Printer Friendly

Molecular detection and identification of virus associated with symptomatic and symptomless grapevines/Deteccao e identificacao molecular de virus associados a videiras sintomaticas e assintomaticas.

INTRODUCAO

A videira pertence a familia Vitaceae e ao genero Vitis, o qual possui varias especies, destacandose Vitis vinifera L., produtora de uvas finas, de origem europeia e conhecida por "uva vinifera" e Vitis labrusca L., produtora de uvas comuns, de origem americana e conhecida por "uva americana ou comum", esta ultima predomina no Brasil. Considerando essas duas especies, destacam-se, em diferentes segmentos desta cadeia produtiva, no Brasil, as cultivares 'Cabernet Sauvignon' (V vinifera), destinada a elaboracao de vinho fino e a cv. 'Isabel' (V labrusca) para a elaboracao de vinho comum, suco ou consumo in natura (GIOVANNINI, 2008).

No Brasil, as viroses ocorrem em todas as regioes viticolas e a incidencia, em varias dessas regioes, em cultivares americanas e viniferas, e bastante expressiva. Dentre os prejuizos causados, citam-se reducoes no rendimento e na qualidade das uvas, reducao da vida util do vinhedo e, dependendo da severidade da infeccao, pode comprometer totalmente a producao ou ate causar a morte da planta (FAJARDO et al., 2003; LIMA, 2009).

Ja foram relatadas no mundo pelo menos 60 especies virais na cultura da videira, embora nem todas se destaquem em importancia (MARTELLI, 2009; MONIS et al., 2010). No Brasil, dez virus foram detectados: Grapevine leafroll-associated virus (GLRaV-1, -2, -3, -5 e -6), Grapevine virus A e B (GVA e GVB), Rupestris stem pitting-associated virus (RSPaV), Grapevine fleck virus (GFkV) e Grapevine fanleaf virus (GFLV). As viroses que se destacam pela incidencia e importancia economica sao o enrolamento da folha (GLRaV-1, -2 e -3) e o lenho rugoso da videira, complexo formado pelo intumescimento dos ramos (GVB), a acanaladura do lenho de Kober (GVA) e as caneluras do tronco de Rupestris (RSPaV) (FAJARDO et al., 2003; LIMA, 2009).

A videira, por ser propagada vegetativamente, facilita a disseminacao e favorece a ocorrencia de doencas complexas, pelo acumulo de diferentes especies/estirpes virais em uma mesma planta (MARTELLI, 2009). Entretanto, as viroses podem passar despercebidas, por nao produzirem sintomas visualmente perceptiveis ou facilmente distinguiveis, o que decorre da expressao diferencial de sintomas na videira. Estes podem variar em funcao das condicoes ambientais, do estadio fenologico da planta, da fertilidade do solo e, principalmente, em funcao da combinacao envolvendo a cultivar e/ou especie da hospedeira e a estirpe e/ou especie viral. Considerando os sintomas das duas principais viroses da videira (enrolamento das folhas e lenho rugoso), verifica-se uma escala gradativa de expressao de sintomas, partindo das cvs. americanas e hibridas (as quais nao exibem sintomas de determinadas viroses ou estes nao sao caracteristicos ou facilmente perceptiveis) ate as cvs. viniferas (nas quais normalmente a expressao de sintomas e evidente). Isso e atribuido a distinta sensibilidade das especies/cultivares da hospedeira em resposta a infeccao viral, ou seja, determinados genotipos sao tolerantes a infeccao viral (KOVACS et al., 2001; FAJARDO et al., 2003).

Os objetivos deste trabalho foram detectar e identificar molecularmente as especies virais associadas a duas especies/cultivares de videiras, uma sintomatica e outra assintomatica, correlacionando a constatacao de infeccao viral com a sintomatologia e o tipo de hospedeira.

MATERIAL E METODOS

As amostras avaliadas foram provenientes de dois vinhedos experimentais da Embrapa Uva e Vinho, Bento Goncalves (RS): um da cv. 'Cabernet Sauvignon' (videira vinifera, Vitis vinifera), enxertada no porta-enxerto 'Paulsen 1103', em 1995, e outro da cultivar 'Isabel' (videira americana, V. labrusca), pe franco, plantada em 1971. Foram selecionadas duas plantas da cv. 'C. Sauvignon' e tres da cv. 'Isabel'. Como controle negativo, selecionou-se a cv. de porta-enxerto 'Paulsen 1103', obtida por termoterapia e cultura de tecidos, e comprovadamente sadia.

Os sintomas observados a campo na cv. 'C. Sauvignon', somente a partir do meio do ciclo vegetativo, foram folhas coriaceas com avermelhamento e enrolamento dos bordos das folhas para baixo, com as nervuras principais permanecendo verdes, presenca de caneluras no porta-enxerto e no tronco da copa e intumescimento com formacao de tecido corticento na base do ramo do ano. Ja na cv. 'Isabel', nao foram verificados sintomas perceptiveis de infeccao viral nas folhas, ramos e tronco, ao longo de todo o ciclo vegetativo.

O dsRNA foi extraido a partir 30 gramas de tecido vegetal obtido de ramos maduros de videira e adotando-se metodologia descrita por VALVERDE et al. (1990). Ao final, o dsRNA foi purificado em coluna de celulose (CF 11, Whatman) e ressuspendido em agua autoclavada.

A sintese de cDNA e as reacoes de PCR foram conduzidas conforme metodologia descrita por FAJARDO et al. (2000). As reacoes foram submetidas a uma desnaturacao inicial (94[degrees]C por 5min) seguida por 35 ciclos de amplificacao: desnaturacao (94[degrees]C por 50seg), pareamento (50[degrees]C por 50seg) e extensao (72[degrees]C por 1min), alem da extensao final (72[degrees]C por 7min). Para os fragmentos esperados, menores que 500pb, o tempo de extensao foi de 50seg e, para os pares de oligonucleotideos degenerados, a temperatura de pareamento foi de 48[degrees]C.

As plantas foram avaliadas quanto a presenca de 12 especies virais: Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Rupestris stem pitting-associated virus (RSPaV), Grapevine leafroll-associated virus (GLRaV-1, -2, -3, 4) e Grapevine chrome mosaic virus (GCMV), com 17 pares de oligonucleotideos especificos, alem de tres pares de oligonucleotideos degenerados para a deteccao de virus da familia Betaflexiviridae e dos generos Closterovirus e Trichovirus/Vitivirus, os quais permitem amplificar fragmentos em diferentes regioes do genoma viral (Tabela 1).

Os produtos da RT-PCR foram analisados em geis de agarose 1,2%, preparados em tampao TBE pH8,0, tingidos com brometo de etideo e visualizados em transluminador sobre luz UV As bandas observadas, correspondentes a fragmentos de tamanhos esperados, foram recortadas dos geis e eluidas com a utilizacao do kit "HiYield[TM] Gel/PCR DNA Extraction" (RBC Real Genomics). Os fragmentos de DNA eluidos foram ligados ao vetor pGEM-T Easy (Promega). A seguir, as ligacoes foram utilizadas na transformacao de celulas competentes de Escherichia coli DH5a, por eletroporacao no aparelho Gene Pulse II (Biorad).

O DNA plasmidial das colonias bacterianas transformadas foi extraido utilizando-se o kit Illustra plasmid Prep Mini Spin (GE Healthcare), seguindo as orientacoes do fabricante. A confirmacao da presenca dos fragmentos virais clonados nos plasmideos recombinantes foi realizada por digestao com a enzima de restricao EcoRI (SAMBROOK & RUSSEL, 2001). Procedeu-se ao sequenciamento automatico de nucleotideos de pelo menos um clone (isolado viral) obtido para cada fragmento amplificado.

As comparacoes entre as sequencias de nucleotideos (nt) e de aminoacidos deduzidos (aad), obtidas com outros isolados disponiveis em banco de dados (GenBank), foram realizadas utilizando-se o programa BLASTn ou BLASTp do NCBI (www.ncbi.nlm.nih.gov). Foram incluidas nas analises sequencias de genes homologos de isolados "estrangeiros", depositadas no GenBank de isoladostipo de cada especie viral amplificada, alem das estirpes (variantes biologicas caracterizadas com base na sequencia de nucleotideos de seu genoma) definidas e reconhecidas de cada virus. Para o GLRaV-2, as estirpes consideradas foram: 93/955, PN (=Sem, 94/970), H4, RG, Alfie e BD (ABOU GHANEM-SABANADZOVIC et al., 2000; BERTAZZON & ANGELINI, 2004; MENG et al., 2005a). Em relacao ao RSPaV, foram consideradas as estirpes GRSPaV-VS, GRSPaV-BS, GRSPaV-SG1 e GRSPaV-1 (MENG et al., 2006; ALABI et al., 2010) e Syrah (SY) (LIMA et al., 2006) e Pinot Noir (PN) (LIMA et al., 2009), recentemente identificadas. Para o GLRaV-3 foi considerada apenas a estirpe "tipica" NY (New York) (LING et al., 1997).

RESULTADOS E DISCUSSAO

Os resultados obtidos demonstraram a ocorrencia de infeccoes virais multiplas em todas as cinco plantas avaliadas com RSPaV e GLRaV-2, presentes na cv. 'C. Sauvignon' e RSPaV, GLRaV-2 e GLRaV-3, na cv. 'Isabel' (Tabela 2). Essas plantas nao apresentaram infeccoes com as especies virais GVA, GVB, GFkV, GFLV e GLRaV-1, ja relatadas no Brasil, tampouco com GVD, ArMV, GLRaV-4, GCMV e RSPaV (estirpe PN), ainda nao relatadas no pais.

Como mencionado anteriormente, as plantas avaliadas das cvs. 'C. Sauvignon' e 'Isabel' eram sintomaticas e assintomaticas, respectivamente. Este resultado evidencia a importancia de se conhecer o estado fitossanitario da planta, independemente da manifestacao ou nao de sintomas. Isso adquire ainda maior relevancia quando se sabe que mesmo materiais assintomaticos sofrem efeitos negativos decorrentes de infeccao viral. KOVACS et al. (2001) determinaram os efeitos da infeccao por GLRaV-3 e GFkV em videiras hibridas americanas assintomaticas. Eles observaram decrescimos no peso medio da baga (5-7%) e no teor de solidos soluveis totais (2-6%), alem de aumento da acidez titulavel do mosto (5-14%). Os resultados desse trabalho tambem demonstraram a prevalencia nas amostras de tres importantes especies virais que infectam a videira, o que esta em concordancia com outros relatos em diferentes paises viticolas do mundo (MARTELLI, 2009).

Considerando que todas as cinco amostras apresentaram-se infectadas por RSPaV, conforme determinado pela utilizacao dos oligonucleotideos RSPaV_v1/RSPaV-c1, a eficiencia de deteccao desse virus com os oligonucleotideos RSP2/RSP21 (nas amostras CS1, IS2 e IS3) e com os oligonucleotideos dPR1_v/dPR2_c (nas amostras CS1 e IS3) nao foi adequada (Tabela 2). Alem das mencionadas anteriormente, nao foram observadas quaisquer outras inconsistencias nos resultados obtidos com os oligonucleotideos testados (Tabela 2). Resultados semelhantes foram relatados por BERTAZZON & ANGELINI (2004), em testes de deteccao de diferentes isolados de GLRaV-2, nos quais obtiveram resultados falso-negativos em funcao do oligonucleotideo utilizado. MENG et al. (1999) destacam a importancia da escolha dos oligonucleotideos na indexacao de plantas infectadas por RSPaV e demonstram que a eficiencia entre diferentes pares de oligonucleotideos testados foi de 85 a 100%. Por fim, BEUVE et al. (2007) tambem ressaltam a importancia de oligonucleotideos desenhados com base em regioes conservadas, levando-se em consideracao a variabilidade entre os isolados da mesma especie.

Merece destaque a amplificacao positiva, a partir de todas as amostras, com os oligonucleotideos SY9F/SY8R, indicando infeccao por RSPaV, estirpe Syrah (RSPaV-SY) (Tabela 2), uma estirpe especifica do RSPaV capaz de causar engrossamento na regiao da enxertia, alem de necroses nesta regiao e ainda nao identificada em vinhedos nacionais. Estudos adicionais de caracterizacao biologica necessitariam ser conduzidos neste caso. Os oligonucleotideos especificos para a estirpe Syrah foram desenhados com base no gene da replicase, numa regiao que apresenta significativa variabilidade, permitindo assim a diferenciacao desta estirpe de outras (LIMA et al., 2006).

Neste estudo, foram sequenciados 12 isolados virais: sete de RSPaV, tres de GLRaV-2 e dois de GLRaV-3 (Tabela 2), os quais tiveram suas sequencias depositadas no GenBank (Tabela 3). Pela analise de identidade de nt do gene completo da CP (780pb), verifica-se que os isolados de RSPaV CS1 e IS2a apresentaram maiores identidades de nt com as estirpes SG1 (95,7%) e BS (91,5%), respectivamente. As identidades de nt e aad entre os dois isolados caracterizados foram de 84,7% e 81,8%, respectivamente. ALABI et al. (2010) analisaram, com base na analise filogenetica do gene da proteina capsidial, 84 isolados de RSPaV, incluindo nove isolados brasileiros, caracterizados por RADAELLI et al. (2009), que se agruparam com a estirpe tipica "GRSPaV-1" (isolados 420A, MG, CF210, CF208, MH, CF195-2, PN e CF207) e com a estirpe "GRSPaV-BS" (isolado CF195). MENG et al. (2005b) demonstraram experimentalmente que a infeccao da videira cv. 'St. George' com a estirpe SG1 e assintomatica.

Para aqueles isolados dos quais foi amplificado o gene da replicase incompleto (831 pb) do RSPaV, verificou-se que estes isolados (CS2a e IS1) apresentaram maiores identidades de nt com as estirpes SG1 (92,4%) e GRSPaV-1 (96,2%), respectivamente (Tabela 3). A analise de identidade de nt dos isolados, dos quais se amplificou parte do gene da replicase (339pb) de RSPaV, demonstrou que o isolado IS2b apresentou maior identidade de nt com a estirpe SG1 (91,0%) e que o isolado CS2b apresentou maior identidade de nt com o isolado Hai1 (96,1%), nao permitindo a identificacao de uma estirpe homologa (Tabela 3). Para o isolado IS3, do qual foi amplificado parte do gene da replicase (628pb) do RSPaV, verificaram-se maiores identidades de nt e aad com a estirpe SY (91,1% e 93,3%, respectivamente) (Tabela 3), confirmando os resultados obtidos na RT-PCR, com os oligonucleotideos especificos para esta estirpe viral (Tabela 2).

Pela analise de identidade de nt dos isolados em que foi amplificado o gene da CP incompleto (431pb) do GLRaV-2, verificou-se que os isolados CS2 e IS3 apresentaram maiores identidades de nt e aad com a estirpe H4 (92,5% (nt) e 93,7% (aad); 92,7% (nt) e 93,6% (aad), respectivamente) (Tabela 3). A identidade de nt entre os dois isolados foi alta (98,8%). A estirpe H4 foi caracterizada por ABOU GHANEM-SABANADZOVIC et al. (2000) como sendo uma variante biologica do GLRaV-2, distinta de outros isolados transmitidos mecanicamente, devido a diferencas nas reacoes em hospedeiras herbaceas e diferencas significativas na sequencia do gene CP. RADAELLI et al. (2009) caracterizaram seis isolados brasileiros deste virus e, destes, tres (M/C, MH e RI) tambem se mostraram mais proximos da estirpe H4. Para o isolado CS1, do qual foi amplificado um fragmento do gene da proteina HSP70 (623pb) do GLRaV-2, verificou-se maior identidade de nt com o isolado PV20 (94,8%), caracterizado por BEUVE et al. (2007), e 74-75,2% de identidade com as estirpes definidas para este virus (Tabela 3). Assim, nao foi possivel identificar a estirpe de GLRaV-2 homologa ao isolado CS1, com base nesta regiao do genoma (parte do gene HSP70).

Pela analise de nucleotideos do isolado IS2, do qual foi amplificado o gene completo (942pb) da CP do GLRaV-3, pode-se verificar que este isolado apresentou 92,3% de identidade de nt com a estirpe NY (Tabela 3), destancando-se, ainda, as altas identidades de nt verificadas com os isolados GP18 (98,4%), da Africa do Sul, e Pet4 (97,7%), do Brasil (FAJARDO et al., 2007). Ja pela analise de nucleotideos do isolado IS1, do qual foi amplificado um fragmento do gene da proteina HSP70 (593pb) do GLRaV-3, verificou-se que esse isolado apresentou 94,1% de identidade de nt com a estirpe NY (Tabela 3), destacando-se, ainda, alta identidade de nt com o isolado WC-HSP-2 (98,1%), da Africa do Sul.

A frequente infeccao viral multipla em videiras, como verificado neste trabalho, e a impossibilidade (RSPaV e GLRaV-3) ou a dificuldade de transmissao (GLRaV-2) dessas especies virais para hospedeiras herbaceas impedem ou dificultam bastante a geracao de informacoes sobre as caracteristicas biologicas (sintomatologia especifica, virulencia, etc.) desses virus e suas estirpes. Entretanto, a determinacao da variabilidade viral, correlacionando-a com os sintomas exibidos (ou nao) pela videira, reveste-se de importancia na busca da melhoria do estado sanitario desta cultura, pois agrega informacoes sobre as especies e possiveis estirpes virais, o que resulta em maiores sensibilidade e especificidade nos testes diagnosticos.

CONCLUSAO

Videiras vinifera sintomatica e americana assintomatica podem ser portadoras de infeccoes multiplas constituidas por diferentes especies virais, alem de apresentarem-se infectadas por estirpes virais. O conhecimento da variabilidade dessas especies e estirpes virais permite incremento de qualidade nos testes diagnosticos.

COMITE DE ETICA E BIOSSEGURANCA

O Certificado de Qualidade em Biosseguranca (CQB) da Embrapa Uva e Vinho esta registrado na Comissao Tecnica Nacional de Biosseguranca (CTNBio) sob o numero 0227/06.

REFERENCIAS

ABOU GHANEM-SABANADZOVIC, N. et al. Properties of a new isolate of Grapevine leafroll-associated virus 2. Vitis, v.39, p. 119-121, 2000. Disponivel em: <http://www.vitis vea.de/admin/volltext/e046268.pdf>. Acesso em: 05 out. 2010.

ALABI, J.A. et al. Sequence diversity, population genetics and potential recombination events in Grapevine rupestris stem pitting-associated virus in Pacific North-West vineyards. Journal of General Virology, v.91, p.265-276, 2010.

BASSO, M.F. Desenvolvimento de ferramentas sorologicas e moleculares para identificacao de virus em videiras e cochonilhas, alteracoes fisiologicas e na qualidade enologica da uva de videiras infectadas. 2010. 114f. Dissertacao (Mestrado em Agronomia)--Curso de Pos-graduacao em Agronomia, Universidade Estadual de Ponta Grossa, PR.

BERTAZZON, N.; ANGELINI, E. Advances in the detection of Grapevine leafroll-associated virus 2 variants. Journal of Plant Pathology, v.86, p.283-290, 2004. Disponivel em: <http://www.sipav.org/main/jpp/volumes/0404/040402.pdf>. Acesso em: 05 out. 2010.

BEUVE, M. et al. A sensitive one-step real-time RT-PCR method for detecting Grapevine leafroll-associated virus 2 variants in grapevine. Journal of Virological Methods, v.141, p.117-124, 2007. Disponivel em: <http://www.sciencedirect.com/ science?_ob=MImg&_imagekey=B6T96-4MV19MY- 1N&_cdi=5106&_user=7430124&_pii=S0166093406004204&_ origin=browse&_coverDate=05%2F31%2F2007&_sk=9985899 97&view = c& wchp = dGLbVtbzSkzk&md5=4c52e0f193704a27a2da3091dc48bc1c&ie=/ sdarticle.pdf>. Acesso em: 05 out. 2010. doi:10.1016/ j.jviromet.2006.11.042.

FAJARDO, T.V.M. et al. Caracterizacao parcial de um isolado do Grapevine fanleaf virus. Fitopatologia Brasileira, v.25, p.505-511, 2000.

FAJARDO, T.V.M. et al. Doencas virais. In: FAJARDO, T.V.M. Uva para processamento--Fitossanidade. Serie Frutas do Brasil 35. Brasilia: Embrapa Informacao Tecnologica, 2003. p.45-62.

FAJARDO, T.V.M. et al. Variability of the coat protein gene of Grapevine leafroll-associated virus 3 in Brazil. Fitopatologia Brasileira, v.32, p.335-340, 2007. Disponivel em: <http:// www.scielo.br/pdf/fb/v32n4/08.pdf>. Acesso em: 05 out. 2010. doi: 10.1590/S0100-41582007000400008.

GIOVANNINI, E. Producao de uvas para vinho, suco e mesa. 3.ed. Porto Alegre: Renascenca, 2008. 368p.

KOVACS, L.G et al. Latent infection by leafroll agent GLRaV3 is linked to lower fruit quality in French-American hybrid grapevines Vidal blanc and St. Vincent. American Journal of Enology and Viticulture, v.52, p.254-259, 2001.

LIMA, M.F. et al. Molecular analysis of a California strain of Rupestris stem pitting associated virus isolated from declining Syrah grapevines. Archives of Virology, v.151, p.1889-1894, 2006. Disponivel em: <http://www.springerlink.com.w10106.dotlib.com.br/ content/9864552221670162/fulltext.pdf>. Acesso em: 05 out. 2010. doi: 10.1007/s00705-006-0742-y.

LIMA, M.F. Deteccao e controle de viroses em videira. Petrolina: Embrapa Semiarido, 2009. 9p. Disponivel em: <http://www.cpatsa.embrapa.br:8080/public_eletronica/ downloads/CTE90.pdf>. Acesso em: 13 ago. 2010.

LIMA, M.F. et al. Genomic study and detection of a new variant of Grapevine rupestris stem pitting associated virus in declining California Pinot Noir grapevines. Journal of Plant Pathology, v.91, p.155-162, 2009. Disponivel em: <http:// www.sipav.org/main/jpp/volumes/0109/010917.pdf>. Acesso em: 05 out. 2010.

LING, K.S. et al. The coat protein gene of Grapevine leafroll-associated closterovirus 3: cloning, nucleotide sequencing and expression in transgenic plants. Archives of Virology, v.142, p.1101-1116, 1997. Disponivel em: <http://www.springerlink.com.w10106.dotlib.com.br/ content/934gve92efw70c7j/fulltext.pdf>. Acesso em: 05 out. 2010.

MARTELLI, G.P. Grapevine virology highlights 2006-09. In: MEETING OF INTERNATIONAL COUNCIL OF VIRUSES AND VIRUS DISEASES OF GRAPEVINE, 16., 2009, Dijon, France. Extended abstracts ... Dijon:ICVG, 2009. p.15-23.

MENG, B. et al. Rupestris stem pitting-associated virus-1 is consistently detected in grapevines that are infected with rupestris stem pitting. European Journal of Plant Pathology, v.105, p.191-199, 1999. Disponivel em: <http:/ /www.springerlink.com.w10106.dotlib.com.br/content/ m032206542842388/fulltext.pdf>. Acesso em: 05 out. 2010.

MENG, B. et al. Genome sequences and structures of two biologically distinct strains of Grapevine leafroll-associated virus 2 and sequence analysis. Virus Genes, v.31, p.31-41, 2005a.

MENG, B. et al. Complete genome sequences of two new variants of Grapevine rupestris stem pitting-associated virus and comparative analyses. Journal of General Virology, v.86, p. 1555-1560, 2005b. Disponivel em: <http://vir.sgmjournals.org/ cgi/reprint/86/5/1555>. Acesso em: 05 out. 2010. doi: 10.1099/ vir.0.80815-0.

MENG, B. et al. Genetic diversity analyses of Grapevine rupestris stem pitting-associated virus reveal distinct population structures in scion versus rootstock varieties. Journal of General Virology, v.87, p.1725-1733, 2006. Disponivel em: <http://vir.sgmjournals.org/cgi/reprint/87/6/1725>. Acesso em: 05 out. 2010. doi: 10.1099/vir.0.81533-0.

MONIS, J. et al. Avances en el estudio de enfermedades de la vid provocadas por virus. Revista Enologia, AnoVII, p.1-8, 2010.

RADAELLI, P. et al. Variabilidade do gene da proteina capsidial de tres especies virais que infectam videiras no Brasil. Tropical Plant Pathology, v.34, p.297-305, 2009. Disponivel em: <http://www.scielo.br/pdf/tpp/v34n5/v34n5a02.pdf>. Acesso em: 04 out. 2010. doi: 10.1590/S1982-56762009000500002.

SAMBROOK, J.; RUSSEL, D. Molecular cloning: a laboratory manual. 3.ed. New York: Cold Spring Harbor Laboratory, 2001. 999p.

VALVERDE, R.A. et al. Analysis of double-stranded RNA for plant virus diagnosis. Plant Disease, v.74, p.255-258, 1990.

Marcos Fernando Basso (I) Thor Vinicius Martins Fajardo (II) * Marcelo Eiras (III) Ricardo Antonio Ayub (I) Osmar Nickel (II)

(I) Departamento de Fitotecnia e Fitossanidade, Universidade Estadual de Ponta Grossa (UEPG), Ponta Grossa, PR, Brasil.

(II) Embrapa Uva e Vinho, CP 130, 95700-000, Bento Goncalves, RS, Brasil. E- mail: thor@cnpuv.embrapa.br. * Autor para correspondencia.

(III) Instituto Biologico, Centro de Pesquisa e Desenvolvimento de Sanidade Vegetal (CPDSV), Sao Paulo, SP, Brasil.

Recebido para publicacao 26.08.10

Aprovado em 14.10.10

Devolvido pelo autor 16.11.10

CR-4041
Tabela 1--Oligonucleotideos especificos e degenerados
utilizados na deteccao viral por RT-PCR em videiras.

Virus                Oligonucleotideo   Sequencia (5'-3') (*)

GVA                  766                GGGGAGGT AGAT AT AGT AGG
                     C1197              TACCCGTGAGAAATGATGGG
GVB                  GVB_v              CAAGCAATTCCCCGAGAGT
                     GVB_c              TTTAGCCGCACTCCTTGACT
GVD                  GVD_v              GACGCAGGGATGTACCTTAGGACG
                     GVD_c              CCTCTACTTATGGAAATTGCGCTC
                     GFkV_v             ATGAGCCTCCCCGCTGACCTCC
GFkV                 GFkV_r             TCATGACGAGGGAGTGGGGCGG
                     GFkV_v             AGTACCTCCTCCACCGCACC
                     GFkV_c             TTTCTCGGGCAGAGAGCCGT
GFLV                 GFLVs2515          GGAAGAGGCCACTTCTTTCCTTGGG
                     GFLVa3300          CCCACCAGCTTCGTGATGGTAACGC
ArMV                 H428v              GCGGCGGATTGGGAGTT
                     C867c              CGATGGTAGGGGGAGCGTATT
                     RSPaV_v1           ATGGCAAGTCAAATTGGGAAAC
RSPaV                RSPaV c1           TCATTCATGTGTAACATTTGAA
                     RSP2               CAAGCATGCTCTTGGCAAC
                     RSP21              CCCTCTGGCGATTGAATTG
RSPaV-PN             2R                 TTCCCCAAACTTCCAACTTAC
                     PN1F               GATGGATACAAGTTACGGGC
RSPaV-SY             SY9F               AGGATTCCAAACTGTAGAGCAA
                     SY8R               TTGGTCGTCATCTTCCAGTT
                     GLRaV-1_v          ATGGCTAGCGTTATATCTCAAA
GLRaV-1              GLRaV-1_r          TTACACCTTAAGCTCGCTAGTA
                     LRA                ACGTTGAGATTAGTCTGACTC
                     CPdR               TCACAGCATCAATATCTTTTCC
GLRaV-2              V2CPf              CTAGTCTAAATGGTGTCGA
                     V2CPr2             TTCAGAGAGCTTCGGGCAAG
GLRaV-3              LR3 8504v          ATGGCATTTGAACTGAAATT
                     LR3 9445c          CTACTTCTTTTGCAATAGTT
GLRaV-4              LR4f               ACCCTTCATAAGCAGGAACC
                     LR4r               CTTGTGAAACCGACGGCC
GCMV                 GCMVs              ATGTGTGCCACTACTGGCATGCA
                     GCMVa              TTCTCTTCAAGAAATGCCTAAGA
Closterovirus        HSP-P1             GGITTIGAITTY GGIACIAC

                     HSP-P2             RTCIAAIGTICCICCICCCRAA
Tricho/Vitivirus     dPR1 v             GCDAARGCNGGNCARACHHTVGCBTGYTT
                     dPR2_c             RAAYTCNCCNSWRAANCKCAT
Betaflexi vi ridae   dRW up1            WGCIAARGCIGGICARAC
                     dRW do2            RMYTCICCISWRAAICKCAT

Orientacao dos oligonucleotideos: senso (primeiro linha) e antisenso
(segunda linha).

(*) As referencias originais dos oligonucleotideos
encontram-se em BASSO (2010).

Tabela 2--Resultados obtidos por RT-PCR para as
amostras de videiras sintomaticas e assintomaticas,
avaliadas para a presenca de 12 especies virais.

Virus              Oligonucleotideos     Localizacao    Tamanho
                                          fragmento    fragmento
                                         amplificado     (pb)

GVA                766/C1197                 CP           451
GVB                GVB_v/GVB_c               CP           693
GVD                GVD v/GVD c               CP           963
                   GFkV v/GFkV r             CP           693
GFkV               GFkV v/GFkV c             REP          245
GFLV               GFLVs2515/GFLVa3300       CP           809
ArMV               H428v/C867c               CP           440
RSPaV              RSPaV_v1/RSPaV_c1         CP           780
                   RSP2/RSP21                REP          831
RSPaV-PN           2R/PN1F                   MTR          505
RSPaV-SY           SY9F/SY8R                 REP          628
                   GLRaV-1 v/GLRaV-1 r       CP           969
GLRaV-1            LRA/CPdR                 CPd2         1019
GLRaV-2            V2CPf/V2CPr2              CPm          431
GLRaV-3            LR3 8504v/LR3 9445c       CP           942
GLRaV-4            LR4f/LR4r              ORF1 e 2        500
GCMV               GCMVs/GCMVa               CP           391
Closterovirus      HSP-P1/HSP-P2            HSP70       593-623
Tricho/Vitivirus   dPR1_v/dPR2_c             REP          339
Betaflexiviridae   dRW up1/dRW do2           REP          339

Virus              Oligonucleotideos              Amostra

                                            CS1         CS2

GVA                766/C1197                --          --
GVB                GVB_v/GVB_c              --          --
GVD                GVD v/GVD c              --          --
                   GFkV v/GFkV r            --          --
GFkV               GFkV v/GFkV c            --          --
GFLV               GFLVs2515/GFLVa3300      --          --
ArMV               H428v/C867c              --          --
RSPaV              RSPaV_v1/RSPaV_c1       (+) *         +
                   RSP2/RSP21               --         (+) *
RSPaV-PN           2R/PN1F                  --          --
RSPaV-SY           SY9F/SY8R                 +           +
                   GLRaV-1 v/GLRaV-1 r      --          --
GLRaV-1            LRA/CPdR                 --          --
GLRaV-2            V2CPf/V2CPr2              +         (+) *
GLRaV-3            LR3 8504v/LR3 9445c      --          --
GLRaV-4            LR4f/LR4r                --          --
GCMV               GCMVs/GCMVa              --          --
Closterovirus      HSP-P1/HSP-P2         (+) (LR2)       +
Tricho/Vitivirus   dPR1_v/dPR2_c            --           +
Betaflexiviridae   dRW up1/dRW do2           +       (+) (RSP)

Virus              Oligonucleotideos                  Amostra

                                            IS1         IS2       IS3

GVA                766/C1197                --          --        --
GVB                GVB_v/GVB_c              --          --        --
GVD                GVD v/GVD c              --          --        --
                   GFkV v/GFkV r            --          --        --
GFkV               GFkV v/GFkV c            --          --        --
GFLV               GFLVs2515/GFLVa3300      --          --        --
ArMV               H428v/C867c              --          --        --
RSPaV              RSPaV_v1/RSPaV_c1         +         (+) *       +
                   RSP2/RSP21              (+) *        --        --
RSPaV-PN           2R/PN1F                  --          --        --
RSPaV-SY           SY9F/SY8R                 +           +       (+) *
                   GLRaV-1 v/GLRaV-1 r      --          --        --
GLRaV-1            LRA/CPdR                 --          --        --
GLRaV-2            V2CPf/V2CPr2              +           +       (+) *
GLRaV-3            LR3 8504v/LR3 9445c       +         (+) *       +
GLRaV-4            LR4f/LR4r                --          --        --
GCMV               GCMVs/GCMVa              --          --        --
Closterovirus      HSP-P1/HSP-P2         (+) (LR3)       +         +
Tricho/Vitivirus   dPR1_v/dPR2_c             +       (+) (RSP)    --
Betaflexiviridae   dRW up1/dRW do2           +           +         +

(+) * Clones obtidos com oligonucleotideos especificos e
com sequencias de nucleotideos depositadas no GenBank.

(+) (LR2, LR3, RSP) Clones obtidos com oligonucleotideos
degenerados, identificados apos sequenciamento de
nucleotideos e com sequencias depositadas  no GenBank.

CS: cv. 'Cabernet Sauvignon' (sintomatica); IS:
cv. 'Isabel' (assintomatica).

CP (gene da proteina capsidial); REP (gene da replicase
viral); HSP70 (gene da proteina de choque termico 70);
MTR (metiltransferase); ORF (open  reading frame).

Tabela 3--Porcentagem (%) de identidade de
nucleotideos entre as estirpes dos virus
RSPaV, GLRaV-2 e GLRaV-3 e os isolados
virais desses mesmos virus, caracterizados
neste trabalho.

Virus          Gene          Tamanho    Isolado       Isolado
            sequenciado     fragmento   caracte-   caracterizado
                              (pb)       rizado       -codigo
                                                      GenBank

           CP (completa)       780        CS1        GU166289
                                          IS2a       GU166290
                               831        CS2a       HM059036
RSPaV                                     IS1        HM059037
           REP (parcial)       339        IS2b       HM358051
                                          CS2b       HM059038
                               628        IS3        HM130524
           CP (parcial)        431        CS2        HM059035
GLRaV-2                                   IS3        HM358050
          HSP70 (parcial)      623        CS1        HM059039
GLRaV-3    CP (completa)       942        IS2        HM059034
          HSP70 (parcial)      593        IS1        HM059040

Virus          Gene            Estirpe          %
            sequenciado        viral de      identi-
                                maior         dade
                              identidade      de nt

           CP (completa)       SG1- EUA       95,7
                              BS--Canada      91,5
                               SG1--EUA       92,4
RSPaV                       GRSPaV-1- EUA     96,2
           REP (parcial)       SG1--EUA       91,0
                            Hai1--Japao *     96,1
                               SY--EUA        91,1
           CP (parcial)       H4--Italia      92,5
GLRaV-2                       H4--Italia      92,7
          HSP70 (parcial)   PV20--Franca *    94,8
GLRaV-3    CP (completa)       NY--EUA        92,3
          HSP70 (parcial)      NY--EUA        94,1

CP (gene da proteina capsidial), REP (gene da replicase viral),
HSP70 (gene da proteina de choque termico 70); *correspondem a
isolado viral.

Codigos de nucleotideos das estirpes no GenBank: SG1 (AY881626),
BS (AY881627), GRSPaV-1 (NC_001948), SY (AY368590), H4 (AY697863),
NY (NC_004667) e isolados virais: Hai1 (AB277787), PV20
(EF012721).
COPYRIGHT 2010 Universidade Federal de Santa Maria
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Basso, Marcos Fernando; Fajardo, Thor Vinicius Martins; Eiras, Marcelo; Ayub, Ricardo Antonio; Nicke
Publication:Ciencia Rural
Date:Nov 1, 2010
Words:4216
Previous Article:Investigation of variable appropriately to the automatic flow control without the use of sensors in fields irrigated by means of multivariate...
Next Article:Green turtle head trauma with intracerebral hemorrhage: image diagnosis and treatment/Traumatismo craniano com hemorragia intracerebral em tartaruga...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters