Printer Friendly

Molecular Epidemiology and Risk Factors Assessment of Anaplasma spp. on Dairy Cattle in Southwest of Iran.

Introduction

Anaplasmosis, theileriosis, and babesiosis are the most important tick-borne diseases in dairy cattle of tropical and subtropical regions of the world (Kocan et al., 2015). In cattle, anaplasmosis caused by different genres of Anaplasma (Rickettsiales: Anaplasmataceae) including Anaplasma marginale (A. marginale), A. phagocytophilium, A. central and A. bovis (Kocan et al., 2015).

Bovine anaplasmosis caused by A. marginale is the most prevalent and pathogenic forms of the disease in Iran. In affected animals, anemia, icterus, fever, abortion, lethargy weight loss and death are the most prevalent clinical signs of the disease. Infected animals with A. marginale remain as carriers throughout their lifetime. Under some circumstances such as stress or other predisposing factors can induce anaplasmosis in carriers or persistent infected animals (Kocan et al., 2010; Noaman and Bastani, 2016).

A. phagocytophilum is a wide range host organism and can cause tick borne fever in dairy cattle and the other ruminants. The disease is characterized by fever, abortion, reduced fertility, reduced milk yield, leukopenia and inclusions in circulating neutrophils. The infections commonly have not any observable symptoms except combined with other pathogens. A. phagocytophilum is also considered as a zoonotic agent and can cause human granulocytic anaplasmosis (Bakken and Dumler, 2015; Noaman et al., 2016). Giemsa-stained blood smears and serological tests like competitive enzyme-linked immunosorbent assay and immunofluorescent antibody have been used widely in epidemiological researches. However, they have not sufficient sensitivity and specificity for the determination of early infections, true negative and carrier animals (Aubry and Geale, 2011; Noaman and Shayan, 2010a). Polymerase chain reaction (PCR), nested polymerase chain reaction (nPCR) and restriction fragment length polymorphism based on the 16S rRNA and major surface proteins are capable to identify low levels of Anaplasma spp. in persistent infected animals (Noaman, 2013a; Quiroz-Castaneda et al., 2016).

Several factors such as type of livestock, breed, sex, age, milk yield, herd size, interaction with wildlife, stress management, pasture type, presence of vectors, ecological and climatic conditions and socio-economic factors may play important roles in the epidemiology of anaplasmosis. However, in different regions, there are different risk factors associated with the presence of anaplasmosis (Amorim et al., 2014; Atif, 2015).

The diversity of climate in Iran can cause the diversity of tick species and subsequently, tick-borne diseases (Noaman, 2012; Noaman et al., 2017; Walker, 2014). Four Anaplasma genres including A. marginale, A. centrale, A. phagocytophilium and A. bovis have been recognized in Iranian cattle based on molecular assays (Noaman, 2013b; Noaman et al., 2009; Noaman and Shayan, 2009; Noaman and Shayan, 2010b). Khuzestan province is located in the southwest of Iran with tropical climate where the tick-borne diseases (especially anaplasmosis) are important in livestock. In Iran, anaplasmosis has been usually detected in blood smears using traditional Giemsa staining. However, this method only suitable in acute anaplasmosis and has no ability in detection of carrier animals and epidemiological studies. The goals of this study were to recognize the Anaplasma species in cattle using molecular method and to assess the risk factors affecting the epidemiology of Anaplasma spp. in tropical region of Iran.

Materials and Methods

Study area

The province of Khuzestan is located in the southwest of Iran, borders Iraq and the Persian Gulf and occupies an area of 63.213 k[m.sup.2]. It is located between 48[degrees]E and 49.5[degrees]E longitudes and between 31[degrees]N and 32[degrees]N latitudes (Figure 1). Topographic elevations in the province vary between zero and 3740m (above MSL). The climate of this area varies from arid to humid. The northern parts of the province experience cold weather, whereas the southern parts have tropical climate. Summer season is from April to September, and winter is from October to March. The annual mean of maximum summer temperatures in the province is about 50[degrees]C (in July), and annual mean of minimum winter temperature is 9[degrees]C (in December). The average annual rainfall is 150-256 mm in the south and 995-1100 mm in the north, and about 70% of annual rainfall events occur from February to April. The annual evaporation is 2000-4000mm (Zarasvandi et al., 2011). Figure 1 shows the geographical situation of Khuzestan province in Iran.

Sampling

From 21 June 2010 to 20 December 2016, a total 200 blood samples were collected from healthy dairy cattles of Khuzestan province based on multistage random sampling method. Sampling was carried out in 22 countries including: Andimeshk, Dezful, Shosh, Gotvand, Anika, Shoshtar, Masjed-soleiman, Leyzeh, Baghmalek, Haftkel, Ramhormoz, Ramshir, Dasht-Azadeghan, Ahwaz, Hoveizeh, Omidiyeh, Behbahan, Hendijan, Mahshahr, Shadegan, Abadan, Khoramshahr (Figure 1). Sample size was estimated based on a prevalence of 15%, a confidence level of 95%, and a precision of 0.5. In addition, a personal interview was conducted via a standardized questionnaire on farm management. Use of the chemical acaricides and kind of vectors (Tick/Mosquito) were recorded according to the farmer's statements.

The variables of climate, altitude, latitude, season, farm type, hygiene, vectors, use of acaricide, distance from other farms, farm density, race, age, sex and milk yield were recorded for each animal. Blood samples were taken from the jugular vein of each animal using vacuum tube containing the anticoagulant Ethylene Diamine Tetra-Acetic acid (EDTA), (Ava Co., Tehran, Iran). The blood samples were stored at -20[degrees]C until DNA extraction.

DNA extraction

DNA was extracted using the DNA isolation kit [Molecular Biology System Transfer, Iran] according to the manufacturer's instructions. The qualification analysis was determined using spectrophotometer (Varian Medical Systems, Palo Alto, CA, USA) at wavelength of 260 and 280 nm. The purification of the extracted DNA was conducted by OD260/OD280 ratio. The quantification analysis of the extracted DNA was performed using 1.5% agarose gel electrophoresis.

PCR and specific nPCR

For the identification of all Anaplasma species, a first PCR was used to amplify almost a 1468 bp fragment of the 16S rRNA gene containing the hyper variable (V1) region. The first PCR was performed using the universal primers fD1 and Rp2, in 50 [micro]L total volume including one time PCR buffer, 1.25 U Taq Polymerase (Cinnagen, Iran), 0.4 [micro]M of each primer, 0.2mM of each dATP, dTTP, dCTP and dGTP (Cinnagen, Iran), 1.5mM Mg[Cl.sub.2] and approximately 100-500 ng extracted DNA in automated thermocycler (Bio-Rad T100, Bio-Rad Laboratories Inc., CA, USA) using the following program: 5 min incubation at 95[degrees]C to denature double strand DNA, 40 cycles of 45 s at 94[degrees]C (denaturing step), 45 s at 55[degrees]C (annealing step) and 1.5 min, at 72[degrees]C (extension step) (Weisburg et al., 1991).

Specific internal primer sets targeting the V1 region of the 16S rRNA were used to detect A. bovis and A. phagocytophilum (Barlough et al., 1996; Kawahara et al., 2006). Specific nPCR reactions were performed directly with 1 [micro]L of the primary PCR product separately. The nPCR for A. bovis and A. phagocytophilum was performed in 25 [micro]L total volume.

The nPCR for detecting Anaplasma centrale (Amori strain) was performed as described by Inokuma et al. (2001).

The A. marginale msp4 gene was amplified by MSP45/MSP43 primers as reported previously by de la Fuente et al. (2002) in a 25 [micro]L volum PCR. The PCR and nPCR products were analyzed on 2% agarose gel in 0.5 times Tris-Borate-EDTA buffer and visualized using ethidium bromide (Merck, Darmstadt, Germany) and UV-transilluminator (Vilber Lourmat, Marne-la-Vallee Cedex, France). The primers are listed in Table 1.

The PCR products were purified with a MBST Gel extraction Kit (MBST, Tehran, Iran) and submitted for sequencing to Pishgam Biotech Co. (Tehran, Iran). The PCR product was sequenced three times in one direction. The A. marginale and A. phagocytophilum 16S rRNA gene sequences were deposited to Gen-Bank under accession numbers MG757665 and MG768969, respectively.

Categorization and classification of evaluated risk factors

Risk factors were categorized and classified as Climate (Mountain, Plain), Altitude (500-1000, <500), Latitude (32-33, <31), Season (Fall, Summer), Farm type (Semi-Industrial, Traditional), Hygiene (Good, Low, Normal), Vectors (Mosquito, Tick), Use of acaricide (No, Yes), Distance from other farms (<1Km, >5Km), Farm density (High, Low, Normal), Race (Hybrid, Native), Age (<1 Year, 1-3 Years, 3-5 Years, >5 Years), Sex (Female, Male), Milk yield (High, Low, Normal, Without).

Statistical analysis

A multiple logistic regression was performed for analyzing risk factors by using Statistical Package for Social Services (SPSS Inc, Chicago, USA) version 18.0. Chi-square ([chi square]) test was used to compare the variable factors in the cattle infected with A. marginale and A. phagocytophilum. A p value less than 0.05 was considered statistically significant.

Results

A total of eighty-eight samples out of two hundred examined generated an expected amplicon of 866 bp from A. marginale msp4 gene. Following the first PCR for amplifying the 16S rRNA gene of all Anaplasma species, positive samples were examined by specific nPCR for detection of A. phagocytophilum, A. bovis and A. centrale (Amori strain). Six of eighty-eight positive samples were giving positivity for A. phagocytophilum with nPCR. No samples generated an expected amplicon of A. bovis and A. central in specific nPCR. The overall prevalence of A. marginale and A. phagocytophilum infections were 44% and 3% respectively. All infected cattle with A. phagocytophilum were also involved with A. marginale.

Multivariate analysis of risk factors revealed that cattle of mountain regions were significantly (p<0.0001; OR=1.18) at higher risk as compared to plain regions. Significant association was found among different ages (p<0.002). Cattle <1 year age was (p<0.02; OR=605.3) at lower risk as compared to 1-3, 3-5 and >5 year age. Significant association was found between different latitude (p<0.01), i.e. the latitude 32[degrees]-33[degrees] (p<0.003; OR=30.48) was at lower risk as compared to <31[degrees]. Cattle with low milk yield were significantly (p<0.002; OR=175.86) at lower risk as compared to high, normal and without milk yield.

Low hygienic farms were significantly (p<0.011; OR=0.013) at higher risk as compared to good and normal hygienic farms. Distance from other farms (<1Km) was another important risk factor which showed significant association with the occurrence of Anaplasma infection (OR=66.18, p=0.021) (Table 2). There was no significant association between altitude, season, farm type, vectors, use of acaricide, farm density, race and sex with the occurrence of Anaplasma infection.

The Chi-square test output showed that the A. marginale prevalence was significantly higher (p=0.006) in cattle at latitude <31[degrees] as compared to the latitude 32[degrees]-33[degrees]. The prevalence of A. marginale was higher (p<0.0001) in fall as compared to that in summer. Farms with normal hygienic level had significantly higher (p=0.0001) prevalence as compared to those in other hygienic levels.

The presence of mosquito vectors in farm was found to be significantly associated to the prevalence of A. marginale infection (p=0.002) than presence of tick vectors. Farms with acaricide treatment showed significantly a higher (p=0.007) prevalence of A. marginale infection as compared to other farms. No significant association was found between prevalence of A. marginale infection and climate, altitude, farm type, distance from other farms, farm density, race, age, sex and milk yield (p>0.05).

The highest prevalence of A. phagocytophilum was observed (p<0.0001) in fall as compared to summer significantly.

Farms with normal hygienic level had a higher (p<0.0001) prevalence of A. phagocytophilum infection as compared to other farms (good and low hygienic level).

The higher infection rates of A. phagocytophilum were observed in the farms with normal density (p=0.004) than the farms with low or high density.

Farms with acaricide treatment showed significantly higher (p=0.042) prevalence of A. phagocytophilum infection as compared to other farms. No significant association was found between prevalence of A. phagocytophilum infection and climate, altitude, latitude, farm type, vectors, distance from other farms, race, age, sex and milk yield (p>0.05).

Discussion

The present study is the first molecular epidemiology in Iran to estimate the overall prevalence for Anaplasma spp. and recognize risk factors significantly associated with highly infected animals. Since dairy cattle breeding in Khuzestan province is more common in the shape of semi-industrial and traditional type dairy farms, samples were collected from these farms. Molecular results showed that Anaplasma species were frequent and widely distributed in Khuzestan province of Iran. In another study, overall molecular prevalence for Anaplasma spp. has been recorded at 38.7% of cattle in the central region of Iran (Noaman et al. 2009).

In the climate category, cattle in mountain regions where the elevation is between 735-482 m above the sea level and average temperature is between 26.9[degrees]C-31.8[degrees]C, had 1.18 times higher positivity than cattle in the plain regions where the elevation is between 0-307 m above the sea level and average temperature is between 30.3[degrees]C-41.2[degrees]C. It can be predicted that microclimate in mountainous area is more suitable than plain areas for plant growth, cattle breeding and tick proliferation. Therefore, the presence of tick-borne disease agents such as Anaplasma species in mountainous cattle is more likely in these areas compared to plain areas (Dantas-Torres, 2015). Studies in other geographical regions (Central and South America) have also revealed that the tick borne diseases are detected at a higher altitudes (mountain) than where the diseases was present in the recent past (plain) (Estrada-Pena and Salman, 2013; Milner and van Beest, 2013).

Clinical signs of anaplasmosis mainly appear in cattle older than one year. However, cows of all ages are susceptible to anaplasmosis (Aubry and Geale, 2011; Atif, 2015; Kocan et al., 2010). The present study revealed that the group of cattle under one year age was at a lower risk compared to other age groups. The good level of protective colostral immunity and lower exposure to Anaplasma spp. vectors have impact on the lower risk of anaplasmosis in this age group. Relation of anaplasmosis with age in this study was supported by the finding of other researchers in Brazil, Bangladesh, India and Pakistan (Amorim et al., 2014;; Atif et al., 2013; Rahman et al., 2015; Sharma et al., 2015).

The latitude 32[degrees]-33[degrees] was at lower risk when compared to <31[degrees] for Anaplasma spp. infections. The higher infection rate was seen in cattle of Ramshir, Omidiyeh, Behbahan, Hendijan, Mahshahr, Shadegan, Abadan and Khoramshahr at latitude <31[degrees]. Global warming may have different impact in the epidemiology of vector-borne diseases such as anaplasmosis. It has been demonstrated that the changes in climate including temperature levels can cause changes in the geographic distribution of ticks and other vectors in new latitudes (Milner and van Beest 2013). The A. marginale prevalence in cattle was significantly higher at latitude <31[degrees] than 32[degrees]-33[degrees]. The findings show that, vectors survived better at this latitude. The information on geographical latitude incidence patterns is important for the practitioners in planning the control. Since the disease occurred mainly in the southern parts of the province, vectors and transmission pattern in this region should be identified.

The present study confirmed that low yielding cattle have significantly lower risk when compared to high-yielding, moderate-yielding and non-milkers, in parallel with the results of da Silva and da Fonseca (2014). In another study, da Silva and da Fonseca (2014) found association between milk yield and seroprevalence for A. marginale in cattle. They observed that dairy cattle with higher milk production had 0.78 times chance to be more seropositive than animals with lower milk production. They suggested that lactation stress along with per parturient hormonal changes have some impact on immunosuppression status in animals and maintenance of anaplasmosis (da Silva and da Fonseca, 2014).

It may be expectable that farms in an isolated area and far from other farms are at very low risk of disease transmission. The present study showed that the farms with less than one km distance to each other played a main role as a risk factor which had significant association with the occurrence of anaplasmosis. There is no confirmed report about association between "distance between farms" and infection with Anaplasma species. To our knowledge, this is the first study that found "distance between farms" is an important risk factor of anaplasmosis.

Farms with good hygienic level had significantly lower prevalence than those in other hygienic levels. Previous studies indicated the hygienic management was one of the potential risk factors for anaplasmosis (Kispotta et al., 2017; Sajid et al., 2014).

There was any relation with the prevalence of anaplasmosis and the use of acaricide in the present study. The results of this paper disagree with Atif et al. (2013) who observed a significant relation between the moderate acaricide application within 60-90 days and seroprevalance to A. marginale in cattle.

Da Silva and da Fonseca (2013) observed a significant association between high animal density and high prevalence of anaplasmosis. In the current study, we found no evidence to suggest that farm density was associated with the prevalence of anaplasmosis.

Tick infestation is identified as an important risk factor which has significant association with the occurrence of Anaplasma infection (Atif et al., 2013; Costa et al., 2013; da Silva et al., 2014; da Silva and da Fonseca, 2014; Rahman et al., 2015;). Use of chemical acaricides and kind of vectors (Tick/Mosquito) were recorded according to the farmer's statements. Usually, acaricide spraying on the body of the cattle is a simultaneous method in case of the presence of the tick or mosquito on the skin of the cattle and thus, in these farms the livestock has been exposed to pathogens. This probably explains the higher prevalence of A. marginale in herds with acaricide treatment.

Only cattle in the rural areas of Gotvand and Shoshtar cities were infected by A. phagocytophilum. The climatic conditions in these areas are different from those in other Khuzestan zones. These areas have a lower average temperature and less than 100 meters altitude above sea level. The six positive cases were from traditional small scale cattle farms and pasture grazing was the main feed source. In pasture grazing feeding, the cattle have a great likelihood of tick infestation, so indoor housing hygiene and acaricide treatment do not have a great impact on control of tick-borne diseases in indoor housing.

Although season, race, sex, and vectors were reported as risk factors by Sajid et al. (2014) and Rahman et al. (2015), there was no significant association between these factors and infections with Anaplasma species.

Conclusion

The present study shows that in Khuzestan province the tropical region of Iran, infections were caused by Anaplasma spp. and the prevalence of anaplasmosis was 44%. The mountain regions, age, latitude, milk yield, farm hygiene and distance from other farms are the major risk factors associated with molecular prevalence to Anaplasma spp. in dairy cattle in Khuzestan, Iran. It can be a guide to strategic control programs for anaplasmosis in this area. There was no significant association between altitude, season, farm type, vectors, use of acaricide, farm density, race and sex with the occurrence of Anaplasma infection. Further studies are needed on the identification of biological and mechanical vectors of Anaplasma species in this region.

Ethics Committee Approval: Ethics Committee approval was received for this study from the Animal Ethics Committee of Agricultural Research, Education and Extension Organization (AREEO) (2016/48445/2).

Peer-review: Externally peer-reviewed.

Author Contributions: Concept--V.N.; Design-V.N.; Supervision--V.N.; Resources - V.N.; Materials--V.N., M.M.; Data Collection and/or Processing--V.N., M.M.; Analysis and/or Interpretation--V.N., M.M.; Literature Search--V.N.; Writing Manuscript - V.N.; Critical Review--V.N.

Acknowledgements: We appreciate the farmers for their cooperation with this study.

Conflict of Interest: The authors have no conflict of interest to declare.

Financial Disclosure: This study was supported by the Isfahan Agricultural and Natural Resources Research and Education Center, Agricultural Research, Education and Extension Organization (AREEO), Isfahan, Iran (Project Number: 2015-48445).

References

Amorim, L.S., Wenceslau, A.A., Carvalho, F.S., Carneiro, P.L., Albuquerque, G.R., 2014. Bovine babesiosis and anaplasmosis complex: diagnosis and evaluation of the risk factors from Bahia, Brazil. Revista Brasileira de Parasitologia Veterinaria 23, 328-336.

Atif, F.A., 2015. Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significance. Parasitology Research 114, 3941-3957.

Atif, F.A., Khan, M.S., Muhammad, F., Ahmad, B., 2013. Sero-epidemiological study of Anaplasma marginale among cattle, Journal of Animal and Plant Sciences 23, 740-4.

Aubry, P., Geale, D.W., 2011. A review of bovine anaplasmosis. Transboundary and Emerging Diseases 58, 1-30.

Bakken, J.S., Dumler, J.S., 2015. Human granulocytic anaplasmosis. Infectious Disease Clinics of North America 29, 341-355.

Barlough, J.E., Madigan, J.E., DeRock, E., Bigornia, L., 1996. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ixodes pacificus). Veterinary Parasitology 63, 319-329.

Costa, V.M., Ribeiro, M.F., Duarte, A.L., Mangueira, J.M., Pessoa, A.F., Azevedo, S.S., Barros, A.T., Riet-Correa, F., Labruna, M.B., 2013. Seroprevalence and risk factors for cattle anaplasmosis, babesiosis, and trypanosomiasis in a Brazilian semiarid region. Revista Brasileira de Parasitologia Veterinaria 22, 207-213.

Dantas-Torres, F., 2015. Climate change, biodiversity, ticks and tick-borne diseases: The butterfly effect. International Journal for Parasitology: Parasites and Wildlife 4, 452-461.

da Silva, J.B., da Fonseca, A.H., 2013. Analysis of the risk factors related to the immune humoral anti-Anaplasma marginale in dairy cattle. Semina: Ciencias Agrarias 34, 777-784.

da Silva, J.B., da Fonseca, A.H., 2014. Risk factors for anaplasmosis in dairy cows during the peripartum. Tropical Animal Health and Production 46, 461-465.

da Silva, J.B., de Santana Castro, G.N., Fonseca, A.H., 2014. Longitudinal study of risk factors for anaplasmosis and transplacental transmission in herd cattle. Semina: Ciencias Agrarias 35, 2491-2500.

de la Fuente, J., Van Den Bussche, R.A., Garcia-Garcia, J.C., Rodriguez, S.D., Garcia, M.A., Guglielmone, A.A., Mangold, A.J., Friche Passos, L.M., Barbosa Ribeiro, M.F., Blouin, E.F. Kocan, K.M., 2002. Phylogeography of New World isolates of Anaplasma marginale based on major surface protein sequences. Veterinary Microbiology 88, 275-285.

Estrada-Pena, A., Salman, M., 2013. Current limitations in the control and spread of ticks that affect livestock: a review. Agriculture 3, 221-235.

Inokuma, H., Terada, Y., Kamio, T., Raoult, D., Brouqui, P., 2001.

Analysis of the 16S rRNA gene sequence of Anaplasma centrale and its phylogenetic relatedness to other ehrlichiae. Clinical and Diagnostic Laboratory Immunology 8, 241-244.

Kawahara, M., Rikihisa, Y., Lin, Q., Isogai, E., Tahara, K., Itagaki, A., Hiramitsu, Y., Tajima, T., 2006. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. In wild deer and ticks on two major islands in Japan. Applied and Environmental Microbiology 72, 1102-1109.

Kispotta, S., Islam, M.F., Hoque, M.F., Rahman, M.S., Borman, A., Haque, M.A., Rahman, M.R., 2017. Study of prevalence and associated risk factors of anaplasmosis and theileriasis in cattle. Asian Journal of Medical and Biological Research 2, 567-576.

Kocan, K.M., de la Fuente, J., Blouin, E.F., Coetzee, J.F., Ewing, S.A., 2010. The natural history of Anaplasma marginale. Veterinary Parasitology 167, 95-107.

Kocan, K.M., de la Fuente, J., Cabezas-Cruz, A., 2015. The genus Anaplasma: new challenges after reclassification. Revue Scientifique et Technique (International Office of Epizootics) 34, 577-586.

Milner, J.M., van Beest, F.M., 2013. Ecological correlates of a tick-borne disease, Anaplasma phagocytophilum, in moose in Southern Norway. European Journal of Wildlife Research 59, 399-406.

Noaman, V., 2012. Identification of hard ticks collected from sheep naturally infected with Anaplasma ovis in Isfahan province, central Iran. Comparative Clinical. Pathology 21, 367-369.

Noaman, V., 2013a. Discrimination between Anaplasma marginale and Anaplasma ovis by PCR-RFLP. World Applied Sciences Journal 21, 190-195.

Noaman, V., 2013b. Report of Anaplasma centrale (Amori strain) in cattle in Iran [Persian]. Pajouhesh-va-Sazandegi Veterinary Journal 98, 26-29.

Noaman, V., Abdigoudarzi, M., Nabinejad, A.R., 2017. Abundance, diversity and seasonal dynamics of hard ticks infesting cattle in Isfahan province, central Iran. Archives of Razi Institute 72, 15-21.

Noaman, V., Bastani, D., 2016. Molecular study on infection rates of Anaplasma ovis and Anaplasma marginale in sheep and cattle in West-Azerbaijan province, Iran. Veterinary Research Forum 7, 163-167.

Noaman, V., Shayan, P., 2009. Molecular detection of Anaplasma phagocytophilum in carrier cattle of Iran-first documented report. Iranian Journal of Microbiology 1, 37-42.

Noaman, V., Shayan, P., 2010a. Comparison of microscopic methods and PCR-RFLP for detection of Anaplasma marginale in carrier cattle. Iranian Journal of Microbiology 2, 89-94.

Noaman, V., Shayan, P., 2010b. Molecular detection of Anaplasma bovis in cattle from central part of Iran. Veterinary Research Forum 1, 117-122.

Noaman, V., Shayan, P., Amininia, N., 2009. Molecular diagnostic of Anaplasma marginale in carrier cattle. Iranian Journal of Parasitology 4, 31-38.

Noaman, V., Nabinejad, A., Shahmoradi, A., Esmaeilkhanian, S., 2016. Molecular detection of bovine leukocytic Anaplasma species in Isfahan, Iran. Research in Molecular Medicine Journal 4, 47-51.

Quiroz-Castaneda, R.E., Amaro-Estrada, I., Rodriguez-Camarillo, S.D., 2016. Anaplasma marginale: Diversity, virulence, and vaccine landscape through a genomics approach. BioMed Research International 2016, 1-18.

Rahman, A.S.M.S., Sumon, S.M.M.R., Khan, M.A.H.N.A., Islam, M.T., 2015. Current status of subclinical form of babesiosis and anaplasmosis in cattle at Rangpur district in Bangladesh. Progressive Agriculture 26, 51-59.

Sajid, M.S., Siddique, R.M., Khan, S.A., Iqbal, Z., Khan, M.N., 2014. Prevalence and risk factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab, Pakistan. Global Veterinaria 12, 146-153.

Sharma, A., Singla, L.D., Kaur, P., Bal, M.S., 2015. PCR and ELISA visa-vis microscopy for detection of bovine anaplasmosis: a study on associated risk of an upcoming problem in North India. The Scientific World Journal, 1-8.

Walker, A.R., 2014. Ticks and associated diseases: a retrospective review. Medical and Veterinary Entomology 28, 1-5.

Weisburg, W.G., Barns, S.M., Pelletier, D.A., 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173, 697-703.

Zarasvandi, A., Carranza, E.J.M., Moore, F., Rastmanesh, F., 2011. Spatio-temporal occurrences and mineralogical-geochemical characteristics of airborne dusts in Khuzestan province (Southwestern Iran). Journal of Geochemical Exploration 111, 138-151.

Vahid NOAMAN (1) [iD], Morteza MORADI (2) [iD]

(1) Veterinary Medicine Group, Department of Animal Science Research, Isfahan Agricultural and Natural Resources Research and Education Center, Agricultural Research, Education and Extension Organization (AREEO), Isfahan, Iran

(2) Faculty of Veterinary Medicine, Islamic Azad University, Boroujerd Branch, Boroujerd, Iran

Cite this article as: Noaman, V., Moradi, M., 2019. Molecular Epidemiology and Risk Factors Assessment of Anaplasma spp. on Dairy Cattle in Southwest of Iran. Acta Vet Eurasia; 45: 30-36.

ORCID IDs of the authors: V.N. 0000-0002-3002-2417; MM 0000-0002-7713-9567.

Address for Correspondence: Vahid Noaman * E-mail: v.noaman@areeo.ac.ir

Received Date: 8 September 2018 * Accepted Date: 11 January 2019 * DOI: 10.26650/actavet.2019.18014
Table 1. PCR and n-PCR tested including primers, annealing, cycling
conditions and PCR product length

                                  Publication references
                                       and Accession
Name of primer                        No. in GenBank

fD1                                Weisburg et al., 1991
Rp2                                      AF414399
Anaplasma phagocytophilum sense    Barlough et al., 1996
Anaplasma phagocytophilum
Antisense                                 M73220
Anaplasma bovis sense              Kawahara et al., 2006
Anaplasma bovis Antisense                 U03775
Anaplasma centrale (Amori
strain)
sense                               Inokuma et al., 2001
Anaplasma centrale (Amori
strain)
Antisense                                 AF283007
MSP45                            de la Fuente et al., 2002
MSP43                                    AF393742

                                                Nucleotid
Name of primer                                  sequences

fD1                                     5'AGAGTTTGATCCTGGCTCAG 3'
Rp2                                     5ACAGCTACCTTGTTACGACTT3'
Anaplasma phagocytophilum sense    5'GTCGAACGGATTATTCTTTTATAGCTTGC 3'
Anaplasma phagocytophilum
Antisense                           5'CCCTTCCGTTAAGAAGGATCTAATCTCC 3'
Anaplasma bovis sense                   5CTCGTAGCTTGCTATGAGAAC3'
Anaplasma bovis Antisense                5'TCTCCCGGACTCCAGTCTG3'
Anaplasma centrale
(Amori strain)
sense                                    5CAAATCTGTAGCTTGCTACGGA3'
Anaplasma centrale
(Amori strain)
Antisense                               5' GAGTTTGCCGGGACTTCTTCT 3'
MSP45                             5'GGGAGCTCCTATGAATTACAGAGAATTGTTTAC3'
MSP43                               5'CCGGATCCTTAGCTGAACAGGAATCTTGC3'

                                     Annealing      No. of
Name of primer                   temp (C[degrees])  cycles  PCR-product

fD1                                     55             40     1468 bp
Rp2
Anaplasma phagocytophilum sense         50             35      926 bp
Anaplasma phagocytophilum
Antisense
Anaplasma bovis sense                   55             35      551 bp
Anaplasma bovis Antisense
Anaplasma centrale (Amori
strain)
sense                                   54             35      403 bp
Anaplasma centrale (Amori
strain)
Antisense
MSP45                                   56             35      866 bp
MSP43

PCR: Polymerase Chain Reaction

Table 2. Multivariate analysis of risk factors associated with
Anaplasma spp. in Khuzestan province, Iran

Category                            Level            Total N

Climate                            Mountain             20
                                    Plain              180
Latitude                   32[degrees]-33[degrees]C     56
                                <31[degrees]C          144
Hygiene                              Good               10
                                     Low               144
                                    Normal              46
Distance from other farms            <1Km              196
                                     >5Km                4
Age                                 <1Year              16
                                   1-3Years             56
                                   3-5Years             46
                                   >5Years              82
Milk yield                           High               24
                                     Low                80
                                    Normal              24
                                   Without              72

                           Anaplasma spp. Positive
Category                   Count  Row Total N %  p value

Climate                     12        60.0       0.0001
                            76        42.2         -
Latitude                    16        28.6       0.003
                            72        50.0         -
Hygiene                      2        20.0       0.995
                            50        34.7       0.011
                            36        78.3         -
Distance from other farms   86        43.9       0.021
                             2        50.0         -
Age                          4        25.0       0.002
                            26        46.4       0.057
                            26        56.5       0.096
                            32        39.0         -
Milk yield                  12        50.0       0.162
                            28        35.0       0.002
                            12        50.0       0.824
                            36        50.0         -

                           95% Confidence Interval for Odds ratio
Category                   Odds ratio  Lower Bound  Upper Bound

Climate                       1.18       4.49             3.12
                              -           -               -
Latitude                     30.48       3.18           291.33
                              -           -               -
Hygiene                       3.86        .000             . (c)
                               .013       .000             .372
                              -           -               -
Distance from other farms    66.18       1.90          2296.47
                              -           -               -
Age                         605.30       9.64         37981.46
                             32.95        .905         1200.66
                               .30        .077            1.23
                              -           -               -
Milk yield                   19.33        .305         1225.55
                            175.86       6.51          4744.49
                               .732       .047           11.40
                              -           -               -

(c). Floating point overflow occurred while computing this statistic.
Its value is therefore set to system missing.
COPYRIGHT 2019 AVES
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Noaman, Vahid; Moradi, Morteza
Publication:Journal of the Faculty of Veterinary Medicine
Date:Jan 1, 2019
Words:4939
Previous Article:Effects of Mediterranean Mussel Shell (Mytilus galloprovincialis) on Performance and Egg Quality in Laying Quails.
Next Article:Phylogenetic Grouping of Verotoxigenic Escherichia coli (VTEC) Obtained from Sheep and Broiler Chicken in Northwestern Iran.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |