Printer Friendly

Molecular Characterization of Isolated Xanthomonas sp. from Rice Rhizosphere Soil and their Inhibition using Clerodendrum viscosum Vent.

Byline: Rafiquel Islam, Mohammad Mizanur Rahman, Zannatul Nyme, Jobair Ahmed, Laisa Ahmed Lisa, Sharif Mohammad Al-Reza, Muhammad Yousaf and Mohammad Nur-E-Alam

Summary: In this study, we characterized some Xanthomonas sp. from rice rhizosphere soil by 16S rDNA sequence analysis and the potentiality tested of oil and extracts of Clerodendrum viscosum Vent. leaves against those isolated bacteria. The essential oil compositions were evaluated by GC- MS analysis and identified twenty four compounds as 94.37% of the total essential oil, where cyclohepta-1,3,5,-triene (16.07%), 2H-1,4-pyridoxazin-3(4H)-one (12.27%), L-carvenol (8.04%), p- cymene (9.15%), a-terpineol (7.98%), b-sitosterol (6.76%), tyranton (6.42%), mesityl oxide (6.34%), -terpinene (5.42%) and b-linalool (3.74%) were the major constituents. According to the 16S rDNA sequences analysis, Hb28 and Xb43 isolates have shown the 100% similarity for Xanthomonas retroflexus and Xanthomonas theicola.

In addition, isolates Ha18, Xb33 and Jb30 also have shown the maximum similarity of 98% for Xanthomonas sp. TB8-9-II, Xanthomonas campestris and Xanthomonas sp. BBCT38. Furthermore, in vitro studies showed that the oil have the inhibitory effect on Xanthomonas sp. TB8-9-II, X. campestris, X. retroflexus, Xanthomonas sp. BBCT38, and X. theicola, where the zone of inhibition and MIC values were 18.8 to 25.9 mm and 62.5 to 125 g ml-1, respectively. However, organic extracts showed the zone of inhibition and MIC values were 13.4 to 22.9 and 62.5 to 500 g ml-1, respectively. Our findings suggested that the essential oil and extracts of C. viscosum Vent. leaves might be the effective source to control Xanthomonas sp. biologically.

Keywords: 16S rDNA sequence, Xanthomonas sp., Clerodendrum viscosum Vent., Essential oil, GC-MS, Antibacterial efficacy.

Introduction

A plant disease means any physiological freakishness and disruption in the normal health of a plant. Usually, fungi and bacteria cause these diseases. In addition, some environmental abiotic factors viz. lack of oxygen, excessive temperature, ultraviolet radiation, or pollution and nutrient deficiency are also another causes of that. Moreover, human beings are using plants extensively as a source of food. As plenteous nutrients, plants are degenerating many organisms, including bacteria, fungi, insects, protests and vertebrates [1]. But, these bacterial diseases are more difficult to manage and have worsened impacts, which predominantly affecting the commercial vegetable production. Usually, the control of bacterial diseases caused by spraying with antibiotics and pesticides, which never been an appreciable outcome.

For the bio-accumulation of food chain, the acute toxicity, long degradation periods, antibiotics and synthetic pesticides are prohibited in many countries. Therefore, losses from bacterial diseases can be substantial all over the world [2].

Furthermore, Xanthomonas integrated diseases result in a scarcity of harvest. A common report has been arisen that Xanthomonas can easily develop resistance to several antibiotics such as streptomycin, ampicillin, kanamycin and penicillin [3].

Besides, the control of bacterial diseases is not so easy. It requires the expensive and complex integrated pest management (IPM), including the use of healthy seeds, sanitization practices, and pure chemicals [4]. Considering the effect of hurtful chemicals like synthetic antibiotics and pesticides on life supporting systems, an alternative, and approaches are crying need for the management of plant pathogenic microorganisms. For this reason, naturally occurring biologically active plant products (e.g. essential oils, organic extracts and pure compounds) might be an effective source to control the plant pathogenic microorganisms and use as a new eco-friendly pesticide. Furthermore, active ingredients containing bio-pesticides can be used by cultivators as effective substitutes for chemical pesticides [5].

Clerodendron viscosum Vent., is a family of Verbenaceae, which frequently referred to as 'Bhati' in Bangladesh. It is about 4 feet high small shrubs, with broadly ovate leathery leaves, whose leaves are simple and opposite, decussate and petiole: 2.5-8 cm long. It is also terete, fulvous tomentose; lamina 7-17(-23) A-7.5-15cm, broad elliptic-ovate or sub- orbicular. Besides, it has apex acuminate, base cordate, margin entire or dentate, sub coriaceous, fulvous tomentose, 7-nerved at base. It retains tertiary nerves distantly and horizontally per current. Further, zygomorphic or pinkish type flowers with white with inflorescence terminal panicle, up to 18 cm long, fulvous pubescent and small fruits enclosed in red bracts. It is an indigenous medicinal plant, which is widely distributed in various parts of Bangladesh, India, Ceylon and Malaya. In Bangladesh, the highest density of C. viscosum Vent is 53.57 plants/100 m2 and frequency is 35.71 % among all shrubs [6].

It grows commonly in waste places and graveyards in all areas of the country. This shrub contains some important organic compounds such as alkaloids, saponin, flavonoids, glycoside, cleodendroside, benzoic acid derivatives, lupeol and b -sitosterol. The antifungal- cabruvin, flavonoids and quercetin are present in roots. Furthermore, the fatty acids- palmitic, oleic and linoleic is the major ingredients of seed fatty oil. Cleroden-droside has hypertensive property. Leaf juice issued as strong anthelmintic, emetic, mild laxative and cholagogue. It is used for tumors, skin diseases, snake bite and scorpion-sting [7]. Since this medicinal shrub is available in our country and grows naturally in nearby road sides and uncultivable areas and has no any commercial uses, it would be economically lucrative enough, if we able to produce any remedy of diseases from its bioactive compounds.

To discover natural compounds with anti-Xanthomonas potentiality, our research group is trying to way out how to control Xanthomonas sp. using natural sources. In this study, we evaluated the chemical constituents of the essential oil of C. viscosum Vent. using GC-MS analysis. Therefore, the main investigation was to control the isolated and characterized bacteria of Xanthomonas sp. using essential oil and organic extracts of C. viscosum Vent.

Experimental

Collection of Plant Materials and its Taxonomic Evaluation

The leaves of C. viscosum Vent. were collected from the Islamic University area, Kushtia, Bangladesh, in September' 2013 and was identified by Bushra Khan, Principal Scientific Officer and President, Bangladesh National Herbarium in Dhaka, where a voucher specimen (DACB 40902) was deposited.

Isolation and Separation of Essential Oil

Firstly, the plant's leaves were dried at room temperature and then ground into coarse powders. According to standard procedure of the European Pharmacopoeia, the Clevenger type apparatus was used in hydro distillation to distillate the essential oil from coarse powders of the plant [8]. The distillation process was taken place for several hours and then oil-water mixture was collected as a condensed basis from hydro distillation chamber. The isolated oil was separated by a solvent extraction process using dichloromethane (DCM) as a solvent. Hydro distillates and solvents were mixed with 2:1 ratio in a separating funnel. Then shaking well for a while and standing for a day. In this way, two separate layers formed, in which, oil dissolved in DCM solvent and went to bottom layer and water was the upper layer. Then the oil including DCM solvent mixture was collected by separating funnel. Finally, DCM was removed by rotary evaporator [9, 10].

Essential Oil Analysis by GC-MS Study

The individual chemical compounds were investigated from essential oil by a combined gas chromatography-mass spectrophotometer (GC-MS) equipped with the inlet of the GC column (Restek RTX-5 MS capillary column, 95% DMPS, 5% diphenyl, 30 m A-0.25 mm A- 0.25 m) at temperature of 120C (5 min) increased at 5C/min to 320C and held for 5 min. Hewlett-Packard computerized system was used in GC-MS unit comprising a 6890 gas chromatograph coupled to a 5973 mass spectrometer. The ionization energy was 70 eV, a scan time of 1 s and mass range of 40-300 amu. Identification of the essential oil components was based on their retention indices, relative to a homologous series of n-alkane (C8 - C20) in the RTX-5 capillary column through the same operating conditions and computer matching with the GC-MS spectra from the Wiley 6.0 MS data and literature data. Finally, the relative percentages of the essential oil constituents were carried out explicitly as the percentages by peak area normalization [11].

Isolation and Identification of Bacteria from Soil

Isolation of bacteria from rice (Oryza sativa) rhizosphere soil was performed as previously described [12]. Fresh soil (5 g) was added to the 45 ml of 0.9% NaCl solution. Serial dilution (1:10) was dropped and spread onto the solid media plate count agar (PCA). Petri-dishes were incubated aerobically at 30C. After 14 days representative colonies were isolated and stored in glycerol at -20C for molecular analyses. In addition, their genetic identification was implemented by 16S rDNA sequencing as previously described [12-14]. Through alkaline analysis, DNA was extracted as a single colony. 16S rDNA amplification and sequencing was performed as described by Rahman et al. [14, 15]. PCR was executed in 25 l containing buffer 10X, 1.0 units of TaqDNA polymerase (Amersham Biosciences), 0.2 mM each of dNTPs, 200 nM of each primer 63F 5'CAGGCCTAACACATGCAAGTC [16] and 1389R 5'ACGGGCGGTGTGTACAAG and 50 ng template DNA [17].

The thermal cycler (Bio Rad I Cycler 170-8740) was programmed for the initial denaturation step (94C) of 5 min., followed by 44 cycles of 1 min., denaturation along with 1 min. primer annealing (37C) and 2 min. primer extension (72C), further followed by the 7 min primer extension (72C) step. The amplified DNA was visualized by gel electrophoresis. The most similar bacterial species were ascertained in the GenBank using the BLAST search (http://www.ncbi.nlm.nih.gov). Neighbor-joining phylogenetic trees (Fig. 1) were constructed based on 16S rDNA sequences using Jalview version 2.7. Antibacterial Activity against Xanthomonas sp.

Through an agar disc diffusion method, the antibacterial efficacy was accomplished using 100 l of standardized inoculum suspension containing 107CFU ml-1 of bacteria [18]. The essential oil was diluted by 1:5 (v/v) with ethanol and different extracts (Hexane, chloroform, ethyl acetate and methanol) of C. viscosum Vent. leaves were diluted with its same solvent, which were used for extraction. The appropriate amounts, such as 5, 10 or 15 l were spotted onto the filter paper discs (6 mm diameter) and then placed on the inoculated agar. Negative controls were prepared using the same solvents employed to dissolve the samples. In contrast, for positive control of the tested bacteria, standard reference (Amoxicillin and Erythromycin) of 10 g disc-1, collected from Sigma-Aldrich Co., USA, was used.

Then the plates were sealed with parafilm and incubated at 37C for 24 h. Antibacterial potentiality was assessed by measuring the diameter of the inhibition zones against the tested bacteria. Each experiment was implemented in triplicate.

Determination of Minimum Inhibitory Concentration (MIC)

MICs of the essential oil and extracts were measured by a twofold serial dilution method [19]. The methanol and dimethyl sulfoxide (DMSO) were dissolved in the tested oil and extract samples, respectively, and integrated into LB broth medium to obtain a concentration of 1,000 g ml-1 and serially diluted to accomplish 500, 250, 125, 62.5, 31.25, 15.62, 7.81 and 3.9 g ml-1, respectively. The final solvent concentration of the culture medium was maintained at 0.5% (v/v). A 10 l standardized suspension of each tested organism (107CFU ml-1 approximately) was transferred to each tube. The control tubes were incubated at 37C for 24h which contained bacterial suspension only. After macroscopic evaluation, the lowest concentration of the test samples (expressed in g ml-1), which did not show any growth of test organism, was evaluated as MICs.

Statistical Analysis

The data obtained for antibacterial activity against Xanthomonas sp. using essential oil and extracts were statistically analyzed and mean values were calculated. For the statistical evidence and significance, it was carried out employing one way ANOVA (p less than 0.05). A statistical package (SPSS version 11.0) was used for the data analysis.

Results and Discussion

Isolation and Analysis of the Essential Oil by GC-MS study

The isolated essential oil of C. viscosum Vent. was yellowish-green in color and the yields were about 0.86% (w/w). The compounds were identified by GC-MS, according to their elution order on a RTX-5 capillary column are shown in Table-1. The constituents and percent composition of the volatile oil obtained from C. viscosum Vent. were represented together with the retention in indices in Table-1. Twenty four different chemical compounds were identified and quantified from the oil, where cyclohepta-1,3,5,-triene(16.07%),2H-1,4pyridoxazin-3(4H)-one (12.27%), L-carvenol (8.04%), p-cymene (9.15%), a-terpineol (7.98%), b-sitosterol (6.76%), tyranton (6.42%), mesityl oxide (6.34%), -terpinene (5.42%) and b-linalool (3.74%) etc. were the bioactive compounds.

Several researchers had shown that the above compounds and compounds containing plants extracts have various biological activities such as antimycobacterial, antibacterial, herbicidal, antifungal, anticancer, anti-inflammatory, antiprotozoal, antinociceptive, antipyretic, anti- platelet, and cytotoxicity activities [20-24]. Furthermore, in Ayurveda, it is still used in snake bite and scorpion string [25]. However, it is quite noteworthy that the essential oil composition may vary for a particular species of plant depending on physical, chemicals and environmental factors like harvesting seasons, extraction methods, and geographical sources. Moreover, different parts of the same plant may have the difference in their composition [26]. Therefore, further studies would be needed of this shrub to purify the novel bioactive compounds and screening the biological activities for eco-friendly drug discovery.

Identification and Characterization of Bacteria

Molecular identification and characterization of bacteria was developed and adopted almost 20 years ago. Detection of bacterial species is generally based on the identification of some unique parts of their 16S rDNA [27, 28]. For that reason, 16S RDNA-based techniques are widely implemented to characterize bacterial community composition in soil samples [28, 29]. Total 16S rDNA was extracted from soil isolates. Amplification of 16S rDNA was subjected to PCR for identification of bacterial species and amplified 16S rDNA products were confirmed by gel electrophoresis through the visualization of their band patterns. The bacteria isolates were identified as the following Xanthomonas sp. according as 16S rDNA sequences analysis comparing with the known sequences in the public databases at NCBI and the BLAST results (Table-2). Phylogenic tree was constructed as in Fig. 1.

The sequences of Hb28 and Xb43 isolates were showing the 100% similar to Xanthomonas retroflexus and Xanthomonas theicola and isolates Ha18, Xb33 and Jb30 were showing maximum similarity of 98% to Xanthomonas sp. TB8-9-II, Xanthomonas campestris and Xanthomonas sp. BBCT38, respectively, and shown in Table 2.

Table-1: Chemical composition of the essential oil of C. viscosum Vent. leaf.

###RI a###Compounds###b###c

###% RA###Identification

###455###-ketopropane###8.04###RI, MS

###739###Mesityl oxide###6.34###RI, MS

###786###Cyclohepta-1,3,5,-triene###16.07###RI, MS

###888###3-methylheptane-2-ol###1.26###RI, MS

###845###Tyranton###6.42###RI, MS

###897###-acetopropanol###tr###RI, MS

###964###N-cyanomethyl-N-methylacetamide###0.36###RI, MS

###1002###Ethyl hexanoate###0.45###RI, MS

###1014###4H-1,3-oxazin###12.27###RI, MS

###1042###-cymene###9.15###RI, MS

###1082###-linalol###3.74###RI, MS

###1086###-terpinene###5.42###RI, MS

###1125###4,7,7-Trimethylbicyclo [4.1.0] heptan-3-ol###0.64###RI, MS

###1140###2,2,6-Trimethyl-4H-1,3-dioxin-4-one###0.78###RI, MS

###1247###2-trans--Ocimene###1.60###RI, MS

###1365###6-(Dimethylamino)-as-triazine-3,5 (2H,4H)-dione###0.37###RI, MS

###1407###2,6-dimethyl acetate###tr###RI, MS

###1494###Caryophyllene###1.86###RI, MS

###1579###Humulene###1.46###RI, MS

###1656###Estragole###tr###RI, MS

###1694###-terpineol###7.98###RI, MS

###1888###L-carvenol###1.79###RI, MS

###2162###T-cadinol###1.12###RI, MS

###3408###-sitosterol###6.76###RI, MS

###Total identified###94.37%

Table-2: List of identified bacteria in this study.

###Name of strains###Name of bacteria###Accession numbers###(%) Similarity

###Ha18###Xanthomonas sp.-TB8-9-II###AY599706###98

###Xb33###Xanthomonas campestris###EF059753###98

###Hb28###Xanthomonas retroflexus###AM495257###100

###Jb30###Xanthomonas sp. BBCT38###EF471219###98

###Xb43###Xanthomonas theicola###Y10763###100

Antibacterial Activity of Xanthomonas sp. using Leaves Essential Oil and Extracts

In vitro antibacterial potentiality of essential oil and various extracts (Hexane, chloroform, methanol and ethyl acetate) of C. viscosum Vent. leaves against the Xanthomonas sp. was qualitatively and quantitatively evaluated by the presence or absence of inhibition zones. Essential oil of C. viscosum Vent. showed potential inhibitory effect against two Xanthomonas sp. The oil and various extracts showed its efficacy against all five strains of Xanthomonas sp. such as Xanthomonas sp. TB8-9-II, X. campestris, X. retroflexus, Xanthomonas sp. BBCT38, and X. theicola, as an inhibition diameter of 18.8 to 25.9, 13.4 to 19.6, 13.8 to 22.6, 13.8 to 22.9 and 16.4 to 23.4 mm, respectively (Table-3). In that case, essential oil was diluted with ethanol at a concentration of 10 L of 1:5 (v/v) and other extracts was diluted in the above ratio of the solvents from which it was extracted.

In these studies, the oil and extracts (ethyl acetate and methanol) demonstrated higher or similar type of antibacterial activities compared to amoxicillin, while erythromycin showed higher activities in some other cases than the oil and extracts. The blind control did not resist the growth of the tested Xanthomonas sp. The extracts (Hexane, Chloroform) from C. viscosum Vent. leaves exhibited a good inhibitory effect against Xanthomonas sp. TB8-9-II, X. campestris with zone of inhibition in the ranges of 17.2 to 22.6 mm, whereas no effective zone of inhibition against X. retroflexus, Xanthomonas sp. BBCT38, and X. theicola ( 13.4 to 16.7 mm). Furthermore, the ethyl acetate extract strongly inhibited the growth of Xanthomonas sp. specially Xanthomonas sp. TB8-9-II, X. campestris and X. theicola with the zone of 20.4 to 22.9 mm. Similarly, methanol extracts inhibited Xanthomonas sp. BBCT38 with Xanthomonas sp. TB8-9-II and X. campestris, where the ranges were 20.7 to 23.4 mm.

In contrast, the essential oil inhibited Xanthomonas sp. TB8-9-II, X. campestris and X. theicola effectively with diameter zones of 23.1 to 25.9 mm, which have been reported the most powerful control of diseases occurred by Xanthomonas sp., particularly would be widespread used in agricultural purposes [30].

Minimum Inhibitory Concentration (MIC)

The MIC values of essential oil against the employed bacterial strains of Xanthomonas sp. were found more capable as compared to the leaf extracts as shown in Table-4. The essential oil exhibited antibacterial activity significantly against five strains of Xanthomonas sp. like Xanthomonas sp. TB8-9-II, X. campestris, X. retroflexus, Xanthomonas sp. BBCT38, and X. theicola, with their MIC values of 62.5, 62.5, 62.5, 125 and 62.5 g/ml, respectively. Furthermore, essential oil, ethyl acetate, and methanol extracts displayed potential antibacterial effect as compared to hexane extract. At the same concentration, the solvents did not inhibit the growth of any of the tested bacteria.

However, essential oils, ethyl acetate, and methanol extracts exposed similar effect against Xanthomonas sp. TB8-9-II, X. campestris and X. theicola with their respective MIC value of 62.5 g/ml. The MIC values of methanol, ethyl acetate, chloroform and hexane extracts against the tested bacteria were found in the range of 62.5 to 125, 62.5 to 500, 62.5 to 250 and 62.5 to 500g/ml, respectively. Comparatively, methanol and chloroform extracts showed higher antibacterial activities as compared to ethyl acetate extract. The moderate antibacterial effect of the hexane extract was only observed as a minimum inhibitory concentration (62.5 to 500 g/ml for each bacterium) against Xanthomonas sp. (Table-4). This activity of the essential oil could be assigned to the presence of cyclohepta-1,3,5,-triene, 2H-1,4-pyridoxazin-3(4H)- one, L-carvenol, p-cymene, a-terpineol, b-sitosterol, tyranton, mesityl oxide, -terpinene and b-linalool [31, 32].

One of the areas which are subjected to considerable interest in plant extracts and in particular their essential oils. Also, the consumer demand for effective and safe natural products are increasing day by day, that ultimately fascinated the plant oils and extracts. Report on the analysis of essential oil from C. viscosum Vent. from South Asian regions and its efficacy against Xanthomonas sp. is still scarce. Therefore, screening of wild plant- C. viscosum Vent., growing in Bangladesh, for antimicrobial activity and phytochemicals, is important for finding potential new compounds for medicinal industry, agricultural industry and other related sectors.

Table 3: Antibacterial activity of essential oil and organic extracts of leaves of C. viscosum Vent.

###Zone of inhibition (mm)

###Name of bacteria###Essential oil###Various Organic Extracts###Antibiotics

###Hexane###CHCl3###EtOAc###Methanol###Amoxicillin###Erythromycin

###Xanthomonas sp. TB8-9-II###25.90.9a###17.20.7b###17.50.7b###22.60.8a###20.70.8b###12.50.4a###16.20.8a

###X. campestris###23.10.6a###19.60.8a###22.60.5a###22.90.8a###23.40.7a###11.30.4c###15.60.5b

###X. retroflexus###21.60.8b###13.40.8d###13.80.9c###19.60.9bc###19.20.7b###13.60.5bc###14.30.8c

###Xanthomonas sp. BBCT38###18.80.5c###13.60.5d###14.70.6d###13.80.4c###20.80.6b###10.90.6d###15.20.5b

###X. theicola###23.30.6a###16.70.9c###16.70.7bc###20.40.7b###16.40.6c###14.50.6b###12.40.4d

Table 4: Minimum inhibitory concentration (MIC) of essential oil and organic extracts of C. viscosum Vent.

###Minimum inhibitory concentration (MIC)a

###Microorganism###Various Organic Extracts

###Essential oil

###Hexane###CHCl3###EtOAc###Methanol

###Xanthomonas sp. TB8-9-II###62.5###125###125###62.5###62.5

###X. campestris###62.5###62.5###62.5###62.5###62.5

###X. retroflexus###62.5###500###250###125###125

###Xanthomonas sp. BBCT38###125###500###250###500###62.5

###X. theicola###62.5###125###125###62.5###250

Conclusion

From the significant results of this study, it can be recapitulated that our investigations identified the 24 compounds containing 94.37% of the total essential oil from Clerodendrum viscosum Vent. by GC-MS study. The main constituents of C. viscosum Vent. essential oil were cyclohepta-1,3,5,-triene, 2H-1,4-pyridoxazin-3(4H)-one, L-carvenol, p-cymene, a- terpineol, b-sitosterol, tyranton, mesityl oxide, - terpinene and b-linalool, which have the high potentiality against isolated Xanthomonas sp. This study would be the imminent bio-control approaches to inhibit such Xanthomonas sp., so that it would support the possible use of oil and extract of C. viscosum Vent. in agro-industries as eco-friendly agrochemicals.

Acknowledgements

This research funding was provided by the Department of Applied Chemistry and Chemical Technology, Islamic University, Kushtia-7003, Bangladesh. Due to this, we are thankful to that department, indeed. Moreover, we are grateful to the Department of Biotechnology and Genetic Engineering, Islamic University, Kushtia 7003, Bangladesh for providing antibacterial assay.

References

1. B. C. Freeman and G. A. Beattie, Iowa State University, An Overview of Plant Defenses against Pathogens and Herbivores, The Plant Health Instructor (2008).

2. M. W. Aktar, D. Sengupta and A. Chowdhury, Impact of Pesticides Use in Agriculture: their Benefits and Hazards, Interdiscip. Toxicol., 2, 1 (2009).

3. H. Rodriguez, L. Aguilar and M. Lao, Variations in Xanthan Production by Antibiotic Resistant Mutants of Xanthomonas Campestris, App. Microbiol. Biotech., 48, 626 (1997).

4. J. S. P. Araujo, C. F. Robbs and R. L. D. Ribeiro, Manejo Integrado De Fitobacterioses De Importancia Economica No Brasil, Parte 1, Revisao Anual de Patologia de Plantas, 11, 107 (2003).

5. C. Cao, S. Park and B. B. M. Gardener, Biopesticide Controls of Plant Diseases: Resources and Products for Organic Farmers in Ohio, Agriculture and Natural Resources, Department of Plant Pathology, The Ohio State University, USA (2010).

6. M. D. Choudhury, S. B. Paul, S. Choudhury, S. Choudhury and P. P. N. Choudhury, Isolation, Characterization and Bio activity Screening of Compound from Clerodendrum viscosum Vent., Assam Uni. J. Sci. Tech. Biol. Sci., 4, 29 (2009).

7. A. Ghani, Medicinal Plants of Bangladesh, (2nd eds.), The Asiatic Society of Bangladesh, Dhaka, p. 176 (2003).

8. C. Tschiggerl and F. Bucar, Investigation of the Volatile Fraction of Rosemary Infusion Extracts, Sci. Pharm., 78, 483 (2010).

9. J. B. Harborne, Phytochemical Methods: A Guide to Mordern Techniques of Plant Analysis, (3rd eds.), Chapman and Hall, London, p. 47 (1998).

10. S. J. Caster, In Tutorial Pharmacy, 6th (eds.), Pitman Medical, London, p. 251 (2000).

11. R. P. Adams, Identification of Essential Oil Components by Gas Chromatography/Mass Spectroscopy, (4th eds.), Carol stream, Illinois, Allured Publishing Corporation, USA (2007).

12. M. M. Rahman, T. Sultana, M. Y. Ali, M. A. Rahman, S. M. Al-Reza and A. Rahman, Chemical Composition and Antibacterial Activity of the Essential Oil and Various Extracts from Cassia sophera L. Against Bacillus sp. from Soil, Arab. J. Chem., in press, (2013).

13. A. E. McCaig, L. A. Glover and J. J. Professor, Numerical Analysis of Grassland Bacterial Community Structure Under Different Land Management Regimens by Using 16S rDNA Sequence Data and Denaturing Gradient Gel Electrophoresis Banding Patterns, Appl. Environ. Microbiol., 67, 4554 (2001).

14. M. M. Rahman, M. Basaglia, E. Vendramin, B. Boz, F. Fontana, B. Gumiero and S. Casella, Bacterial Diversity of a Wooded Riparian Strip Soil Specifically Designed for Enhancing Denitrification Process, Biol. Fertil. Soils, 50, 25 (2014).

15. M. M. Rahman, M. Basaglia, F. Lorenzo, B.Boz, F. Fontana, B. Gumiero and S. A. Casella, Wooded Riparian Strip Set Up for Nitrogen Removal Can Affect the Water Flux Microbial Composition, Italian J. Agronom., 9, 548 (2014).

16. J. R. Marchesi, T. Sato, A. J. Weightman, T. A. Martin, J. C. Fry, S. J. Hiom and W. G. Wade, Design and Evaluation of Useful Bacterium- Specific PCR Primers that Amplify Genes Coding for Bacterial 16S rRNA, Appl. Environ. Microbiol., 64, 795 (1998).

17. A. M. Osborn, E. R. B. Moore and K. N. Timmis, An Evaluation of Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis for the Study of Microbial Community Structure and Dynamics, J. Environ. Microbiol., 2, 39 (2002).

18. P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover and R. H. Yolke, Manual of Clinical Microbiology, ASM, Washington, p. 1773 (1995).

19. M. Chandrasekaran and V. Venkatesalu, Antibacterial and Antifungal Activity of Syzygium jambolanum Seeds, J. Ethnopharmcol., 91, 105 (2004).

20. C. C. Toma, G. M. Simu, D. Hanganu, N. Olah, F. M. G. Vata, C. Hammami and M. Hammami, Chemical Composition of The Tunisian Nigella Sativa. Note II. Profile on Essential Oil, Farmacia., 61, 454 (2013).

21. S. B. Hassan, H. Gali-Muhtasib, H. Goransson and R. Larsson, Alpha Terpineol: a Potential Anticancer Agent which acts through Suppressing NF-kappa B signaling, Anticancer Res., 30, 1911 (2010).

22. S. Loizou, I. Lekakis, G. P. Chrousos and P. Moutsatsou, Beta-Sitosterol Exhibits Anti Inflammatory Activity in Human Aortic Endothelial Cells, Mol. Nutr. Food Res., 54, 551 (2010).

23. P. Escobar, L. S. Milena, L. V. Herrera, J. R. Martinez and E. Stashenko, Chemical Composition and Antiprotozoal Activities of Colombian Lippia spp Essential Oils and their Major Components, Mem. Inst. Oswaldo. Cruz. Pub. Med., 105, 184 (2010).

24. K. Liu, Q. Chen, Y. Liu, X. Zhou and X. Wang, Isolation and Biological Activities of Decanal, Linalool, Valencene, and Octanal from Sweet Orange Oil, J. Food Sci., 77, C1156 (2012).

25. K. R. Kirtikar and B. D. Basu, Indian Medicinal Plants, (2nd eds.), Bishen Singh and Mahendra Pal Sing Publication, p. 1950 (1991).

26. S. Burt, Essential oils: Their Antibacterial Properties and Potential Applications in Foods - a review, Inter. J. Food Microbiol., 94, 223 (2004).

27. J. M. Lynch, A. Benedetti, H. Insam, M. P. Nuti, K. Smalla, V. Torsvik and P. Nannipieri, Microbial Diversity in Soil: Ecological Theories, the Contribution of Molecular Techniques and the Impact of Transgenic Plants and Transgenic Microorganisms, Biol. Fertil. Soils, 40, 363 (2004).

28. M. M. Rahman, M. S. Sarwar, A. Das, M. M. R. Moghal and M. Hasanuzzaman, Evaluation of Cytotoxic and Anthelmintic Activity of Plant Roots of Clerodendrum viscosum (Family: Verbenaceae), Int. J. Pharmacog. Phytochem. Res., 2, 119 (2013).

29. Z. Li, J. Xu, C. Tang, J. Wu, A. Muhammad and H. Wang, Application of 16S r DNA-PCR Amplification and DGGE Fingerprinting for Detection of Shift in Microbial Community Diversity in Cu-, Zn-, and Cd-Contaminated Paddy Soils, Chemosphere, 62, 1374 (2006).

30. G. Zhou, D. Xu and M. Zhang, Southern Rice Black-Streaked Dwarf Virus: a White-Backed Plant Hopper Transmitted Fiji Virus Threatening Rice Production in Asia, Front Microbiol., 4, 270 (2013).

31. A. D. Ankalgi and M. S. Ranawat, Synthesis and Antibacterial Activity of Substituted 2H-1,4 Pyridoxazin-3(4H)-one derivatives, Int. J. Pharm. Tech. Res., 4, 258 (2012).

32. D. K. S. Lima, L. J. Ballico, F. R. Lapa, H. P. Gonc-alves, L. M. de Souza, M. Iacomini, M. F. P. Werner, C. H. Baggio, I. T. Pereira, L. M. Silva, V. A. Facundo and A. R. S. Santos, Evaluation of the Antinociceptive, Anti Inflammatory and Gastric Antiulcer Activities of the Essential Oil from Piper aleyreanum C.DC in rodents, J. Ethnopharmacol., 142, 274 (2012).
COPYRIGHT 2015 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of the Chemical Society of Pakistan
Article Type:Report
Date:Dec 31, 2015
Words:4749
Previous Article:Hierarchy of N-acylation Sites in Human Insulin Studied by RP-HPLC and Mass Spectrometry.
Next Article:O2-Binding Abilities and Catalytic Oxidation Performance of Cobalt (II) Complexes with Dihydroxamic Acid Functionalized N-pivot Lariat Ethers.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters