Protective effect of gypenosides against oxidative stress in phagocytes, vascular endothelial cells and liver microsomes. Cancer Biother. 8, 263-272.

Lin, C.C., Huang. P.C., Lin, J.M., 2000. Antioxidant and hepatoprotective effects of Anoectochilus formosanus and Gynostemma pentaphyllum. Am. J. Chin. Med. 28, 87-96.

Lin, J.P., Yang, J.S., Lin, J.J., Lai, K.C., Lu, H.F., Ma. C.Y., Sai-Chuen Wu, R., Wu. K.C., Chueh, F.S., Gibson Wood, W., Chung, J.G., 2011. Rutin inhibits human leukemia tumor growth in a murine xenograft model in vivo. Environ. Toxicol.

Lin, S.S., Huang, H.P., Yang. J.S., Wu, J.Y., Hsai, T.C., Lin, C.C., Lin, C.W., Kuo, C.L., Gibson Wood, W., Chung, J.G., 2008. DNA damage and endoplasmic reticulum stress mediated curcumin-induced cell cycle arrest and apoptosis in human lung carcinoma A-549 cells through the activation caspases cascade-and mitochondrial-dependent pathway. Cancer Lett. 272, 77-90.

Lu, C.C., Yang, J.S., Huang, A.C., Hsia, T.C., Chou, S.T., Kuo, C.L., Lu, H.F., Lee, T.H., Wood, W.G., Chung, J.G., 2010a. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol. Nutr. Food Res. 54, 967-976.

Lu, H.F., Hsueh. S.C., Ho, Y.T., Kao, M.C., Yang. J.S., Chiu, T.H. Huamg, S.Y., Lin, C.C., Chung. J.C., 2007. ROS mediates baicalin-induced apoptosis in human promyelocytic leukemia HL-60 cells through the expression of the Gadd153 and mitochondrial-dependent pathway. Anticancer Res. 27, 117-125.

Lu, H.F., Lai, T.Y., Hsia, T.C., Tang, Y.J., Yang, J.S., Chiang, J.H., Lu, C.C., Liu, C.M., Wang, H.L., Chung, J.G., 2010b. Danthron induces DNA damage and inhibits DNA repair gene expressions in GBM 8401 human brain glioblastoma multiforms cells. Neurochem. Res. 35, 1105-1110.

Lu. H.F., Wang. H.L., Chuang. Y.Y., Tang, Y.J., Yang. J.S., Ma. Y.S., Chiang. J.H., Lu, C.C., Yang.J.L., Lai, T.Y., Wu, C.C., Chung. J.G., 2010c. Danthron induced apoptosis through mitochondria- and caspase-3-dependent pathways in human brain glioblastoma multiforms GBM 8401 cells, Neurochem. Res, 35, 390-398.

Lu, K.W., Chen, J.C., Lai.T.Y., Yang, J.S., Weng, S.W., Ma, Y.S., Tang, N.Y., Lu, P.J., Weng, J.R., Chung, J.G., 2010d, Gypenosides causes DNA damage and inhibits expression of DNA repair genes of human oral cancer SAS cells. In Vivo 24, 287-291.

Mutoh, M., Takahashi, M., Fukuda, K., Komatsu, H., Enya, T., Matsushima-Hibiya, Y., Mutoh, H., Sugimura. T., Wakabayashi, K., 2000. Suppression by flavonoids of cyclooxygenase-2 promoter-dependent transcriptional activity in colon cancer cells: structure-activity relationship. Jpn.J. Cancer Res. 91, 686-691.

Niculescu 3rd. A.B., Chen, X., Smeets, M., Hengst, L., Prives, C., Reed, S.I., 1998. Effects of p21(Cip1/Waf1) at both the G1/S and the G2/M cell cycle transitions: pRb is a critical determinant in blocking DNA replication and in preventing endoreduplication. Mol. Cell. Biol. 18, 629-643.

Noda, A., Ning. Y., Venable. S.F., Pereira-Smith. O.M., Smith. J.R., 1994. Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp. Cell Res. 211, 90-98.

Norman, H.A., Go, V.L., Butrum, R.R., 2004. Review of the International Research Conference on Food, Nutrition, and Cancer, 2004. J. Nutr. 134, 3391S-3393S.

Purmova, J., Opietal, L., 1995. Phytotherapeutic aspects of diseases of the cardiovascular system. 5. Saponins and possibilities of their use in prevention and therapy. Ceska Slov. Farm. 44, 246-251.

Schild, L., Chen, B.H., Makarov, P., Kattengell. K., Heinitz, K., Keilhoff, G., 2010. Selective induction of apoptosis in glioma tumour cells by a Gynostemma pentaphyllum extract Phytomedicine 17, 589-597.

Schild. L, Roth, A., Keilhoff, G., Gardemann, A., Brodemann, R., 2009. Protection of hippocampal slices against hypoxia/hypoglycemia injury by a Gynostemma pentaphyllum extract. Phytomedicine 16, 734-743.

Sherr. C.J., 1995. D-type cyclins. Trends Biochem. Sci. 20, 187-190.

Sherr, C.J., 1996. Cancer cell cycles. Science 274, 1672-1677.

Tan. H., Liu, Z.L., Liu, M.J., 1993. Antithrombotic effect of Gynostemma pentaphyllum. Zhongguo Zhong Xi Yi Jie He Za Zhi 13,278-280, 261.

Tsou,M.F., Peng, C.T., Shih, M.C., Yang, J.S., Lu, C.C., Chiang, J.H., Wu. C.L., Lin,J.P., Lo. C., Fan. M.J., Chung, J.G., 2009, Benzyl isothiocyanate inhibits murine WEHI-3 leukemia cells in vitro and promotes phagocytosis in BALB/c mice in vivo. Leuk. Res.,

Vink.J., Thomas, L., Etoh, T., Bruijn, J.A., Mihm Jr., M.C., Gattoni-Celli, S., Byers. H.R., 1993. Role of beta-1 integrins in organ specific adhesion of melanoma cells in vitro. Lab. Invest. 68,192-203.

Wang. C, Wang, X., Li, Y., Deng, S., Jiang, Y., Yue, L., 1995. A preliminary observation of preventive and blocking effect of Gynostemma pentaphyllum (Thunb) Makino on esophageal cancer in rats. Hua Xi Vi Ke Da Xue Xue Bao 26, 430-432.

Wang, Q.F., Chen, J.C., Hsieh, S.J., Cheng, C.C., Hsu, S.L., 2002. Regulation of Bcl-2 family molecules and activation of caspase cascade involved in gypenosides-induced apoptosis in human hepatoma cells. Cancer Lett. 183,169-178.

Wang. Q.F., Chiang, C.W., Wu, C.C., Cheng, C.C., Hsieh, S.J., Chen, J.C., Hsieh, Y.C., Hsu, S.L., 2007. Gypenosides induce apoptosis in human hepatoma Huh-7 cells through a calcium/reactive oxygen species-dependent mitochondrial pathway. Planta Med. 73, 535-544.

Weinberg. W.C., Denning, M.F., 2002. P21Waf1 control of epithelial cell cycle and cell fate. Crit. Rev. Oral Biol. Med. 13, 453-464.

Wen, Y.F., Yang.J.S., Kuo, S.C., Hwang, C.S., Chung,J.G., Wu, H.C., Huang, W.W., Jhan, J.H., Lin, C.M., Chen, H.J., 2010. Investigation of anti-leukemia molecular mechanism of ITR-284, a carboxamide analog, in leukemia cells and its effects in WEHI-3 leukemia mice. Biochem. Pharmacol. 79, 389-398.

WenzeL U., Kuntz. S., Brendel, M.D., Daniel. H., 2000. Dietary flavone is a potent apoptosis inducer in human colon carcinoma cells. Cancer Res. 60, 3823-3831.

Xiong, Y., Hannon. G.J., Zhang, H., Casso, D., Kobayashi, R., Beach, D., 1993. p21 is a universal inhibitor of cyclin kinases. Nature 366, 701-704.

Yang, J.S., Hour, M.J., Huang, W.W., Lin, K.L., Kuo, S.C., Chung, J.G., 2010. MJ-29 inhibits tubulin polymerization, induces mitotic arrest, and triggers apoptosis via cyclin-dependent kinase 1-mediated Bcl-2 phosphorylation in human leukemia U937 cells. J. Pharmacol Exp. Ther. 334, 477-488.

Yu, R., Wang. D.S., Zhou, H., 1996. Clinical and experimental study on effects of yinchen wuling powder in preventing and treating hyperlipoproteinemia, Zhongguo Zhong Xi Yi Jie He Za Zhi 16, 470-473.

Zhou. Z., Wang, Y., Zhou, Y., 1996. The effect of Gynostemma pentaphyllum mak (GP) on carcinogenesis of the golden hamster cheek pouch induced by DMBA. Zhonghua Kou Qiang Yi Xue Za Zhi 31. 267-270.

* Corresponding author at: Department of Biological Science and Technology. China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan. Tel.: +886 4 2205 3366 x 2161; fax: +886 4 2205 3764.

E-mail address: jgchung@mail.cmu.edu.tw (J,-G. Chung).

(1) These authors contributed equally to this work.

Jen-Jyh Lin (a),(b),(1), Hui-Ying Hsu (c),(1), Jai-Sing Yang (d), Kung-Wen Lu (g), Rick Sai-Chuen Wu (e), King-Chuen Wu (f), Tung-Yuan Lai (g), (h), Po-Yuan Chen (c), Chia-Yu Ma (i), W. Gibson Wood (j), Jing-Gung Chung(c),(k), *

(a) Graduate Institute of Chinese Medicine, China Medical University. Taichung 404, Taiwan

(b) Division of Cardiology, China Medical University Hospital, Taichung404, Taiwan

(c) Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan

(d) Department of Pharmacology, China Medical University, 404 Taichung, Taiwan

(e) Department of Anesthesiology, Critical Care and Pain Service, China Medical University Hospital, Taichung 404, Taiwan

(f) Department of Anesthesiology, E-DA Hospital/I-Shou University, Kaohsiung 824, Taiwan

(g) School of Post-Baccalaureate Chinese Medicine, China Medical University, Taichung 404, Taiwan

(h) Department of Chinese Medicine and Internal Chinese Medicine, China Medical University Hospital 404, Taichung. Taiwan

(i) Department of Food and Beverage Management, Technology and Science Institute of Northern Taiwan, Taipei 112, Taiwan

(j) Department of Pharmacology, School of Medicine, Geriatric Research, Education and Clinical Center, VA Medical Center, University of Minnesota, Minneapolis. MN 55417. USA

(k) Department of Biotechnology, Asia University, Taichung 412, Taiwan
COPYRIGHT 2011 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lin, Jen-Jyh; Hsu, Hui-Ying; Yang, Jai-Sing; Lu, Kung-Wen; Wu, Rick Sai-Chuen; Wu, King-Chuen; Lai,
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Geographic Code:9TAIW
Date:Sep 15, 2011
Words:6057
Previous Article:Chemical composition and antimicrobial activity of Cymbopogon citratus and Cymbopogon giganteus essential oils alone and in combination.
Next Article:Reversal effect of 2',4'-Dihydroxy-6'-methoxy-3',5'-dimethylchalcone on multi-drug resistance in resistant human hepatocellular carcinoma cell line...
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters