Printer Friendly

Molecular characterization, chromosomal localizations, expression profile, and association analysis of the porcine PECI gene with carcass traits.

INTRODUCTION

Fat deposition of pigs is of economic importance because of market incentives for lean pork production and decreased feeding costs. It is crucial to investigate and characterize new candidate genes and QTL relevant to pig fat deposit traits. To date, several quantitative trait loci (QTL) significantly affecting 10th-rib, average backfat thickness and other production traits have been mapped on SSC7 (Wang et al., 1998; Nagamine et al., 2003). Peroxisomal [[DELTA].sup.3],[[DELTA].sup.2]-enoyl-CoA isomerase (PECI) was located near the boundary of the quantitative trait loci (QTL) region. [[DELTA].sup.3],[[DELTA].sup.2]-enoyl-CoA isomerase (Ecilp) is unique because its activity is necessary for [beta]-oxidation of all unsaturated fatty acids (Geisbrecht et al., 1999). The series of enzyme-catalyzed reactions required for degradation of fatty acids are evolutionarily conserved and accomplished primarily through the p-oxidation pathway. In peroxisomes, ECI was predicted to be a dominant enzyme for 3-cis 3[right arrow]2-trans and 3-trans 3[right arrow]2-trans isomerizations of long-chain intermediates (Zhang et al., 2002). Fatty acid [beta]-oxidation in mammals is considerably more complicated, primarily due to the existence of overlapping but distinct fatty acid poxidation pathways. Mammalian peroxisomes contain at least three fatty acyl-CoA oxidases, both L-specific and D-specific 2-enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase multifunctional proteins, and at least two thiolases, all of which are encoded by different genes (Palosaari et al., 1990a, 1991; Geisbrecht et al., 1998; Gurvitz et al., 1998; Geisbrecht et al., 1999; Partanen et al., 2004). When the ECI was completely excised in the mouse, it extensively perturbed the metabolism of unsaturated fatty acids, especially for short interval starvation and the fatty acid pattern of complex phospholipids was strongly altered (Palosaari et al., 1990b; Janssen et al., 2002). The PECI gene can be encoded by ECI1 and it is required for growth of saccharomyces cerevisiae on unsaturated fatty acids (Gurvitz et al., 1998). It can be concluded that the PECI gene may play an important role during the metabolic processing of unsaturated fatty acids. Deposition of fat by animals in their bodies is associated with the metabolism of fatty acids, and more research would contribute to understanding of porcine fat deposition.

MATERIALS AND METHODS

Materials and reagents

Genomic DNA was isolated from blood of mature Tongcheng pigs (Hubei province, China) by phenol/chloroform extraction. RNA was extracted from muscle tissue of adult Tongcheng pigs and adult Swedish Landrace with TRIzol reagent kit (Life Technologies, Grand Island, NE, USA). RACE (the rapid amplification of cDNA ends) was performed according to the instructions of the SMARTTM RACE cDNA Amplification Kit (Clontech Inc, Palo Alto, CA, USA). The PCR products of RACE were purified with the Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA). ORF were found by the program SeqMan (DNA star, Madison, WI, USA) and the amino acid sequences were deduced with Primer5.0 (Primer Premier5.0, Premier, Canada). Using the pGEM T-easy vector, DNase I (RNase-free) and M-MLV reverse transcriptase from TaKaRa Dalian (Dalian, China), primers were synthesized (Table 1) and PCR products were sequenced by AuGCT Biotechnology (Bejing, China).

Isolation of full-length cDNA of porcine PECI gene

Full-length cDNA sequence of porcine PECI was obtained using the RACE method and EST contigs. Gene-specific primers were designed from pig EST sequences (Table 1). The PCR products of RACE were purified and then cloned into the pGEM T-easy vector, and were sequenced using a commercial service. ORF were found using the program Seqman (DNA star, Madison, WI, USA) and the amino acid sequences were deduced with Primer5.0 (Primer Premier5.0, Premier, Canada).

Spatio-temporal expression pattern of PECI gene

Gene expression patterns were determined using RT-PCR. Total RNA of tissue expression was extracted from adult porcine heart, liver, spleen, lung, kidney, skeletal muscle, and fat. PCR conditions were as follows: 4 min at 94[degrees]C followed by 29 cycles of 40 s at 94[degrees]C, 40 s at 57[degrees]C, 30 s at 72[degrees]C, and a final extension of 5 min at 72[degrees]C. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as internal standard and the relative levels of specific mRNAs were determined by comparing the ratio of PCR products. The cycle numbers were selected to avoid the polymerase chain reactions (PCRs) entering plateau stages. PCR products (10 ^l) were used to detect the expression profile.

Genetic variation identification and association analysis

SNP sites were discovered by direct sequencing of individuals. The SNP was validated using Single-Strand Conformation Polymorphism (SSCP) and polymorphic sites were detected as PCR-RFLP. DNA samples of 126 unrelated animals from four Chinese indigenous pig breeds (Meishan, Erhualian, Dahuabai, Qingping) and the commercial Duroc pig were genotyped. PCR fragments showing different genotypes were cloned and sequenced. A chi-squared test on the allele frequencies distribution for five pig breeds was performed using SAS (version 8.0). Pigs (n = 120) used for association studies were from a crossbreed population. The PCR products were digested with PvuII.

An experimental population (198 pigs) including two cross-bred groups and three pure-bred groups, Large White x (Landrace x Tongcheng) (46 individuals), Landrace x (Large White x Tongcheng) (50 individuals), Tongcheng breed (53 individuals), Landrace (25 individuals) and Large White (24 individuals), were selected for association analysis. Firstly, the interaction effect between population and the genotypes of the gene was detected by linear model and no significant interaction effects were found. Therefore, it could not be incorporated into the model of association analysis. The association between genotype and traits (carcass traits and meat quality) was performed with the least square method (GLM procedure, SAS version 8.1). The model used to analyze the data was assumed to be: [Y.sub.ijk] = [mu]+[B.sub.i]+[P.sub.j]+[G.sub.k]+[e.sub.ijk]; where, [Y.sub.ijk] is the observation value of the trait; [mu] is the population mean; [B.sub.i] is breed effect, [P.sub.j] is carcass batch effect (j = 1 to 8); [G.sub.k] is genotype effect (k = TT, CT, CC) and [e.sub.ijk] is the random residual. The analysis was processed with the GLM procedure of SAS (version8.1).

Somatic cell hybrid and radiation hybrid mapping

A somatic cell hybrid panel (SCHP) (Yerle et al., 1996) was used for chromosomal region assignments and the radiation hybrid (IMpRH) panel was used for precise locations (Yerle et al., 1998). PCR reactions were performed in a volume of 10 [micro]l of 1xPCR Buffer (TakaRa), containing 20 ng of cell hybrid line DNA, 0.2 [micro]M of each primer, 100 [micro]M of each dNTPs, 1.5 mM Mg[Cl.sub.2] and 2.0 units Taq DNA Polymerase (TakaRa). The PCR profile was 5 min at 95[degrees]C followed by 35 cycles of 40 s at 94[degrees]C, 40 s at 62[degrees]C, 30 s at 72[degrees]C, and a final extension of 5 min at 72[degrees]C. Analysis of PCR results was performed with the software available on http://www.toulouse.inra.fr/lgc/pig/hybrid.htm (Chevalet et al., 1997) and the IMpRH mapping tool (http://imprh.toulouse.inra.fr/) (Milan et al., 2000) for SCHP and RH mapping. Two-point RH analysis was used for identification of linkage groups with LOD score threshold of 5.0. Multipoint locations were obtained by the minimum break analysis.

Phylogenetic tree of PECI gene

In order to realize the different species evolution in the PECI gene, a phylogenetic tree of the PECI gene based on CDs sequence was completed in MEG[[DELTA].sup.3].1 software and contained bootstrap values computed from 1,000 replicates.

RESULTS

Sequence characteristics of porcine PECI

The cDNA sequence of the human PECI gene (GenBank: NM 006117) was used to search the pig EST databases by BLAST (http://www.ncbi.nlm.nih.gov/blast/). Porcine EST (28 for PECI), which shared at least 80% identity with the corresponding human cDNAs, was assembled into contigs for primer design. The 5'-RACE procedures were used to obtain a complete porcine PECI CDS of 1,185 nucleotides (GenBank: DQ291159). Porcine PECI was 81% and 83% identical to human (NM_006117, NM_206836), and 80% identical to mouse homologues (NM_011868). The PECI gene was predicted to encode 394 amino acids with a molecular mass of 43.33 kDa and isoelectric point of 5.77. The predicted coding sequences (CDS) showed 75% identity to the corresponding human sequences (accession number NM_006117). For the porcine PECI gene, the 5'-RACE PCR gave rise to 487 bp fragments and the 3'-terminate obtained through in silico cloning. Computer analysis of the combined nucleotide sequence revealed an 1,185 bp ORF flanked by a 61-bp 5'UTR and a 60-bp 3'-UTR. The comparison of cDNA and DNA sequences revealed that the PECI gene spanned 1.695 kb and was made up of 11 exons.

[FIGURE 1 OMITTED]

Spatio-temporal expression pattern of PECI gene

RT-PCR analysis of total RNA showed that PECI expressed in all seven tissues examined. The template was selected from a famous indigenous Tongcheng breed of pig. By the expression profile, it could be concluded that there was little difference between heart and other tissues, the gene expressed in every tissue which testified to its broad expression pattern. The PECI gene was expressed comparatively higher in fat tissue (Figure 1).

Genetic variation identification and association analysis

The PCR-RFLP assay was used to examine the 267 bp fragment for the presence and location of two PvuII restriction sites by comparing the sizes of restriction fragments. The restriction fragments were detected by PAGE gel electrophoresis with 1xTBE buffer. The gels were stained with silver and photographed, and the band patterns were screened for polymorphism. The PCR product amplified using the primer expression-F and expression-R, was 267 bp from exon 10. Restriction enzyme analysis revealed a polymorphic PvuII site in the 3'-UTR. The two allele-specific patterns obtained after PvuII digestion were two uncut fragments of 142-bp and 125-bp fragments for allele T and two fragments of 125 and 17 bp for allele C. SNPs and association studies were used for PECI. PCR fragments representing different genotypes were sequenced and revealed a C to T mutation at position 143. Allele frequencies of PECI genotypes were significantly different beside Chinese indigenous Meishan (Table 2). By genetic variation analysis, allele frequency of T appeared preponderant in Duroc, Dahuabai and Erhualian pigs, while the C allele was preponderant in all other breeds, especially the Yushan Black pig in which no TT genotype presented. There was an imbalance in genotype between the indigenous and exotic pigs (Table 2). The genotype and allele frequencies of the SNPs of the PECI gene were detected in different breeds for association analysis (Table 3). Statistical analysis revealed that the CC-TT genotype had a significant association with average backfat thickness and muscle color (p<0.05) and especially with the trait of Buttock backfat thickness, this genotype expressed an highly significant association (p<0.01) (Table 4).

SCHP and RH mapping of the porcine PECI

PECI was mapped to SSC71/2 p11-13 (probability of localization to region equals 0.4703 and error risk <0.1%) by SCHP analyses. RH mapping allowed the locations of PECI to be defined more precisely. PECI showed close linkage to S0383 (PECI: 22 cR, LOD = 12.84), which was already mapped to porcine chromosome 7. Thus the most probable chromosomal localization for PECI was SSC71/2 p11-13.

Phylogenetic analysis of PECI gene in diverse species

A phylogenetic tree of the PECI gene was constructed by use of the UPGMA method. The analysis included the following species: Homo sapiens (NM_006117); Sus scrofa (DQ291159); Mus musculus (NM_011868); Rattus norvegicus (NM_001006966); and Gallus gallus (XM 418965). The data clearly showed distinct clusters with high bootstrap support (Figure 2). From the figure, Homo sapiens and Sus scrofa could be clustered as one (the bootstrap value was 77%). A very high bootstrap value was observed for the Mus musculus cluster and Rattus norvegicus cluster (100%).

DISCUSSION

Tissue distribution of porcine PECI gene

PECI gene is extensively expressed in the tissue of Tongcheng pigs. It appeared that there was a little difference between tissues in the indigenous breed. As far as the temporal expression profile was concerned, it may participate in the metabolism of fatty acids because of its comparatively high expression in fat tissue.

Mapping of porcine PECI gene

The PECI gene was mapped to porcine chromosome SSC71/2 p11-13 by SCHP panel and the most significant association was with S0383 (LOD = 12.84) analyzed by radiation hybrid (IMpRH) panels, which also characterised to SSC7. The PECI gene has been mapped to chromosome 6p24.3 in the human while to chromosome 13 A4 in the mouse (http://www.ncbi.nlm.nih.gov/entrez/). The information was also consistent with comparative mapping data as porcine chromosome 71/2 p11-13 has been shown to share homology with human chromosome 6p24.3 (update 22th May 2002 by INRA). The PECI gene was mapped to porcine Chr7. The largest effects were obtained for the SLA (the swine leukocyte antigens) region on SSC 7(Quintanilla et al., 2003). Many QTL affecting growth, carcass composition, reproduction, and meat quality traits have been detected in this region (Bidanel et al., 2001a, 2001b, 2002; Milan et al., 2002). So, it could be a candidate gene for research on porcine fat deposition.

Polymorphism and association analysis

A C/T transition was found at 3'-UTR of the porcine PECI gene. In this study, a significant difference could be seen among the different indigenous pig breeds. By Chi-square testing, Yushan Black pigs were significantly different from Duroc and Dahuabai pigs (Table 5) which may be because results in these pigs presented a different evolution in genetic selection. It was evident that polymorphism of the PECI gene was significantly associated with Average backfat thickness (p<0.05) and Buttock backfat (p<0.01) traits. SNP in the 3'-UTR was about 47 bp from coding sequences (CDs). Generally speaking, the 3'-UTR was a particular section of messenger RNA. A long chain of AMP residues seems to enhance its translatability by helping recruit mRNA to polysomes, thereby promoting initiation of translation. So, we deduced that the SNP site might influence porcine adipose tissue mass by way of polyadenylation. It is well known that many QTL on chromosome 7 influence fatness traits. Therefore, the PECI polymorphism could potentially be acting as a genetic marker for a linked QTL with effect on Buttock Backfat and Average backfat thickness. Research on fatty acid metabolism became rather significant for us to understand different deposition of adipose tissue between pig breeds. It would be convenient for us to develop porcine early breeding projects based on these results.

[FIGURE 2 OMITTED]

ACKNOWLEDGMENTS

We are grateful to Dr. Martine Yerle for providing the RH panel. This research was supported by National Natural Science Foundation of China (30771536), National High Science and Technology Foundation of China

REFERENCES

Bidanel, J. P., D. Milan, N. Iannuccelli, Y. Amigues, M. Y. Boscher, F. Bourgeois, J. C. Caritez, J. Gruand, P. Le Roy, H. Lagant, R. Quintanilla, C. Renard, J. Gellin, L. Ollivier and C. Chevalet. 2001a. Detection of quantitative trait loci for growth and fatness in pigs. Genet. Sel. Evol. 33(3):289-309.

Bidanel, J. P., A. Prunier, N. Iannuccelli and D. Milan. 2001b. Detection of quantitative trait loci for male and female reproductive traits in Meishanx Large White F2 pigs. Page 54 in Proc. 52nd Annual Meeting of the E.A.A.P. Budapest, Hungary.

Bidanel, J. P. and M. F. Rothschild. 2002. Current status of quantitative trait locus mapping in pigs. Pig News Info. 23(2):39-54.

Chevalet, C., J. Gouzy and M. San Cristobal-Gaudy. 1997. Regional assignment of genetic markers using a somatic cell hybrid panel: a WWW interactive program available for the pig genome. Computer Application Bioscience 13(1):69-73.

Geisbrecht, Brian V., Dai Zhu, Kerstin Schulz, Katja Nau, James C. Morrell, Michael Geraghtyi, Horst Schulz, Ralf Erdmann and Stephen J. Gould. 1998. Molecular Characterization of Saccharomyces cerevisiae D3,D2-Enoyl-CoA Isomerase. J. Biol. Chem. 273(50):33184-33191.

Geisbrecht, Brian V., Dongyan Zhang, Horst Schulz, and Stephen J. Gould. 1999. Characterization of PECI, a novel monofunctional Delta (3), Delta(2)-enoyl-CoA isomerase of mammalian peroxisomes. J. Biol. Chem. 274(31):21797-21803.

Gurvitz, Aner, Anu M.Mursula, Andreas Firzinger, Barbara Hamilton, Seppo H. Kilpelainen, Andreas Hartig, Helmut Ruis, J. Kalervo Hiltunnen and Hanspeter Rottensteiner. 1998. Peroxisomal [[DELTA].sup.3]-cis-[[DELTA].sup.2]-trans-Enoyl-CoA isomerase encoded by ECI1 is required for growth of the yeast Saccharomyces cerevisiae on unsaturated fatty acids. J. Biol. Chem. 273(47):31366-31374.

Janssen, Uwe and Wilhelm Stoffe. 2002. Disruption of mitochondrial [beta]-oxidation of unsaturated fatty acids in the 3,2-trans-Enoyl-CoA isomerase-deficient mouse. J. Biol. Chem. 277(22):19597-19584.

Milan, D., R. Hawken, C. Cabau, S. Leroux, C. Genet, Y. Lahbib, G. Tosser, A. Robic, F. Hatey, L. Alexander, C. Beattie, L. Schook, M. Yerle and J. Gellin. 2000. IMpRH server: an RH mapping server available on the web. Bioinformatics 16(6):558-559.

Milan, D., J. P. Bidanel, N. Iannuccelli, J. Riquet, Y. Amigues, J. C. Caritez, J. Gruand, P. Le Roy, H. Lagant, C. Renard and C. Chevalet. 2002. Detection of quantitative trait loci for carcass composition traits in pigs. Genet. Sel. Evol. 34(6):705-728.

Nagamine, Y., C. S. Haley, A. Sewalem and P. M. Visscher. 2003. Quantitative trait loci variation for growth and obesity between and within lines of pigs (Sus scrofa). Genetics 164(2):629-635.

Palosaari, Paivi. M. and J. Kalervo Hiltunen. 1990a. Peroxisomal bifunctional protein from rat liver is a trifunctional enzyme possessing 2-Enoyl-CoA hydratase, 3-Hydroxyacyl-CoA dehydrogenase, and [[DELTA].sup.3],[[DELTA].sup.2]-Enoyl-CoA isomerase activities. J. Biol. Chem. 265(5):2446-2449.

Palosaari, Paivi M., Johanna M. Kilponen, Raija T. Sormunen, Ilmo E. Hassinen and J. Kalervo Hiltunen. 1990b. [[DELTA].sup.3],[[DELTA].sup.2]-Enoyl-CoA isomerases (Characterization of the mitochondrial isoenzyme in the rat). J. Biol. Chem. 265(6):3347-3353.

Palosaari, Paivi M., Mauno Vihinen, Pekka I. Mantsala, Stefan E. H. Alexson, Taina Pihlajaniemi and J. Kalervo Hiltunen. 1991. Amino acid sequence similarities of the mitochondrial short chain [[DELTA].sup.3],[[DELTA].sup.2]-Enoyl-CoA isomerase and peroxisomal multifunctional [[DELTA].sup.3],[[DELTA].sup.2]-Enoyl-CoA isomerase, 2-Enoyl-CoA hydratase, 3-Hydroxyacyl-CoA dehydrogenase enzyme in rat liver. J. Biol. Chem. 266(17):10750-10753.

Partanen, Sanna. T., Dmitry K. Novikov, Alexander N. Popov Anu M. Mursula, J. Kalervo Hiltunen and Rik K. Wierenga. 2004. The 1.3 [Angstrom] crystal structure of human mitochondrial [[DELTA].sup.3]-[[DELTA].sup.2]-Enoyl-CoA isomerase shows a novel mode of binding for the fatty acyl group. J. Mol. Biol. 342(4):1197-1208.

Quintanilla, R., O. Demeure, J. P. Bidanel, D. Milan, N. Iannuccelli, Y. Amigues, J. Gruand, C. Renard, C. Chevalet and M. Bonneau. 2003. Detection of quantitative trait loci for fat androstenone levels in pigs. J. Anim. Sci. 81(2):385-394.

Wang, L., T.-P. Yu, C. K. Tuggle, H.-C. Liu and M. F. Rothschild. 1998. A directed search for quantitative trait loci on chromosomes 4 and 7 in pigs. J. Anim. Sci. 76(10):2560-2567.

Yerle, M., G. Echard, A. Robic, A. Mairal, C. Dubut-Fontana, J. Riquet, P. Pinton, D. Milan, Y. Lahbib-Mansais and J. Gellin. 1996. A somatic cell hybrid panel for pig regional gene mapping characterized by molecular cytogenetics. Cytogenet. Cell Genet. 73(3):194-202.

Yerle, M., P. Pinton and A. Robic. 1998. Construction of a wholegenome radiation hybrid panel for high-resolution gene mapping in pigs. Cytogenet. Cell Genet. 82(3-4):182-188.

Zhang, Dongyan, Wenfeng Yu, Brian V. Geisbrecht, Stephen J. Gould, Howard Sprecher and Horst Schulz. 2002. Functional characterization of [[DELTA].sup.3],[[DELTA].sup.2]-Enoyl-CoA isomerases from rat liver. J. Biol. Chem. 277(11):9127-9132.

H. Gao, B. Fan, M. J. Zhu and B. Liu *

Key Laboratory of Agricultural Animal Genetics, Breeding, Reproduction of Ministry of Education & Key Laboratory of Swine Genetics, Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, China

* Corresponding Author: Bang Liu. Tel: +86-27-87284140, Fax: +86-27-87280408, E-mail: liubang@mail.hzau.edu.cn

Received January 12, 2006; Accepted May 18, 2009
Table 1. Primer pairs designed for PECI gene

                                                      Binding
Gene    Primer           Primer sequence (5'-3')      region

PECI    5'-RACE        CCACCAGGCTGTCACTTTCCGCTTGTT
        primer1F       AATCTGCCCAAGGAAACTGC          Exon 3, 4
        primer1R       CTGTGACTCTGTGTGGACGG          Exon 11
        expression-F   ATGCGGAGGAAAGCAGAGTC          Exon 10
        expression-R   CACCTGCCTCCCTTCTCAAA          Exon 10
        Mapping-F      CAGAGCAGCGCCGTCTTACT          Exon 6
        Mapping-R      CTCCGAGTCCGCCTTGCTAC          Intron 6
GAPDH   Primer-F       CCTTCATTGACCTCCACTAC
        Primer-R       GTTGTCATACTTCTCATGGTTC

Gene    Primer         PCR (Tm)   Size (bp)

PECI    5'-RACE          74.0         487
        primer1F         59.2       1,215
        primer1R         56.3
        expression-F     59.2         267
        expression-R     60.0
        Mapping-F        60.7         402
        Mapping-R        62.2
GAPDH   Primer-F                      320
        Primer-R

Table 2. Allele frequency and genotype frequency of PECI in
different pig breeds

                                 Genotype frequency

Breed                 CC                CT                TT

Duroc            0.1111(2/18)      0.2778(5/18)      0.6111(11/18)
Qingping         0.3750(12/32)     0.4375(14/32)     0.1875(6/32)
Dahuabai         0.0556(1/18)      0.3889(7/18)      0.5556(10/18)
Erhualian        0.1765(3/17)      0.2941(5/17)      0.5294(9/17)
Yushan Black     0.7308(19/26)     0.2692(7/26)      0
Meishan          0.4667(7/15)      0.2667(4/15)      0.2667(4/15)

                         Allele frequency

Breed                  C                 T

Duroc               0.2500            0.7500
Qingping            0.5938            0.4062
Dahuabai            0.2500            0.7500
Erhualian           0.3235            0.6765
Yushan Black        0.8654            0.1346
Meishan             0.6000            0.4000

Table 3. Genotype and allele frequencies of SNPs of the PECI
gene in different pig breeds used for association analysis

                                   Genotype frequency

Breeds                   CC                CT               TT

Landrace           0.4000(10/25)     0.4400(11/25)    0.1600(4/25)
Large White        1.0000(24/24)     0                0
Tongcheng          0.3019(16/53)     0.3962(21/53)    0.3019(16/53)
Landrace x         0.9000(45/50)     0.0800(4/50)     0.0200(1/50)
  (Large white x
  Tongcheng)
Large White x      0.7391(34/46)     0.1957(9/46)     0.0652(3/46)
  (Landrace x
  Tongcheng)
Total              0.6515(129/198)   0.2273(45/198)   0.1212(24/198)

                            Allele frequency

Breeds                    C                T

Landrace               0.6200            0.3800
Large White            1.0000
Tongcheng              0.5000            0.5000
Landrace x             0.9400            0.0600
  (Large white x
  Tongcheng)
Large White x          0.8370            0.1630
  (Landrace x
  Tongcheng)
Total

Table 4. Association analyses of PvuII-RFLP genotypes with
production traits

                   Number of           Buttock backfat
Genotypes           animals               thickness

PECI-PvuII
  CC                  129             2.49 [+ or -] 0.07
  TT                   24             2.95 [+ or -] 0.15
  CT                   45             2.71 [+ or -] 0.11
p value
  CC-CT                               0.0905
  CC-TT                               0.0065 **
  CT-TT                               0.1644

                Average backfat
                   thickness
Genotypes         (in 3 sites)           Muscle color

PECI-PvuII
  CC           3.13 [+ or -] 0.06     3.09 [+ or -] 0.03
  TT           3.47 [+ or -] 0.13     2.92 [+ or -] 0.08
  CT           3.36 [+ or -] 0.09     3.15 [+ or -] 0.06
p value
  CC-CT        0.0411 *               0.3649
  CC-TT        0.0158 *               0.0428 *
  CT-TT        0.4210                 0.0073 **

* p < 0.05, ** p < 0.01.

Average backfat thickness (in 3 sites): backfat thickness at the
shoulder, backfat thickness depth between 6th and 7th ribs, 10th
rib backfat thickness.

Table 5. Chi square testing for genotype distribution of PECI
gene in pig breeds

                                                   Yushan      Xiao
Breed          Qingping   Dahuabai   Erhualian     Black      Meishan

Duroc           9.7185     0.7143     0.3717     24.4489 **   5.9319
Qingping        9.4629                6.2577      9.3938      1.2914
Dahuabai                              1.3585     25.5915 **   7.6804
Erhualian                                        19.9604 *    3.5230
Yushan Black                                                  7.9798

The Chi square of all breeds is: 42.8744 df = 10
[[chi square].sub.20.05(10)] = 18.3000;
[[chi square].sub.20.01(10)] = 23.2000.
COPYRIGHT 2010 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gao, H.; Fan, B.; Zhu, M.J.; Liu, B.
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:9CHIN
Date:Mar 23, 2010
Words:3936
Previous Article:Spray dried animal plasma as an alternative to antibiotics in weanling pigs: a review.
Next Article:Effect of exogenous administration of tamoxifen on hormonal profile and sexual maturity in Indian native Kadaknath fowl.
Topics:


Related Articles
Full-length cDNA, expression pattern and association analysis of the porcine FHL3 gene.
ASCL2 gene expression analysis and its association with carcass traits in pigs.
Molecular cloning and expression of Forkhead Transcription Factor O1 gene from pig Sus scrofa.
Single-minded 1 gene mapping and its variants association with growth, carcass composition and meat quality traits in the pig.
Tissue distribution, SNP detection and association study with immune traits of porcine LBP and CD14 genes.
Mapping, tissue distribution and polymorphism of porcine retinol binding protein genes (RBP5 and RBP7).
Isolation, expression pattern, polymorphism and association analysis of porcine TIAF1 gene.
Nutrigenomics approach-a strategy for identification of nutrition responsive genes influencing meat edible quality traits in swine.
Molecular characterization, chromosomal localizations, expression profile, and association analysis of the porcine PECI gene with carcass traits.
Effects of castration on androgen receptor, IGF-I Ea, MGF and myostatin gene expression in skeletal muscles of male pigs.

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters