Printer Friendly

Molecular characterization and tissue distribution of estrogen receptor genes in domestic Yak.

INTRODUCTION

Estrogen, which is a steroid hormone primarily synthesized in ovary and testis (Katsu et al., 2010), regulates a variety of functions in vertebrates, including reproductive immune, and central nervous systems (Bakker and Brock, 2010; McCarthy, 2010; Vasudevan and Pfaff, 2008). At present, a large amount of research has been done on the biological roles of estrogen in vertebrates, especially in reproductive performance (Hewitt and Korach, 2003; Wang, 2005). Wu et al. found treatment of in vitro mouse embryo cultures with the anti-estrogen CI 628 could block embryo development (Sengupta et al., 1982), and this type of blockage could be alleviated by the co-administration of E2, indicating a direct effect of estrogens on embryo development. In primates, it also has been shown that near-term fetuses deprived of estrogen in utero reduced the number of primordial follicles in the ovaries, and the phenomenon can be restored to normal in animals administered E2 (Billiar et al., 2003). These researches indicated the key role of estrogen during human primordial follicle formation. Moreover, a number of studies showed that endogenous estradiol-17p acted as a natural inducer of ovarian differentiation in non-mammalian vertebrates (Devlin and Nagahama, 2002; Sinclair et al., 2002).

Although estrogen has an important effect on fetal development, its extensive physiological functions are mediated by specific cell surface receptors, i.e., the estrogen receptors (ERs) (Beyer et al., 2003; Mermelstein and Micevych, 2008). Accordingly, it is important to analyze the ERs to understand their physiological role. ERs belong to a superfamily of nuclear hormone receptors that include other steroid hormone receptors, such as progestogen, androgen, glucocorticoid, and mineralocorticoid receptors (Blumberg and Evans, 1998). The members of this superfamily have a number of common features and their proteins can be divided into six distinct domains. The N terminal of the A/B domain has a transactivation function, and the C domain contains two zinc finger motifs, which is formed by a number of cysteine residues and necessary for DNA binding. The D area is the hinge region, which enables the protein to change its conformation. In addition, the E domain is possibly the ligand binding domain. The function of the F domain is not fully understood (Todo et al., 1996). Two types of ER, ERP, and ERP, arising from two distinct genes, have been isolated in vertebrates. DNAs encoding ERs have been cloned from a variety of vertebrate species including mammals (Green et al., 1986; White et al., 1987), bird (Krust et al., 1986), reptiles (Sumida et al., 2001; Katsu et al., 2004), amphibian (Weiler et al., 1987), and teleost fish (Pakdel et al., 1990). However, no information is available on the sequence and the expression pattern of ERs mRNA in yaks.

Yak (Bos grunniens), living in the Tibetan Plateau, has successfully adapted to the chronic cold and low-oxygen environment of high altitude (~3,500 to 5,500 m). As a key species in Tibetan Plateau, yaks play an important role in Tibetan life by providing meat and milk where few other animals can survive. Unfortunately, female yaks usually have a low reproductive rate (40% to 60%) compared with other bovines (Zi, 2003; Sarkar and Prakash, 2005). Therefore, it's of significance to study the reproductive biology of this species to meet an increasing demand in Tibet. To date, there is little information concerning the reproductive endocrinology of yak. Considering this, we isolated cDNA clones encoding yak ERs and detected their expression pattern in order to provide some data on their phylogenic relationship with other known vertebrate ERs and further investigated the special reproductive endocrine system of yak.

MATERIALS AND METHODS

Sample collection and preservation

The yaks were obtained from the Songpan Bovine Breeding Farm in Sichuan, China. These animals were killed, and their tissues, including heart, liver, spleen, lung, kidney, mammary gland, uterus, oviduct, ovary, and testis (male = 3, female = 3), were collected and immediately frozen in liquid nitrogen until use.

RNA isolation and cDNA cloning

Total RNA was extracted from tissues (11 difference tissues) using Trizol reagent (Invitrogen) according to the manufacturer's instructions. The primers for amplification f yak ER[alpha] (ER[alpha]01 and ER[alpha]02) and ER[beta] (ER[beta]01 and ER[beta]02) gene coding sequences were based on the full-length sequences of bovine ERs, designed by Bacon designer (Table 1). cDNA synthesis was performed using PrimeScript reagent kit (TakaRa, Dalian, China) in a total volume of 10 [micro]L of reaction mixture, containing 2 [micro]L of 5 x PrimeScript Buffer, 0.5 [micro]L of PrimeScript RT enzyme Mix I, 0.5 [micro]L of Oligo dT primer, 0.5 [micro]L of random 6 mers, and 6.5 [micro]L of total RNA. This cDNA was used as a template in reverse transcription-polymerse chain reaction (RT-PCR). The PCR reaction was performed in 25 [micro]L volumes of the reaction mixture, containing 12.5 [micro]L of PCR Mastermix, 1 [micro]L of cDNA, 9.5 [micro]L of dd[H.sub.2]O, and 1 [micro]L of each primer. The PCR procedure consisted of first denaturation step at 94[degrees]C for 5 min, followed by 35 amplification cycles (denaturation at 94[degrees]C for 30 s, annealing at 58[degrees]C for 30 s, and extension at 72[degrees]C for 1 min 30 s), with a final elongation step at 72[degrees]C for 5 min. The expected fragment ER[alpha] 01 (820 bp), fragment ER[alpha] 02 (1,280 bp), fragment ER[beta] 01 (783 bp), and fragment ER[beta] 02 (875 bp) were extracted from the EZNA gel extraction kit (OMEGA, USA). The fragments were cloned into pMD19-T Vector (TakaRa, Dalian, China).

Sequence analysis

The nucleotide and deduced amino acid sequence identity was performed using LaserGene software package (DNASTAR, London, UK). The sequences of yak ER[alpha] and ER[beta] were aligned using the Multiple Sequence Alignment option in Clustal W. The neighbor-joining phylogenetic tree of ER[alpha] and ER[beta] was constructed using molecular evolutionary genetics analysis 5.

The tissue distributions of ER[alpha] and ER[beta] mRNA were examined in the heart, liver, spleen, lung, kidney, testis, mammary, oviduct, uterus, and ovary by quantitative RTPCR using the SYBR Premix Ex Taq (TakaRa, China) with Bio-Rad Connect (iCycler iQ5 Real-time Detection System) in a 15 [micro]L of reaction volume. GlycER[alpha]ldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control gene. The primers ER[alpha]Q, ERPQ, and GAPDH were designed using Bacon designer (Table 1). The reaction mixture for quantitative RT-PCR contained 7.5 [micro]L of Green premix (TakaRa), 1.0 [micro]L of cDNA, and 0.5 [micro]L of each gene-specific primer, and dd[H.sub.2]O was used to adjust the total volume to 15 [micro]L. Melting curve was performed to detect the specificity. PCR parameters were based on a three-step method: 94[degrees]C for 30 s; 40 cycle of amplification step (denaturation at 94[degrees]C for 5 s, annealing at 58[degrees]C for 25 s, and extension at 72[degrees]C for 25 s); and dissociation curve analysis at 95[degrees]C/10 s, 65[degrees]C to 95[degrees]C in 0.5[degrees]C intervals. Each sample was tested in triplicate. Serial dilutions of pooled cDNA samples of each tissue were used to generate the standard curves. The amplification efficiency between the target gene and reference gene is 97% to 99%. The expression of the target gene was compiled relative to the expression of GADPH by the relative quantification method [2.sup.-[DELTA][DELTA]Ct] (Schmittgen and Livak, 2008).

Statistical analysis

The statistical significance of the variation was analyzed by one-way analysis of variance or Student's t-test, followed by Tukey's multiple comparison test. All the quantitative RT-PCR data were expressed as mean [+ or -] SE, and significance was set at p < 0.05.

RESULTS

Molecular cloning and characterization of ER[alpha] and ER[beta] cDNA

The ER[alpha] PCR products were 820 and 1,280 bp, which were composed of 1,791 bp of open reading frame (ORF) coding 596 amino acids. The predicted molecular mass of yak ER[alpha] was 66.5 kDa. Multiple alignments were carried out based on amino acid sequences of ER[alpha] from Bos taurus, Gallus gallus, Homo sapiens, Mus musculus, Rattus norvegicus, alligator, Xenopus laevis, and zebrafish. ER[alpha] showed 99.5% and 91.1% amino acid identities with B. taurus and H. sapiens, whereas only 45.3% amino acid identity with zebrafish (Table 2). The ER[beta] PCR products were 783 and 875 bp, which contained 1,584 bp of ORF with a coding potential for 527 amino acid residues. The molecular mass of yak ER[beta] was 59.0 kDa. The protein sequence showed 99.0%, 70.5%, 78.8%, 80.9%, 96.5%, 87.8%, 79.6%, and 91.9% similarities to B. taurus, G gallus, H. sapiens, M. musculus, R. norvegicus, alligator, X. laevis, and zebrafish, respectively (Table 2). Similar to most nuclear receptors, both ER[alpha] and ER[beta] contained six important domains that are labeled A though F (Figure 1). C and E domains of yak were highly conserved from fish to mammals between ER[alpha] and ER[beta] (C domain, 94% to 99% amino acid identity; E domain, 58% to 94%) in the six bindings (Figures 2 and 3). Both ER[alpha] and ER[beta] contained eight cysteine residues (Figure 4).

Phylogenetic analysis

Based on the amino acid sequences of ER[alpha] and ER[beta] of other species, a phylogenetic tree was constructed using the neighbor-joining method (Figure 5). The phylogenetic analysis showed that all mammalian ERs formed an independent branch, whereas birds, reptile, amphibian, and fish formed another branch.

Tissue expression of estrogen receptor [alpha] and estrogen receptor [beta] in yak

The two transcripts were expressed in a variety of tissues, but their expression levels varied (Figure 6). The expression of ER[alpha] was highest in the oviduct, followed by the uterus, mammary gland, spleen, stomach, and ovary, and lowest in the liver, lung, testis, spleen, and heart. The expression of ER[beta] was highest in the oviduct; intermediary in the uterus, testis, mammary gland, and ovary; and lowest in the spleen, mammary gland, heart, spleen, and liver. Moreover, in the same reproductive organs, the yER[alpha] mRNA level was higher than yER[beta], except in the ovary.

DISCUSSION

Estrogen and its receptors are essential hormones for normal reproductive function in males and females during developmental stage. In this study, we cloned the ORFs of ERs from yak and examined the expression pattern of mRNA in 10 tissues to elucidate the evolution, structure, and function of the genes.

The results of the phylogenetic analysis showed that yak ER[alpha] and ER[beta] belonged to the ER[alpha] and ER[beta] clusters, respectively. Both also shared high identities of amino acid sequences with other ER of mammals. These results suggest that ERs were quite conserved in mammal molecular evolution.

ERs are divided into six domains designated A-F by the deletion and point mutation technology similarity to other steroid hormone receptors. The results of the alignment showed that the A/B domain was hyper-variable between ER[alpha] and ER[beta]. In this study, we found that yak ER[alpha] had a considerably longer A/B domain than ER[beta] (182 compared with 120 amino acids), which is similar with previous reports of other species (Ma et al., 2000; Choi and Habibi, 2003). hER[alpha] was significantly different compared with hERP; the A/B domain of hER[alpha] had a ligand-independent transactivation (AF-1) function by the promoter and cell context. Both are a combination of GAL4 DNA binding domain (GAL4-DBD) fusion protein; the N-terminal region of ER[alpha] possessed an autonomous and ligand-independent activity in HeLa cells, but not ERP. After deletion, the N-terminal region of hERP showed higher activity than the whole hERP. This result indicates that the A/B domain of ERP could repress a target function. Therefore, we speculate that the length of yak A/B domains between the ER[alpha] and ER[beta] may be related to the activity of the A/B domain.

The distribution of the eight cysteine residues was the same in both ER[alpha] and ER[beta], which is composed of two zinc fingers (Menue et al., 2002). These structures were necessary for combining with sequences of the target gene. (Kumar et al., 1987). Moreover, the C and E domains of the yak ERs were highly conserved from fish to mammals in both ER[alpha] and ER[beta] (C domain, 94% to 99%; E domain, 58% to 94%) in the six bindings, which agreed with previous results (Katsu et al., 2010). The aforementioned evidence indicated that these two domains were the core of the estrogen and are essential for estrogen actions. Therefore, the basic functions of ERs have been conserved during evolution. The D domain had a less conserved fragment than other domains, whereas an arginine residue, which is surrounded by other residues, was conserved in ERs. The present pattern of arginine showed that it has function in the ER secondary structure. Moreover, this pattern contributes to consolidating the structure of DNA binding.

This study showed that both ER[alpha] and ER[beta] were expressed in a variety of tissues in yak, which is similar to the ERs in many species (Socorro et al., 2000; Menuet et al., 2002; Choi and Habibi, 2003). This result further supports the diverse functions of ERs in yak. The mRNA expression levels of yak ERs were predominant in the mammary gland, uterus, and oviduct and showed low expression in the liver, heart, spleen, lung, kidney, and testis. Similarly, Katsu et al. (2010) reported that the reproductive organs are the main sites of ER synthesis. Our results also further demonstrated that ER genes possessed many functions, but the main function was in the regulation of sexual differentiation. We also found that in the same reproductive organ, except testis, the expression of ER[alpha] was higher than ER[beta]. Thus, the present data indicates that ER[alpha] is essential for fertility, mammary gland development, and lactation. In addition, ER[beta] has important functions in normal ovulation, but is not significant in lactation and reproduction, which is similar to Rattus norvegicus (Hiroi et al., 1999).

We reported the identification of ER genes, i.e., ER[alpha] (belonging to ER[alpha]) and yak ER[beta] (belonging to ER[beta]), in domestic yak. The extensive distribution of ER gene product expression in domestic yaks strongly supported that ERs have different functions in yak, and the predominant expression in reproductive organs further showed the evolutionary diversification and physiological function of the mammalian ER gene.

http://dx.doi.org/10.5713/ajas.2014.14380

REFERENCES

Bakker, J. and O. Brock. 2010. Early oestrogens in shaping reproductive networks: Evidence for a potential organisational role of oestradiol in female brain development. J. Neuroendocrinol. 22:728-735.

Beyer, C., J. Pawlak, and M. Karolczak. 2003. Membrane receptors for oestrogen in the brain. J. Neurochem. 87:545-550.

Billiar, R. B., N. C. Zachos, M. G. Burch, E. D. Albrecht, and G. J. Pepe. 2003. Up-regulation of alpha-inhibin expression in the fetal ovary of estrogen-suppressed baboons is associated with impaired fetal ovarian folliculogenesis. Biol. Reprod. 68: 1989-1996.

Blumberg, B. and R. M. Evans. 1998. Orphan nuclear receptors--new ligands and new possibilities. Genes Dev. 12: 3149-3155.

Chang, X. T., T. Kobayashi, T. Todo, T. Ikeuchi, M. Yoshiura, H. K. Kobayashi, C. Morrey, and Y Nagahama. 1999. Molecular cloning of estrogen receptors a and p in the ovary of a teleost fish, the tilapia (Oreochromis niloticus). Zoolog. Sci. 16:653-658.

Choi, C. and H. Habibi. 2003. Molecular cloning of estrogen receptor a and expression pattern of estrogen receptor subtypes in male and female goldfish. Mol. Cell. Endocrinol. 204:169-177.

Devlin, R. H. and Y Nagahama. 2002. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture 208:191-364.

Green, S., P. Walter, V. Kumar, A. Krust, J. M. Bornert, P. Argos, and P. Chambon. 1986. Human oestrogen receptor cDNA: sequence, expression and homology to v-ERP-A. Nature 320: 134-139.

Hewitt, S. C. and K. S. Korach. 2003. Oestrogen receptor knockout mice: Roles for oestrogen receptors alpha and beta in reproductive tissues. Reproduction 125:143-149.

Hiroi, H., S. Inoue, T. Watanabe, W. Goto, A. Orimo, M. Momoeda, O. Tsutsumi, Y Taketani, and M. Muramatsu. 1999. Differential immunolocalization of estrogen receptor alpha and beta in rat ovary and uterus. J. Mol. Endocrinol. 22:37-44.

Katsu, Y, E. Taniguchi, H. Urushitani, S. Miyagawa, M. Takase, K. Kubokawa, O. Tooi, T. Oka, N. Santo, J. Myburgh, A. Matsuno, and Taisenlguchi. 2010. Molecular cloning and characterization of ligand- and species-specificity of amphibian estrogen receptors. Gen. Comp. Endocrinol. 168:220-230.

Klein, S. L., R. Strausberg, L. Wagner, J. Pontius, S. W. Clifton, and P. Richardson. 2002. Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative. Dev. Dyn. 225:384-391.

Krust, A., S. Green, P. Argos, V. Kumar, P. Walter, J. M. Bornert, and P. Chambon. 1986. The chicken oestrogen receptor sequence: Homology with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J. 5:891-897.

Kumar, V., S. Green. G. Stack, M. Berry, J. R. Jin, and P. Chambon. 1987. Functional domains of the human estrogen receptor. Cell. 51:941-951.

Ma, C. H., K. W. Dong, and K. L. Yu. 2000. cDNA cloning and expression of a novel estrogen receptor P-subtype in goldfish (Carassius auratus). Biochim. Biophys. Acta (BBA)-Gene Structure and Expression 1490:145-152.

McCarthy, M. 2010. How it's made: organisational effects of hormones on the developing brain. J. Neuroendocrinol. 22:736-742.

Menuet, A., E. Pellegrini, I. Anglade, O. Blaise, V. Laudet, O. Kah, and F. Pakdel. 2002. Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biol. Reprod. 66:1881-1892.

Mermelstein, P. G. and P. E. Micevych. 2008. Nervous system physiology regulated by membrane estrogen receptors. Rev. Neurosci. 19:413-424.

Menuet, A., E. Pellegrini, I. Anglade, O. Blaise, V. Laudet, O. Kah, and F. Pakdel. 2002. Molecular characterization of three estrogen receptor forms in zebrafish: Binding characteristics, transactivation properties, and tissue distributions. Biol. Reprod. 66:1881-1892.

Mosselman, S., J. Polman, and R. Dijkema. 1996. ER[beta]: Identification and characterization of a novel human estrogen receptor. FEBS Lett. 392:49-53.

Pakdel, F., F. L. Gac, P. L. Goff, and Y. Valotaire. 1990. Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell. Endocrinol. 71:195-204.

Sarkar, M. and B. Prakash. 2005. Circadian variations in plasma concentrations of melatonin and prolactin during breeding and non-breeding seasons in yak (Poephagus grunniens L.). Anim. Reprod. Sci. 90:149-162.

Scatchard, G 1949. The attractions of proteins for small molecules and ions. Ann. NY Acad. Sci. 51:660-672.

Schmittgen, T. D. and K. J. Livak. 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3:1101-1108.

Sengupta, J., S. Roy, and S. Manchanda. 1982. Effect of an oestrogen synthesis inhibitor, 1, 4, 6-androstatriene-3, 17-dione, on mouse embryo development in vitro. J. Reprod. Fertil. 66: 63-66.

Sinclair, A., C. Smith., P. Western, and P. McClive. 2002. A comparative analysis of vertebrate sex determination. Novartis Foundation Symposium. 244:102-125.

Socorro, S., D. M. Power, P. E. Olsson, and A. V. Canario. 2000. Two estrogen receptors expressed in the teleost fish, Sparus aurata: cDNA cloning, characterization and tissue distribution. J. Endocrinol. 166:293-306.

Sumida, K., N. Ooe, K. Saito, and H. Kaneko. 2001. Molecular cloning and characterization of reptilian estrogen receptor cDNAs. Mol. Cell. Endocrinol. 183:33-39.

Todo, T., S. Adachi, and K. Yamauchi. 1996. Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell. Endocrinol. 119:37-45.

Vasudevan, N. and D. W. Pfaff. 2008. Non-genomic actions of estrogens and their interaction with genomic actions in the brain. Front. Neuroendocrinol. 29:238-257.

Wang, P. H. 2005. Role of sex hormone receptors in ovulation. Taiwan. J. Obstet. Gynecol. 44:16-25.

Weiler, I. J., D. Lew, and D. J. Shapiro. 1987. TheXenopus laevis estrogen receptor: Sequence homology with human and avian receptors and identification of multiple estrogen receptor messenger ribonucleic acids. Mol. Endocrinol. 1:355-362.

Zi, X.-D. 2003. Reproduction in female yaks (Bos grunniens) and opportunities for improvement. Theriogenology 59:1303-1312.

Mei Fu (1), Xian-Rong Xiong (1), Dao-liang Lan (2), and Jian Li (1,2) *

(1) College of Life Science and Technology, Southwest University for Nationalities, Chengdu, Sichuan 610041, China

* Corresponding Author: Jian Li. Tel: +86-028-8552-2227, E-mail: lijian@swun.cn

(2) Institute of Qinghai-Tibetan Plateau, Southwest University for Nationalities, Chengdu, Sichuan 610041, China.

Submitted May 20, 2014; Revised Jun. 25, 2014; Accepted Jul. 14, 2014

Table 1. Primers used for molecular cloning and Q-PCR in this study

Gene name            Primer sequence           bp      Accession
                                                       number

For molecular clone

  ER[alpha] 01F      ACTGTCTCAGCCCTTGACTTCTA   820     NM 001001443.1
  ER[alpha] 01R      GCTCTTCCTCCTGTTTTTATCAA
  ER[alpha] 02F      ACGATTGATAAAAACAGGAGGAA   1,280   NM 001001443.1
  ER[alpha] 02R      ACTGAGTGAGCGAATGAATGG
  ER[beta]01F        GCTGTTACCTACTCAAGACATGG   783     NM 174051.3
  ER[beta]01R        AGCTCTTTCACTCGGGTCAT
  ER[beta]02F        ACTGCCTGAGCAAAACCAA       875     NM_174051.3
  ER[beta]02R        TCACTGAGCCTGGGGTTTC

For real-time PCR

  ER[alpha] QF       TCAGGCTACCATTACGGAGT      230     AC_000166.1
  ER[alpha] QR       CGCTTGTGCTTCAACATTCT
  ER[beta] QF        CAGCCGTCAGTTCTGTATGC      191     AC 000167.1
  ER[beta] QR        GGCACAACTGCTCCCACTA
  GAPDHF             TGCTGGTGCTGAGTAGTTGGTG    290     AC_000162.1
  GAPDHR             TCTTCTGGGTGGCAGTGATGG

Q-PCR, quantity polymER[alpha] se chain reaction; F, forward primer; R,
reverse primer; QF, quantity forward primer; QR, quantity reverse
primer; GAPDHF, GAPDH forward primer; GAPDHR, GAPDH reverse primer.

Table 2. Similarities of amino acid of ER[alpha] and ER[beta] to other
species

                           Similarity

Species             ER[alpha]   ER[beta]

Bos taurus            99.5        99.1
Gallus gallus         76.1        78.0
Homo sapiens          91.1        84.0
Mus musculus          88.1        87.3
Alligator             75.5        77.8
Xenopus laevis        68.0        70.0
Rattus norvegicus     87.8        86.8
Zebrafish             45.3        53.9

ER, estrogen receptor.
COPYRIGHT 2014 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Fu, Mei; Xiong, Xian-Rong; Lan, Dao-liang; Li, Jian
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Date:Dec 1, 2014
Words:3643
Previous Article:Genomic selection for adjacent genetic markers of Yorkshire pigs using regularized regression approaches.
Next Article:VCS: tool for visualizing copy number variation and single nucleotide polymorphism.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters