Printer Friendly

Modulation by geraniol of gene expression involved in lipid metabolism leading to a reduction of serum-cholesterol and triglyceride levels.

ABSTRACT

Background: Geraniol (G) is a natural isoprenoid present in the essential oils of several aromatic plants, with various biochemical and pharmacologic properties. Nevertheless, the mechanisms of action of G on cellular metabolism are largely unknown.

Hypothesis/Purpose: We propose that G could be a potential agent for the treatment of hyperlipidemia that could contribute to the prevention of cardiovascular disease. The aim of the present study was to advance our understanding of its mechanism of action on cholesterol and TG metabolism.

Study Design/Methods: N1H mice received supplemented diets containing 25, 50, and 75 mmol G/kg chow. After a 3-week treatment, serum total-cholesterol and triglyceride levels were measured by commercial kits and lipid biosynthesis determined by the [[sup.14]C] acetate incorporated into fatty acids plus nonsaponifiable and total hepatic lipids of the mice. The activity of the mRNA encoding HMGCR--the rate-limiting step in cholesterol biosynthesis--along with the enzyme levels and catalysis were assessed by real-time RT-PCR, Western blotting, and HMG-CoA-conversion assays, respectively. In-silico analysis of several genes involved in lipid metabolism and regulated by G in cultured cells was also performed. Finally, the mRNA levels encoded by the genes for the low-density-lipoprotein receptor (LDLR), the sterol-regulatory-element-binding transcription factor (SREBF2), the very-low-density-lipoprotein receptor (VLDLR), and the acetyl-CoA carboxylase (ACACA) were determined by real-time RT-PCR.

Results: Plasma total-cholesterol and triglyceride levels plus hepatic fatty-acid, total-lipid, and nonsaponifiable-lipid biosynthesis were significantly reduced by feeding with G. Even though an upregulation of the mRNA encoding HMGCR occurred in the G treated mouse livers, the protein levels and specific activity of the enzyme were both inhibited. G also enhanced the mRNAs encoding the LDL and VLDL receptors and reduced ACACA mRNA, without altering the transcription of the mRNA encoding the SREBF2. Conclusions: The following mechanisms may have mediated the decrease in plasma lipids levels in mice: a down-regulation of hepatocyte-cholesterol synthesis occurred as a result of decreased HMGCR protein levels and catalytic activity; the levels of LDLR mRNA became elevated, thus suggesting an increase in the uptake of serum LDL, especially by the liver; and TG synthesis became reduced very likely because of a decrease in fatty-acid synthesis.

Keywords:

Geraniol

Hypolipemia

Lipogenesis

HMGCR

ACACA

Introduction

Geraniol (G) is an acyclic monoterpene derived from the mevalonate pathway (MP) in plants, but not produced in mammals. This natural isoprenoid--present in the essential oils of diverse aromatic plants--is produced by the flowers but is present in the vegetative tissues from species of the Rosaceae, Poaceae, Lamiaceae, Geraniaceae and Rutaceae families. Because of its organoleptic features, G one of the most frequently used compound in the fragrances and flavoring industries (Chen and Viljoen 2010; Lapczynski et al. 2008).

This terpenoid has previously shown antiproliferative activity against human tumor cells both in culture and in vivo (Ahmad et al. 2011; Burke et al. 1997; Cardozo et al. 2011; Carnesecchi et al. 2001; Galle et al. 2014; Jin et al. 2013; Ong et al. 2006). G appears to decrease tumor growth by cell-cycle arrest, apoptosis induction, and autophagy (Cardozo et al. 2011; Chaudhary et al. 2013; Kim et al. 2012; Ong et al. 2006; Wiseman et al. 2007). Nevertheless, the mechanisms of action of G on cellular metabolism are largely unknown. The MP has been reported as a metabolic sequence modulated by isoprenoids (Mo and Elson 2004; Ong et al. 2006). In addition to cholesterol, the pathway generates several other molecules relevant to general cellular metabolism, such as farnesyl pyrophosphate and geranyl-geranyl pyrophosphate, essential in the prenylation of a variety of proteins including the small GTPase Ras, which play a critical role in cell-cycle progression. The rate-limiting enzyme of the MP is 3-hydroxy-3-methylglutarylcoenzyme-A reductase (HMGCR), a protein that is transcriptionally regulated by the sterol-regulatory-element-binding transcription factor (SREBF2).

Our recently published work (Galle et al. 2014) performed in a mouse model in which G exerted antitumor activity as well as caused the inhibition of the MP, also demonstrated a reduction of plasma cholesterol and triglyceride (TG) levels in tumor-bearing host mice. Whether the hypolipidemic effect was caused by an increase in the tumor's lipid requirements for growth or by the presence of G itself, however, remained unclear. The aim of the present study was to advance our understanding of the mechanism of action of this monoterpene on cholesterol and TG metabolism in non-tumor-bearing mice. For this purpose we evaluated the plasma-lipid content, the lipid-biosynthetic levels, and the genetic expression of certain key proteins involved in the regulation of those lipid levels that had been previously found to be modified with G in cultured cells and in vivo (Crespo et al. 2013; Galle et al. 2014; Jayachandran et al. 2014): namely, HMGCR, -acetyl-CoA carboxylase (ACACA, catalyzing the rate-limiting step in fatty-acid biosynthesis), SREBF2, the low-density-lipoprotein (LDL) receptor, (mediating LDL-cholesterol internalization into the cell), and the very-low-density-lipoprotein (VLDL) receptor--it apparently playing an essential role in the uptake and degradation of fatty acids and TG-rich particles (Crawford et al. 2008).

Materials and methods

Reagents

G (98%) was obtained from Sigma (St. Louis, MO, USA), inorganic reagents and solvents of analytical grade from Merck (Darmstadt, Germany), analyticals from Carlo Erba (Milan, Italy) and Sigma, and [[sup.14]C] acetate (54.7 Ci/mol) from PerkinElmer Life Science, Inc. (Boston, MA, USA). Merck, Sharp and Dohme (Argentina) kindly provided simvastatin.

Animals and diets

Female NIH nu/nu mice were obtained from the Bioterio of Centro Atomico Ezeiza (CNEA) and housed in a temperature-controlled room on a 12/12-h cycle of light and darkness. The animals were maintained ad libitum on a gamma-irradiated-chow diet and autoclaved water. Two-month-old mice with 20-25 g weight were randomly separated into one control group and three experimental groups, with the latter receiving supplemented diets containing 25, 50, and 75 mmol G/kg chow as described in previous reports (Yu et al. 1995; Galle et al. 2014). A positive control for hypolipidemic effects was included; this group was treated with 50 mg/kg body weight of simvastatin per day in the drinking water. After a 3-week treatment, all mice were injected with radioactive acetate (25 [micro]Ci/animal) and 3 h later killed by cervical dislocation in the middle of the light period. All experiments on animals were performed in conformity with Guidelines of Handling and Training of Laboratory Animal (Wolfensohn and Lloyd 2013). The animal-use protocols employed were approved by the Institutional Animal Care and Use Committee (IACUC), Facultad de Ciencias Medicas, Universidad Nacional de La Plata. Protocol number 04-001-13.

Blood measurements

Samples--removed from serum prepared from mouse blood obtained by cardiac puncture at sacrifice--were placed at 37[degrees]C for 30 min, centrifuged for 10 min at 3000 x g, and then stored at -20[degrees]C until analysis. Cholesterol and TG concentrations were determined by commercial kits (Wiener, Argentina) adapted to use with mice. The samples were incubated at 37[degrees]C for 5 min and the [A.sub.505] measured within 30 min in a Beckman Coulter DTX 880 Microplate Reader. A standard curve of [A.sub.505] vs cholesterol or TG concentration was plotted and the total concentrations in the sample calculated from the standard curve.

Tissue collection and histological analysis

Whole livers were removed from the mice and the total-liver weights measured. Fresh-liver blocks were cut and immediately fixed in 10% (v/v) buffered formaldehyde, then dehydrated in graded alcohols and embedded in paraffin. Sections of 6-[micro]m thickness were rehydrated and stained with hematoxylin-eosin and the stained sections observed under light microscopy.

Liver-lipid extraction and analysis

Liver lipids were extracted with chloroform:methanol (2:1, v:v) (Folch et al. 1957). In one aliquot from the organic phase, the TGs and the free and esterified cholesterol were separated by thin-layer chromatography on silica gel G developed in hexane/diethylether/acetic acid 80/20/1 (v/v/v), revealed through the use of a spray reagent containing an acidic ferric-chloride solution (Dudley and Anderson 1975; Ren and Gould 1994; Wilson and Sargent 1992), and finally quantified by means of a curve constructed with pure standards (free cholesterol, esterified cholesterol, and trimiristine) that had been run on the same plate. The spots' images were analyzed by the ImageJ program. Another aliquot was used for measuring the radioactivity incorporated into total liver lipids and into the nonsaponifiable fraction plus the fatty acids resulting from a previous saponification reaction with 10% (w/v) KOH in methanol at 85[degrees]C for 45 min. The nonsaponifiable lipids were extracted with petroleum ether, while after acidification the fatty acids were further extracted from the aqueous phase with petroleum ether.

The radioactivity was measured in a Wallac 1214 Rackbeta liquid-scintillation counter (Pharmacia, Turku, Finland).

RNA isolation and analysis by the real-time reverse-transcriptase-polymerase-chain reaction

Total RNA was extracted from mouse liver through the use of the TR1 Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) followed by a DNAase-I treatment (Fermentas Life Sciences, Vilnius, Lithuania). The cDNA was then synthesized by means of the kit qScriptTM cDNA SuperMix (Quanta Biosciences, Inc., Gaithersburg, USA). The analysis by the real-time reverse-transcriptase-polymerase-chain reaction (real-time RT-PCR) was run through the use of the PerfeCtaTM SyberGreenFastMixTM and the StratageneMX30005P real-time-RT-PCR System. The PCR conditions were 94[degrees]C for 4 min, followed first by 40 cycles with each one under the following conditions: 94[degrees]C for 40 s, 57[degrees]C for 40 s, and 72[degrees]C for 40 s; and then by a final cycle at 95[degrees]C for 1 min, 55[degrees]C for 30 s, and 95[degrees]C for 30 s. The relative amount of mRNA was calculated by means of the comparative-threshold-cycle method and the qBase vl.3.5 program with [beta]-actin as the reference housekeeping gene. The oligonucleotide primers used are summarized in Table 1. The amplified fragments were detected by electrophoresis on a 1.8% (w/v) agarose gels after Sybr-Green-I staining.

HMGCR in the microsomal fraction

Mouse-liver tissue was placed (1:10, w/v) in cold homogenization buffer containing 0.3 M sucrose, 50 mM NaCl, 10 mM sodium ethylenediaminetetracetic acid, 10 mM dithiothreitol, and 50 mM Tris-HCl (pH 7.4). The minced tissue was homogenized at 4[degrees]C in a TR1-R 5630 homogenizer (Tri-R Instruments, Inc. New York, USA). Samples were centrifuged at 12,000 x g and 4[degrees]C for 15 min and the resulting supernatant fraction at 105,000 x g and 4[degrees]C for 60 min. The final microsomal pellets were immediately frozen at -70[degrees]C for storage until use. Before the assay for HMGCR activity, each pellet was resuspended in buffer containing 5 mM dithiothreitol and 20 mM imidazole chloride (pH 7.4). The protein content of each sample was determined by the method of Bradford (1976) with bovine-serum albumin as standard.

The spectrophotometric assay of the solubilized HMGCR containing 0.2 mM NADPH and 0.1 mM RS-HMG-CoA in phosphate buffer (0.2 M KCl, 0.16 M potassium phosphate, 0.004 M ethylenediamine-tetracetic acid, and 0.01 M dithiothreitol, pH 6.8) was carried out at 37[degrees]C through the use of a Beckman Coulter DTX 880 Microplate Reader. One unit of HMGCR activity was defined as 1 pmol of NADPH consumed per min per mg microsomal protein.

For Western blotting, microsomal proteins were boiled in the sample buffer (Tris-HCl 0.06 M pH 6.8, Glycerol 1%, Bromophenol blue 0.02%, SDS 2%, [beta]-mercaptoethanol 5%) for 5 min. The samples were separated on 12.5% (w/v) sodium-dodecylsulfate-polyacrylamide gels and adsorbed to polyvinylidenedifluoride membranes (Amersham, GE Healthcare, Little Chalfont, UK) by a semidry transfer at 10 V for 1 h in 20% (v/v) methanol in 39 mM glycine, 48 mM Tris pH 8.3. The nonspecific protein-binding sites were blocked by incubation in PBS (pH 7.4) containing 0.05% (v/v) Tween 20 plus 5% (v/v) skimmed milk. The membrane was incubated with anti-HMGCR (Santa Cruz, CA, USA) diluted 1/200 in antibody-dilution buffer (2% [v/v] skimmed milk in PBS plus 0.1% [v/v] Tween 20) for 1 h followed by three 5-min washes in the same buffer. Horseradish-peroxidase-conjugated antibodies (Santa Cruz, CA, USA) were added to the membrane for 1 h. As an internal control, polyvinylidenedifluoride membranes were stained with Coomassie blue G-250.

Immunoreactive bands were detected by enhanced-chemiluminescence Western-blot-detection reagents (Amersham Pharmacia Biotech, Little Chalfont, UK) and processed manually through the use of common X-ray-film developers and fixers. Protein immunoblots were scanned and the density of each band quantified with the ImageJ software (Image processing and analysis in Java).

In-silico analysis

The effect of G on the gene-expression profiles of loci associated with lipid metabolism was assessed in silico. We employed the dataset GSE45567 obtained from GEO (http://www.ncbi.nlm.nih. gov/geo/), in which several compounds, including G were evaluated in triplicate on the PC-3 permanent cell-culture line (Lee et al. 2013). These cells--originally derived from a human-prostate cancer and containing prostasome membranes enriched in lipid rafts of cholesterol and sphingomyelin (Llorente et al. 2007)-synthesize and accumulate more cholesterol than normal prostate epithelial cells (Li et al. 2006). The relevant data were downloaded as .CEL files and normalized with the frozen robust multiarray-analysis (fRMA) algorithm in the open-source statistical software R. From the normalized matrix obtained, the vehicle- and G-treated samples were extracted and compared statistically. A total of 64 genes--grouped into seven functional categories--were analyzed (Supplementary material).

We applied the unsupervised-hierarchical-clustering method by means of the MeV software (www.tm4.org/mev.html) with the Pearson correlation coefficient as a measurement of distance and complete linkage.

Statistical analysis

The results are expressed as the means [+ or -] S.E.M., and all analyses were conducted with GraphPadlnStat 3.0. Statistical differences between the control and the geraniol-treated animals were evaluated by the ANOVA test followed by the Tukey HSD post-hoc comparisons. Differences were considered significant at a p < 0.05. For the in-silico analysis, the differences in the gene-expression profiles between the samples exposed to the vehicle and those treated with G were evaluated by the TTest (Dudoit et al. 2002; Pan 2002) at a significance threshold of 0.05% (Supplementary material).

Results

Serum-cholesterol and -TC levels after G treatment

Mice treated with 25, 50, and 75 mmol G/kg chow manifested a decrease in serum cholesterol and TGs (Fig. 1), and this effect became significant (p < 0.05) in the mice treated with 50 and 75 mmol G/kg chow. Moreover, in mice fed with the highest dose of G, the reduction in serum-TG content compared to the controls was much more pronounced than that of the cholesterol (by 58.2% and 18.7%, respectively). The effect of simvastatin (50 mg/kg), as a standard hypolipidemic drug, was similar to that obtained with the lowest dose of G (Fig. 1). In order to compare G with simvastatin, G impregnated into the chow was quantified by capillary gas chromatography (data not shown), which determination suggested that 25, 50, and 75 mmol G added per kg of the chow, would result in 100,200, and 300 mg G/kg body weight of each animal per day, respectively.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

The decrease in these blood lipids seemed not to produce any adverse side effects in the mice since after the 3-week experimental period the final body and liver weights, as well as the levels of food intake, in the treated mice were not significantly different from the corresponding values in the control mice (Table 2). This outcome contrasts with what is commonly observed in animals subjected to toxic compounds (Wang et al. 2007). Moreover, the general histologic organization of the livers of the G-fed mice was similar to that of the control mice: none of the animals manifested hepatic steatosis, an accumulation of pigments, a congestion of the hepatic vessels, or the presence of macrophages and lymphocyte infiltrates (Fig. 2A-D).

Liver-lipid profile and lipid synthesis of mice treated with G

In contrast to the results with serum, when the content of TGs and of free and esterified cholesterol were analyzed in the livers of G-treated mice, no significant differences were found in any of those lipid classes with respect to the control values (Fig. 3A and B).

When the incorporation of [14C]acetate into total lipids, fatty acids, and nonsaponifiable lipids was investigated, low doses of G (25 mmolG/kg chow) did not significantly decrease the radiolabelling in the total lipids, but at 50 or 75 mmol G/kg chow, a diminution in incorporation became progressively significant. Fatty-acid synthesis was significantly inhibited only at the highest dose of G, whereas nonsaponifiable-lipid synthesis was substantially reduced at all three doses of the isoprenoid (Fig. 4).

In silico analysis of the effect of G on lipid metabolism and the expression of related genes in PC-3 cells

Hierarchical clustering revealed two stable groups, the vehicle-exposed (a working solution of 0.01% [v/v] ethanol) and the G-treated cells. Similarly, at the genetic level two stable clusters were identified from the first node of the dendrogram. We designated these clusters as being up-regulated or down-regulated upon treatment with G. That the genes related to lipogenesis all segregated into the down-regulated cluster, whereas those involved in lipoprotein metabolism all seemed to be activated by G treatment was most interesting. The distribution of genes from the other functional categories varied between the two clusters: The genes encoding bile-acid metabolism and cholesterol excretion showed a tendency to be activated, with six genes in the up-regulated vs three in the downregulated cluster (at 66% overall): the genes related to cholesterol transport exhibited the reverse pattern, with three out of four in the down-regulated cluster (at 75% overall); the genes responsible for lipolysis and [beta]-oxidation were principally up-regulated, with five out of seven in that cluster (at 71% overall): and finally the genes governing the MP proved to be essentially divided, with 13 out of 20 in the down-regulated cluster (65% overall; Fig. 5A).

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

TTest analysis for these genes between the vehicle-exposed and the G-treated cells--at a significance level of 0.05--indicated that ACSL1, ABCA1, DHCR24, ACAT2, ACACA, ABCG1, ACAD9, ACACB, IDI1, PPARG, SCD, SCARB1, HMGCS1, EBP, DHCR7, FASN, HMGCR, and GPAM were down-regulated upon G treatment; whereas NR1H2, PPARA, INSIG2, CPTP1, APOE, VLDLR, ABCC2, and SREBF2 were activated after exposure to G (Fig. 5, Panel B). Furthermore, the reverse cholesterol transport, lipogenesis, and MP biofunctions were down-regulated. On the basis of these results and the previous data from our own laboratory, we decided to validate five of these genes (HMGCR, ACACA, LDLR, VLDLR, and SREBF2) in the livers of G-treated mice, as this organ plays a major role in cholesterol and lipid metabolism (van der Wulpet al. 2013).

Effect of G on the HMGCR of mouse liver

The analysis of HMGCR expression by real-time RT-PCR revealed a dose-dependent increase in the amount of the mRNA encoding the enzyme. The highest dose of G (75 mmol G/kg chow) produced a statistically significant rise in the mRNA levels in the livers of the mice compared to the control values (Fig. 6, Panel A). Nevertheless, the levels and specific activities of the protein in the microsomes decreased reciprocally with increases in the doses of G (Fig. 6, panels B and C), resulting in a statistically significant effect on each of the two parameters at respective doses of 75 and 50 plus 75 mmol G/kg chow.

Effect of G on the LDL-receptor-, ACACA-, VLDL-receptor-, and SREBF2-mRNA transcription

In order to evaluate cholesterol uptake by the liver, we measured the transcriptional expression of the LDL receptor. As determined by real-time RT-PCR, the LDL receptor mRNA was significantly increased in mice fed with 50 and 75 mmol G/kg chow (Fig. 7A). The SREBF2-mRNA levels, however, did not vary significantly under either feeding condition (Fig. 7, Panel B). To ascertain the possible reason for the decrease in serum TG, we evaluated the mRNA levels of ACACA, the rate limiting enzyme in the fatty-acid synthesis. We observed that G tended to inhibit ACACA transcription in animals treated with the middle dose, with this inhibition becoming statistically significant at 75 mmol G/kg chow (Fig. 8A). Moreover, by measuring the VLDL-receptor mRNA we also were able to evaluate the TG removed from VLDL by liver cells. These results indicated that the VLDL-receptor expression was up-regulated by G (Fig. 8B). This increased transcription was statistically significant in mice fed with 50 mmol G/kg chow. Finally, most of these determinations of gene expression by real-time RT-PCR were consistent with the analyses in silico illustrated in Fig. 5.

Discussion

In the present work we have demonstrated that G, a natural monoterpene present in the essential oils of several plants, significantly diminished the triglyceride and cholesterol levels in mouse blood, without exerting any effect on the animals' gain in body weight, food intake (Table 2), or liver histology (Fig. 2). Furthermore, mice fed with 50 and 75 mmol G/kg chow exhibited a reduction in the synthesis of total liver lipids, especially with respect to the nonsaponifiable fraction (Fig. 4), where cholesterol biosynthesis was presumably the main process inhibited by G, as we had demonstrated in several previous studies on cultured cells (Crespo et al. 2013; Polo et al. 2011; Polo and de Bravo 2006). These results encouraged us to consider G as a phytochemical with potential as an agent for combatting hypercholesterolemia. Since 50% or more of the total cholesterol in humans derive from de-novo synthesis, one of the most effective means to reduce the sterol's levels is undoubtedly an inhibition of its endogenous synthesis at the hepatic level (Vallianou et al. 2011). We suggest that HMGCR inhibition would be one of the multiple effects that isoprenoid compounds seem to be exerting on the MP, though that possibility had not yet been specifically elucidated previously. Only few citations in the literature (Duncan et al. 2004; Peffley and Gayen 2003)-in addition to previous studies from our laboratory (Crespo et al. 2013) and the data obtained from the in-silico analysis presented here--have documented both a transcriptional and a posttranscriptional inhibition of the enzyme in cultured tumor cells. Our in-vivo results are in accord with the aforementioned reports on cultured cells since the animals treated with G evidenced a decrease in both the levels and the activity of hepatic HMGCR even though the enzyme-specific mRNA levels increased in a dose-dependent manner (Fig. 6).

[FIGURE 5 OMITTED]

[FIGURE 6 OMITTED]

Regarding the regulation of HMGCR messenger levels, despite the indication by in-silico analysis that SREBF2 mRNA-which transcript modulates the expression of the HMGCR structural gene-was overexpressed in cultured G-treated cells, our work demonstrated that those regulatory-mRNA levels did not vary in the livers of mice treated with geraniol (Fig. 7); possibly because, in addition to affecting the SREBF2 gene's expression at the transcriptional level, the monoterpene could be regulating, directly or indirectly, the maturity mechanism of this transcription factor-involving a cleavage in the endoplasmatic reticulum and thus a prevention of nuclear migration--in agreement with the reports of Espenshade and Hughes (2007) and Sato (2009).

In order to gain a more complete understanding of the role of SREBF2 transcription in the modulation of cholesterol levels under these experimental conditions, we also evaluated the effect of G on LDL-receptor mRNA--its gene constituting another target of the mature SREBF2 (Sato 2009)-since one of the mechanisms that participates in cellular-cholesterol homeostasis is the uptake of cholesterol from the serum mainly through the internalization of LDL-cholesterol via the LDL receptor (Chang et al. 2006) within the LDL pathway (Goldstein and Brown 1990). The increase in LDL-receptor mRNA in mice treated with all three G doses was only statistically significant from the second dose assayed, which response correlated with the diminution observed in serum-cholesterol levels (Fig. 7, Panel A and Fig. 1, respectively). These results, together with the observation that the cholesterol levels in liver were not modified by the treatments with G (Fig. 3), suggest the occurrence of an overexpression of the LDL-receptor gene to produce an increased uptake of exogenous cholesterol as a compensatory mechanism to offset the decrease in endogenous cholesterogenesis.

G also produced a decline in serum TG (Fig. 1). Moreover, the decreases in the incorporation of [14C]acetate into fatty acids in the livers of the treated mice (Fig. 4) along with the drop in the ACACA-mRNA levels (Fig. 8) support the hypothesis that the lowering of the serum TG concentration effected by G could have been mediated by that concomitant inhibition of the synthesis of fatty acids. Nevertheless, serum TG significantly decreased with doses of G that did not yet produce a statistically significant inhibition in fatty-acid synthesis (c/. Figs. 1 and 4). Consequently, we consider that other regulatory mechanisms involved in the metabolism of fatty acids could be operating to produce the lowering of serum TG. Since VLDL transports TG in the serum and the VLDL receptor has been proposed to bind VLDL as well as lipoprotein lipase and thus facilitate lipolysis (Crawford et al. 2008; Tacken et al. 2000)-or even to induce VLDL uptake (Guo-Min et al. 2012)--the overexpression of the VLDL-receptor gene induced by G (Fig. 8) should be associated with an elevated removal of TG from the serum. Furthermore, similar hypolipidemic effects and molecular mechanisms have been shown in mice treated with the essential oils from Melissa officinalis (Jun et al. 2014). Accordingly, on the basis of the in-silico analyses presented here, we hypothesized that G induced a fundamental change in the expression of several key genes involved in lipid metabolism resulting in a significant decrease in lipogenic-gene expression, particularly those related to the synthesis of cholesterol, fatty acids, and the saponifiable lipids; all of those gene products being targets for SREBF2 and SREBFlc. Furthermore, SREBFlc expression was down-regulated and nuclear-receptor-gene expression also modified by G (c/. Fig. 5): there the peroxisome proliferator-activated receptor-(PPARA) and the farnesoid X receptor (FXR aka NR1H4) were up-regulated, whereas the liver X receptor (LXR aka NR1H3) was down-regulated. Another relevant action of G concerns lipid trafficking in blood, as most genes involved in reverse cholesterol transport and lipoprotein metabolism have had their transcription modified under the influence of that monoterpene. Fig. 9 shows the model we propose for the overall effects of G, as suggested from the results obtained in the present work, in our previous studies (Crespo et al. 2013; Galle et al. 2014), and from the literature (Goto et al. 2011; Jun et al. 2014; Takahashi et al. 2002).

In this model, high levels of both the cholesterol and the TGs in serum along with the presence of oxidized LDL--it accelerating atherogenesis--increase the risk of coronary disease (Chung et al. 2008). Because of the action of G in lowering the levels of both of these compounds selectively in the serum compartment, we propose that G-a natural compound having such pronounced hypolipidemic effects--could well constitute an effective prophylactic or therapeutic agent for the prevention and/or treatment of cardiovascular disease.

[FIGURE 7 OMITTED]

[FIGURE 8 OMITTED]

[FIGURE 9 OMITTED]

Conclusions

In the present work we have demonstrated that mice administered with G had significantly lower levels of serum cholesterol and TG. The following mechanisms may have mediated this effect: First, a down-regulation of hepatocyte-cholesterol synthesis occurred as a result of decreased HMGCR protein levels and catalytic activity. Second, the levels of LDLR mRNA became elevated, thus suggesting an increase in the uptake of serum LDL, especially by the liver. Third, TG synthesis became reduced very likely because of a decrease in fatty-acid synthesis.

Dietary phytochemicals may alter gene expression in different ways. The results from these experiments provide information on the effects of G on the metabolism of specific lipids that should contribute to a decrease in the risk of cardiovascular disease. To our knowledge, this investigation is one of the first studies demonstrating that G could constitute a potential prophylactic and/or therapeutic agent by lowering both the cholesterol and the TG in serum so as to contribute to a primary as well as a secondary prevention of coronary disease.

Conflict of interest

We have no conflicts of interest to declare.

Abbreviations: ACACA, acetyl-CoA carboxylase; G, geraniol; HMG-CoA, 3-hydroxy-3-methylglutarylcoenzyme-A; HMGCR, 3-hydroxy-3-methylglutarylcoenzyme-A reductase; LDL, low-density-lipoprotein; LDLR, low-density-lipoprotein receptor; MP, mevalonate pathway; RT-PCR, reverse-transcriptase-polymerase-chain reaction; SREBF2, sterol-regulatory-element-binding transcription factor; TG, triglyceride; VLDL, very-low-density-lipoprotein; VLDLR, very-low-density-lipoprotein receptor.

ARTICLE INFO

Article history:

Received 24 December 2014

Revised 18 April 2015

Accepted 24 April 2015

Acknowledgements

This work was supported by research grants from Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET) Argentina, Agenda Nacional de Promotion Cientffica y Tecnologica (ANPCyT), and Universidad Nacional de La Plata.

We would like to thank Dr. Donald F. Haggerty, a retired career investigator and native English speaker, for editing the final version of the manuscript.

Supplementary Materials

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2015.04.005.

References

Ahmad, S.T., Arjumand, W., Seth, A., Nafees, S., Rashid, S., Ali, N., Sultana, S., 2011. Preclinical renal cancer chemopreventive efficacy of geraniol by modulation of multiple molecular pathways. Tox 290, 69-81.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.

Burke, Y.D., Stark, M.J., Roach, S.L., Sen, S.E., Crowell, P.L., 1997, Inhibition of pancreatic cancer growth by the dietary isoprenoids farnesol and geraniol. Lipids 32, 151-156.

Cardozo, M.T., de Conti, A., Ong, T.P., Scolastici, C., Purgatto, E., Horst, MA, Bassoli, B.K., Moreno, F.S., 2011. Chemopreventive effects of beta-ionone and geraniol during rat hepatocarcinogenesis promotion: distinct actions on cell proliferation, apoptosis, HMGCoA reductase, and RhoA. J. Nutr, Biochem. 22, 130-135.

Carnesecchi, S., Schneider, Y., Ceraline, J., Duranton, B., Gosse, F., Seiler. N., Raul, F., 2001. Geraniol, a component of plant essential oils, inhibits growth and polyamine biosynthesis in human colon cancer cells, J. Pharmacol. Exp. Ther. 298, 197-200.

Crawford, D.C., Nord, A.S., Badzioch, M.D., Ranchalis, J., McKinstry, LA., Ahearn, M., Bertucci, C., Shephard, C., Wong, M., Rieder, M.J., Schellenberg, G.D., Nickerson, D.A., Heagerty, P.J., Wijsman, E.M., Jarvik, G.P., 2008. A common VLDLR polymorphism interacts with APOE genotype in the prediction of carotid artery disease risk. J. Lipid Res. 49, 588-596.

Crespo, R., Montero Villegas, S., Abba, M.C., de Bravo, M.G., Polo, M.P., 2013. Transcriptional and posttranscriptional inhibition of HMGCR and PC biosynthesis by geraniol in 2 Hep-G2 cell proliferation linked pathways. Biochem. Cell Biol. 91, 131-139.

Chang, T.Y., Chang, C.C., Ohgami, N., Yamauchi, Y., 2006. Cholesterol sensing, trafficking, and esterification. Annu. Rev. Cell Dev. Biol. 22, 129-157.

Chaudhary, S.C., Siddiqui, M.S., Athar, M., Alam, M.S., 2013. Geraniol inhibits murine skin tumorigenesis by modulating COX-2 expression, Ras-ERKl/2 signaling pathway and apoptosis. J. Appl. Toxicol. 33, 828-837.

Chen, W., Viljoen, A.M., 2010. Geraniol-A review of a commercially important fragrance material. S. Afr. J. Bot. 76, 643-651.

Chung, M.J., Park, K.W., Kim, K.H., Kim, C.T., Baek, J.P., Bang, K.H., Choi, Y.M., Lee, S.J., 2008. Asian plantain (Plantago asiatica) essential oils suppress 3-hydroxy-3methyl-glutaryl-co-enzyme A reductase expression in vitro and in vivo and show hypocholesterolaemic properties in mice. Br. J. Nutr. 99, 67-75.

Dudley, R.A., Anderson, R.E., 1975. Separation of polyunsaturated fatty acids by argentation thin layer chromatography. Lipids 10, 113-115.

Dudoit, S., Yang, Y.H., Callow, M.J., Speed, T.P., 2002. Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments. Stat. Sin. 12, 111-140.

Duncan, R.E., Lau, D., El-Sohemy, A., Archer, M.C., 2004. Geraniol and beta-ionone inhibit proliferation, cell cycle progression, and cydin-dependent kinase 2 activity in MCF-7 breast cancer cells independent of effects on HMG-CoA reductase activity. Biochem. Pharmacol. 68, 1739-1747.

Espenshade, P.J., Hughes, A.L., 2007. Regulation of sterol synthesis in eukaryotes. Annu. Rev. Genet. 41, 401-427.

Folch, J., Lees, M., Sloane Stanley, G.H., 1957. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226, 497-509.

Galle, M., Crespo, R., Rodenak Kladniew, B., Montero Villegas, S., Polo, M., de Bravo, M.G., 2014. Suppression by geraniol of the growth of a549 human lung adenocarcinoma cells and inhibition of the mevalonate pathway in culture and in vivo: potential use in cancer chemotherapy. Nutr. Cancer 66, 888-895.

Goldstein, J.L., Brown, M.S., 1990. Regulation of the mevalonate pathway. Nature 343, 425-430.

Goto, T., Kim, Y.L, Funakoshi, K., Teraminami, A., Uemura, T., Hirai, S., Lee, J.Y., Makishima, M., Nakata, R.. Inoue, H., Senju, H., Matsunaga, M., Horio, F., Takahashi, N., Kawada, T., 2011. Farnesol, an isoprenoid, improves metabolic abnormalities in mice via both PPARalpha-dependent and -independent pathways. Am. J. Physiol. Endocrinol. Metab. 301, E1022-E1032.

Guo-Min, S., Ying-Ze, Z., Ming-Tai, C., Feng-Lin, Z., Xiao-Ling, L., Yi, W., Chang-Zheng, L., Jia, Y., Jun-Wu, Z., 2012. Hypoxia-inducible factor-1 (HIF-1) promotes LDL and VLDL uptake through inducing VLDLR under hypoxia. Biochem. J. 441, 675-683.

Jayachandran, M., Chandrasekaran, B., Namasivayam, N., 2014. Effect of geraniol, a plant derived monoterpene on lipids and lipid metabolizing enzymes in experimental hyperlipidemic hamsters. Mol. Cell. Biochem. 398, 39-53.

Jin, X., Sun, J., Miao, X., Liu, G., Zhong, D., 2013. Inhibitory effect of geraniol in combination with gemcitabine on proliferation of BXPC-3 human pancreatic cancer cells. J. Int. Med. Res. 41, 993-1001.

Jun, H.J., Lee, J.H., Kim, J., Jia, Y., Kim, K.H., Hwang, K.Y., Yun, E.J., Do, K.R., Lee, S.J., 2014. Linalool is a PPARalpha ligand that reduces plasma TG levels and rewires the hepatic transcriptome and plasma metabolome. J. Lipid Res. 55, 1098-1110.

Kim. S.H., Park, E.J., Lee, C.R., Chun, J.N., Cho, N.H., Kim, LG., Lee, S., Kim, T.W., Park, H.H., So, L, Jeon, J.H., 2012. Geraniol induces cooperative interaction of apoptosis and autophagy to elicit cell death in PC-3 prostate cancer cells. Int. J. Oncol. 40, 1683-1690.

Lapczynski, A., Bhatia, S.P., Foxenberg, R.J., Letizia, C.S., Api, A.M., 2008. Fragrance material review on geraniol. Food Chem. Toxicol. 46 (Suppl. 11), S160-S170.

Lee, S., Chun, J.N., Kim, S.H., So, L, Jeon, J.H., 2013. Icilin inhibits E2Fl-mediated cell cycle regulatory programs in prostate cancer. Biochem. Biophys. Res. Commun. 441, 1005-1010.

Li, Y.C., Park, M.J., Ye, S.K., Kim, C.W., Kim, Y.N., 2006. Elevated levels of cholesterol-rich lipid rafts in cancer cells are correlated with apoptosis sensitivity induced by cholesterol-depleting agents. Am.J. Pathol. 168, 1107-1118 quiz 1404-1105.

Llorente, A., van Deurs, B., Sandvig, K., 2007. Cholesterol regulates prostasome release from secretory lysosomes in PC-3 human prostate cancer cells. Eur. J. Cell Biol. 86, 405-415.

Mo, H., Elson, C.E., 2004. Studies of the isoprenoid-mediated inhibition of mevalonate synthesis applied to cancer chemotherapy and chemoprevention. Exp. Biol. Med. 229, 567-585.

Ong, T.P., Heidor, R., de Conti, A., Dagli, M.L., Moreno, F.S., 2006. Farnesol and geraniol chemopreventive activities during the initial phases of hepatocarcinogenesis involve similar actions on cell proliferation and DNA damage, but distinct actions on apoptosis, plasma cholesterol and HMGCoA reductase. Carcinogenesis 27, 1194-1203.

Pan, W., 2002. A comparative review of statistical methods for discovering differentially expressed genes in replicated microarray experiments. Bioinformatics 18, 546-554.

Peffley, D.M., Gayen, A.K., 2003. Plant-derived monoterpenes suppress hamster kidney cell 3-hydroxy-3-methylglutaryl coenzyme a reductase synthesis at the posttranscriptional level, J. Nutr. 133, 38-44.

Polo, M.P., Crespo, R., de Bravo, M.G., 2011. Geraniol and simvastatin show a synergistic effect on a human hepatocarcinoma cell line. Cell Biochem. Funct. 29, 452-458.

Polo, M.P., de Bravo, M.G., 2006. Effect of geraniol on fatty-acid and mevalonate metabolism in the human hepatoma cell line Hep G2. Biochem. Cell Biol. 84, 102-111.

Ren, Z., Gould, M.N., 1994. Inhibition of ubiquinone and cholesterol synthesis by the monoterpene perillyl alcohol. Cancer Lett. 76, 185-190.

Sato, R., 2009. SREBPs: protein interaction and SREBPs. FEBS J. 276, 622-627.

Tacken, P.J., Teusink, B., Jong, M.C., Harats, D., Havekes, L.M., van Dijk, K.W., Hofker, M.H., 2000. LDL receptor deficiency unmasks altered VLDL triglyceride metabolism in VLDL receptor transgenic and knockout mice. J. Lipid Res. 41, 2055-2062.

Takahashi, N., Kawada, T., Goto, T., Yamamoto, T., Taimatsu, A., Matsui, N., Kimura, K., Saito, M., Hosokawa, M., Miyashita, K., Fushiki, T., 2002, Dual action of isoprenols from herbal medicines on both PPARgamma and PPARalpha in 3T3-L1 adipocytes and HepG2 hepatocytes. FEBS Lett. 514, 315-322.

Vallianou, L, Peroulis, N., Pantazis, P., Hadzopoulou-Cladaras, M., 2011. Camphene, a plant-derived monoterpene, reduces plasma cholesterol and triglycerides in hyperlipidemic rats independently of HMG-CoA reductase activity. PLoS One 6, e20516.

van der Wulp, M.Y., Verkade, H.J., Groen, A.K., 2013. Regulation of cholesterol homeostasis. Mol. Cell. Endocrinol. 368, 1-16.

Wang, J., Zhou, G., Chen, C., Yu, H., Wang, T., Ma, Y., Jia, G., Gao, Y., Li, B., Sun, J., Li, Y., Jiao, F., Zhao, Y., Chai, Z., 2007. Acute toxicity and biodistribution of different sized titanium dioxide particles in mice after oral administration. Toxicol. Lett. 168, 176-185.

Wilson, R., Sargent, J.R., 1992. High-resolution separation of polyunsaturated fatty acids by argentation thin-layer chromatography. J. Chromatogr. A 623, 403-407.

Wiseman, D.A., Werner, S.R., Crowell, P.L., 2007. Cell cycle arrest by the isoprenoids perillyl alcohol, geraniol, and farnesol is mediated by p21(Cipl) and p27(Kipl) in human pancreatic adenocarcinoma cells. J, Pharmacol. Exp. Ther. 320, 1163-1170.

Wolfensohn, S., Lloyd, M., 2013. Handbook of Laboratory Animal Management and Welfare, 4th ed. John Wiley & Sons, Oxford, Wiley-Blackwell.

Yu, S.G., Hildebrand t, L.A., Elson, C.E., 1995. Geraniol, an inhibitor of mevalonate biosynthesis, suppresses the growth of hepatomas and melanomas transplanted to rats and mice. J. Nutr. 25, 2763-2767.

Marianela Galle (a), Boris Rodenak Kladniew (a), Maria Agustina Castro (a), Sandra Montero Villegas (a), Ezequiel Lacunza (b), Monica Polo (a), Margarita Garcia de Bravo (a), Rosana Crespo (a,*)

(a) INIBIOLP (UNLP-CONICET CCT La Plata), Facultad de Ciencias Medicas, Calles 60 y 120, La Plata, Argentina

(b) CINIBA (UNLP-CONICET CCT La Plata), Facultad de Ciencias MeG dicas, Calles 60 y 120, La Plata, Argentina

* Corresponding author. Tel.: +54 221 4824894; fax: +54 221 4258988.

E-mail address: rcrespo@med.unlp.edu.ar, ro_crespo@yahoo.com (R. Crespo).

http://dx.doi.org/10.1016/j.phymed.2015.04.005
Table 1
Real-time-RT-PCR-primer sequences.

Gene           Primer    Sequence (5'-3')

HMGCR          Forward   TGTCOTGATGGCAGCCTTG
               Reverse   CGCGCTTCAGTTCAGTGTCAG

LDLR           Forward   GCAGTAGCTCGCTCTCGTTG
               Reverse   TGGCAATGGATCCCGGAAAG

SREBF2         Forward   AAGGCTGGCCCATAGCTTC
               Reverse   GCAGTAGCTCGCTCTCGTTG

VLDLR          Forward   AGCGCTTCTGTAGGACACAC
               Reverse   CTTCAGCGCTGGCTCTGTTA

ACACA          Forward   GACAGAGGAAGATGGCGTCC
               Reverse   AGATGTGCTGGGTCATGTGG

[beta]-actin   Forward   TCAAGATCATTGCTCCTCCTGAG
               Reverse   CTCCTGCTTGCTGATCCACA

Table 2
Effect of geraniol (C) in body and liver weight and in the food
intake of mice during a 3-week experimental period. After that
exposure to G (at 0,25.50, and 75 mmol G/kg chow) body weight (BW),
liver weight (LW), food intake, and G intake were measured in the
treated and control mice. Values are the means [+ or -] SEM (n = 5).
Values in a row with similar superscript letters do not differ
significantly (p >0.05).

                 Control                    mmol G/kg chow

                                                       25

Initial BW (g)    20.5 [+ or -] 0.4 (a)      20.6 [+ or -] 0.2 (a)
Final BW (g)      25.0 [+ or -] 0.5 (a)      24.0 [+ or -] 0.5 (a)
LW(g)             1.60 [+ or -] 0.07 (a)     1.56 [+ or -] 0.06 (a)
LW/BW            0.064 [+ or -] 0.002 (a)   0.065 [+ or -] 0.002 (a)
Food intake       4.10 [+ or -] 0.26 (a)     3.96 [+ or -] 0.26 (a)
  (g/day)
G intake                                    0.099 [+ or -] 0.006 (a)
  (mmol/day)

                 mmol G/kg chow

                            50                         75

Initial BW (g)    21.0 [+ or -] 0.4 (a)      20.8 [+ or -] 0.4 (a)
Final BW (g)      24.5 [+ or -] 0.2 (a)      24.1 [+ or -] 0.4 (a)
LW(g)             1.60 [+ or -] 0,05 (a)     1.52 [+ or -] 0.06 (a)
LW/BW            0.065 [+ or -] 0.002 (a)   0.063 [+ or -] 0.002 (a)
Food intake       4.02 [+ or -] 0.25 (a)     3.88 [+ or -] 0.23 (a)
  (g/day)
G intake                                    0.291 [+ or -] 0.017 (c)
  (mmol/day)
COPYRIGHT 2015 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Galle, Marianela; Kladniew, Boris Rodenak; Castro, Maria Agustina; Villegas, Sandra Montero; Lacunza
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Jul 15, 2015
Words:6703
Previous Article:Purification and partial characterization of a ribosome-inactivating protein from the latex of Euphorbia trigona Miller with cytotoxic activity...
Next Article:The effect of angoroside C on pressure overload-induced ventricular remodeling in rats.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters