Printer Friendly

Mitochondrial DNA phylogenies for the Drosophila obscura group.

The four major groups of the subgenus Sophophora (genus Drosophila) are the melanogaster, willistoni, saltans, and obscura groups. Of these, only the last is a primarily temperate group found in both the Old and New Worlds. Because many Drosophila researchers occupy temperate regions, species of the obscura group are often the most readily available natural populations of this subgenus. The group is favored for many evolutionary studies (reviewed in Dobzhansky and Powell 1975; Krimbas and Loukas 1980; Lakovaara and Saura 1982; Krimbas 1992, 1993; Powell 1992, 1997) because it is the sister group to the melanogaster group (Powell and DeSalle 1995), most species are easily cultured, and many have naturally occurring inversion polymorphisms. Highlights of research on this group include the development of the biological species concept, the first genetic analysis of reproductive isolation, the demonstration of extremely strong selection on inversion polymorphisms, codiscovery of the rare male effect, and the first extensive molecular study of genetic variation in natural populations. Despite the long history of evolutionary studies of this group, the phylogenetic relationships of the approximately 55 species have remained elusive.

Many studies on the phylogeny of this group have been performed using a variety of data types including morphology, chromosomes, allozymes, and DNA. Although resolving some relationships, these studies have not provided unambiguous evidence for all relationships in the group. Sturtevant (1942) divided the obscura group into two subgroups based on morphological criteria: number of sex-combs, testes shape, and number of rows of achrostichal hairs. Sturtevant's obscura subgroup contained all of the Old World species plus the New World species D. pseudoobscura, D. persimilis, and D. miranda. More recent analyses have questioned the monophyly of the classically defined obscura subgroup; both Lakovaara and Saura (1982) and Goddard et al. (1990) suggested that the New World species related to D. pseudoobscura should be placed into a separate pseudoobscura subgroup. A third subgroup, the affinis subgroup, inhabits North America (with one dubious member, D. helvetica, in Europe; see Burla 1951); the representatives of this subgroup included in this study are D. affinis, D. azteca, and D. algonquin. A fourth subgroup, microlabis, has been proposed based on the discovery of two, presumably relic, species in semitemperate montane areas in Africa (Cariou et al. 1988).

Mitochondrial DNA (mtDNA) sequences have been highly useful in insect phylogenetics (Simon et al. 1994) including Drosophila (e.g., DeSalle 1992a,b). Two previous studies on mtDNA sequences in the obscura group have involved the complete sequence of one gene, COII (Beckenbach et al. 1993); four gene fragments, 16S rDNA, cytb, ND1, ND5; [tRNA.sup.Leu](CUN) and [tRNA.sup.Ser](UCN); as well as four short intergenic sequences located between these genes (Barrio et al. 1994). Here we add new data on the mitochondrial cytochrome oxidase subunit I gene (COI) for many of the same species. We analyze the COI dataset separately as well as combine it with the previous data for a total of 3130 bp of mtDNA sequence for the 13 species common to all studies.

MATERIALS AND METHODS

Sample Preparation

DNA was extracted from frozen or ethanol-preserved flies by standard phenol-chloroform extraction and proteinase K digestion (Werman et al. 1990). Two species belong to the D. affinis subgroup: D. affinis (Hastings NE, USA, Bowling Green Stock Center), and D. azteca (AZ29, Mather, CA, USA). Three species belong to the pseudoobscura subgroup: D. miranda (WP111, Whitney Portal, CA, USA), D. persimilis (MA15, Mather, CA, USA), D. pseudoobscura (DM3, Davis Mountains, TX, USA), and D. pseudoobscura bogotana (Bogota, Colombia). Eight Eurasian species were obtained from D. Sperlich and L. Bachmann (Tubingen): D. ambigua (Vienna), D. bifasciata (Japan), D. guanche (Tenerife, Canary Island), D. madeirensis (Madeira Island, Portugal), D. obscura (Tubingen), D. subobscura (H271, Helsinki), D. subsilvestris (Tubingen), and D. tristis (Vienna). As outgroups, we sequenced two species of the melanogaster group, D. melanogaster (Australia 13, from R. Singh) and D. teissieri (from D. Hartl).

The primers used to amplify COI using the polymerase chain reaction (PCR) were 5[prime]CCAGCTGGAGGAGGAGATCC3[prime] and 5[prime]CCAGTAAATAATGGGTATCAGTG3[prime]. The first base of each corresponds to positions 2131 and 2672, respectively, in the D. yakuba mtDNA sequence (Clary and Wolstenholme 1985), and thus a 542-bp fragment was amplified. PCR reactions used approximately 1 [[micro]gram] of total genomic DNA, 200 ng of each primer, 1 unit of Amplitaq DNA polymerase (Perkin-Elmer), and final concentrations of 1X PCR buffer (as formulated by Perkin-Elmer) and 0.4 mM dNTP (an equimolar mixture of dATP, dCTP, dGTP, dTTP), in a total volume of 100 [[micro]liter]. Amplification was carried out in a Hybaid Omnigene Thermocycler using 30 cycles of 30 sec denaturing at 94 [degrees] C, 30 sec annealing at 50 [degrees] C, and 30 sec extension at 72 [degrees] C. Amplification products were checked for the expected size by electrophoresis of one-tenth of the product through an agarose gel.

Both direct sequencing of PCR products and sequencing of cloned products were done. For direct sequencing, 1 [[micro]liter] of the first PCR product was used in a single-stranded PCR reaction. PCR conditions were the same as above, except that the primers were unbalanced in a ratio of 10:1 and the annealing temperature was 55 [degrees] C. The resulting PCR product was checked by electrophoresis on an agarose gel. The product was then concentrated on a Centricon 30 column before sequencing using a modification of the USBiochemical Sequenase 2.0 kit protocol.

Other double-stranded PCR products were cloned using the TA cloning kit (Invitrogen) following the manufacturer's instructions. Plasmids were extracted using the Qiagen Plasmid kit. Sequencing followed a modification of the Sequenase 2.0 kit protocol (USBiochemical). Most sequencing was done manually with 35S label and separation on 6% acrylamide with 8-M urea gels. The D. guanche and D. subobscura COI sequences were obtained from an ABI 373A automated sequencer using the dye terminator cycle sequencing kit (Perkin-Elmer) following the manufacturer's protocols. All nucleotide sequences were deposited in GenBank (see Appendix).

Phylogenetic Analysis

In addition to the COI gene fragment, we analyzed sequences of seven published mitochondrial genes: the full sequence of cytochrome-c oxidase subunit II (COII; Beckenbach et al. 1993); partial sequences of cytochrome-b (cyt-b), NADH-dehydrogenase 1 (ND1), NADH-dehydrogenase 5 (ND5), and 16S ribosomal DNA; [tRNA.sup.Ser](UCN), [tRNA.sup.Leu](CUN), and a small amount of intergenic sequences (Barrio et al. 1994). For outgroups we used the sequences of D. melanogaster (de Bruijn 1985; Garesse 1988; Kobayashi and Okada 1990) and D. yakuba (Clary and Wolstenholme 1985). The accession numbers in GenBank 91.0 (1995) for all the sequences are listed in the Appendix.

The nucleotide sequences of COI and the other genes were aligned by eye. The lengths of alignments were 496 bp for COI, 688 bp for COII, 501 bp for cyt-b, 493 bp for ND1, 409 bp for ND5, 374 bp for 16S ribosomal DNA, 66 bp for [tRNA.sup.Leu](CUN), 65 bp for [tRNA.sub.Ser](UCN), and 38 bp for intergenic sequences. Phylogenetic analyses were carried out on the COI dataset and on the combined dataset of all sequences (3130 bp). Most species overlapped among the individual datasets (see Appendix). Sequences for D. pseudoobscura bogotana were available for all genes except COII, for which we substituted the North American D. pseudoobscura sequence; we have called the resulting taxon "bogotana" in the combined analyses as most sequences came from that subspecies (see Appendix).

Phylogenetic trees were reconstructed by both neighbor-joining (NJ; Saitou and Nei 1987) and maximum-parsimony (MP; Swofford and Olsen 1990) methods. (The number of taxa and size of the dataset precluded maximum-likelihood analysis.) The numbers of nucleotide substitutions per site were estimated by Tamura and Nei's (1993) method using MEGA (Kumar et al. 1993). Because of the heterogeneous nature of the genes, we compared nongamma and gamma distances obtained by the Tamura and Nei model (with the MEGA default gamma parameter a = 0.5). Gamma distances allow for heterogeneity of rates. Because these two distance methods produced identical NJ trees, only the nongamma distance results are presented in the tables and figures. PAUP 3.1.1 (Swofford 1993) was used to reconstruct MP trees. Heuristic searches were conducted with 10 random stepwise additions and the tree bisection-reconstruction method of branch swapping. For both NJ and MP, the robustness of each node was tested by bootstrap analysis (Felsenstein 1985) with 1000 replications, except that only 500 replications were done for the MP method on the combined data.

RESULTS

Before proceeding with the main results, we mention one anomolous finding. Amplification of the mitochondrial COl gene from total DNA of multiple D. madeirensis flies produced the expected approximately 540-bp fragment as well as a smaller band of about 330 bp when visualized on an agarose gel. Both of these bands were cloned and sequenced. The smaller band has the same sequence as the larger band, but it has a deletion of 214 bp corresponding to bases 2426 to 2639, inclusive, in the D. yakuba mitochondrial DNA sequence (Clary and Wolstenholme 1985). To determine if the deletion is present in all flies of this strain, five, single-fly DNA extractions were done and the resulting DNA was PCR amplified by the same method. In all amplifications, two bands of approximately 540 bp and 330 hp were present (data not shown). We do not know if this apparently partially deleted duplication resides in the mtDNA or nucleus.

The COI fragments from the 15 Drosophila species we studied have a high proportion (67-72%) of A + T (Table 1), [TABULAR DATA FOR TABLE 1 OMITTED] especially in third codon positions (84.8-97.5%), and at fourfold degenerate sites (86.5-98.6%) as has been reported for other Drosophila species (DeSalle et al. 1987; Nigro et al. 1991; Tamura 1992) and other mitochondrial genes for the obscura species (Beckenbach et al. 1993; Barrio et al. 1994). Of 496 bases in the COI gene, 134 nucleotide sites have one or more substitutions, 118 of which are at the third codon position.

The number of nucleotide substitutions per site was estimated by the Tamura and Nei (1993) method. Distances based on all nucleotide positions of the COI sequences range from as little as 0.42%, between D. persimilis and D. pseudoobscura, to as high as 15%, between D. yakuba and D. bifasciata. Distances between different subgroups range from 10% to 13%. Distances based on transversional substitutions range from 0.4% to 1%, for comparisons between closely related species, to 5% to 6% for comparisons between subgroups (Table 2, above diagonal).

The ratio of transitions to transversions (Ti/Tv) for all pairwise [TABULAR DATA FOR TABLE 2 OMITTED] species comparisons ranges from 0.29 to 3.68 (Table 2, below diagonal). The highest ratios are among closely related species: the North American pseudoobscura subgroup (D. pseudoobscura, D. persimilis, and D. miranda) and the Eurasian species D. subobscura, D. guanche, and D. madeirensis. The lowest ratios are for comparisons between melanogaster and obscura group species. A strong bias for transitional substitutions between closely related species, with a loss of this bias between more distantly related species, has been previously demonstrated for Drosophila mtDNA. This trend has been explained by the fast saturation of transitional substitutions due to the strong biases in both base composition and substitution patterns (DeSalle et al. 1987; Beckenbach et al. 1993; Barrio et al. 1994). Our data reflect this phenomenon: for transversional divergences less than 3% (bold figures in Table 2), the mean Ti/Tv ratio is 2.7 (not including the one infinite ratio), while at divergences greater than 4%, the ratio is 0.97. This suggests that transitional substitutions have reached saturation for these species comparisons and, therefore, for the phylogenetic analyses, we used only transversions.

Figure 1 shows the results of our phylogenetic analyses. Because the COI sequence of D. teissieri was identical to the published D. yakuba sequence except for one T/C difference, we used a polymorphic character (Y) at this site and henceforth designated this sequence as D. yakuba. For all the phylogenetic analyses, the topologies of the NJ and MP trees were identical.

The phylogeny based on COI alone, is shown on the left of Figure 1. The heuristic search produced only one MP tree that is 141 steps long. Both the NJ and MP trees support the monophyly of the North American pseudoobscura subgroup with bootstrap values greater than 80% for this node. The other North American subgroup, here represented by D. azteca and D. affinis, is also clearly monophyletic (bootstrap values greater than 97%). Considering only nodes with bootstrap values of 70% or greater among the Eurasian species, D. ambigua and D. obscura form a sister clade, which is the sister clade of the D. subsilvestris and D. bifasciata clade. In addition, D. guanche, D. subobscura, and D. madeirensis form a fourth clade. The COI fragment is unable to resolve the placement of D. tristis and some of the relationships among the four resulting major clades.

The right half of Figure 1 shows the results of combining all 3130 bp of the eight available mitochondrial genes. The heuristic search produced only one MP tree that is 679 steps long. It differs from the COI tree in some minor aspects. Drosophila tristis, in the combined tree, is the sister taxon to the ambigua-obscura clade. The subsilvestris-bifasciata clade, which was supported by the COI data, does not occur in the combined tree. Constraining a heuristic search to have the North American species (pseudoobscura and affinis sub-groups) monophyletic results in trees of 687 steps, eight steps longer than the most parsimonious tree. These trees are the same length as the ones obtained when the search is constrained to have the Eurasian species monophyletic or both the North American and Eurasian species monophyletic.

DISCUSSION

Clearly the obscura group is a phylogenetically complex taxon and, as yet, not all relationships have been resolved. Despite incomplete resolution, some relationships are becoming clear especially if we combine the results presented here with previous datasets. Unfortunately it is virtually impossible to combine these datasets in any sort of formal analysis, as the data are too heterogeneous. For example, it is not possible to combine distance data (e.g., DNA-DNA hybridization) with character state data (e.g., chromosome inversions, nucleotide positions). Furthermore, even for a single type of data, it is not clear how to combine studies. For example, in each allozyme study, different loci and different sets of species were used and for the chromosome data it is not clear how to weigh an inversion versus a chromosomal arm fusion. Rather than attempting to provide a formal "total analysis," we have tried to summarize the evidence for different nodes in an attempt to evaluate our present knowledge of relationships in the obscura group. In Figure 2 we summarize well-supported relationships based on our study and the data listed in Table 3.

All of the data (morphology, chromosomes, allozymes, and DNA) confirm that the obscura group is monophyletic. Likewise, all types of data indicate both of the two North American subgroups, pseudoobscura ([ILLUSTRATION FOR FIGURE 2 OMITTED], node 10) and affinis (node 9), are monophyletic lineages. Although there is little resolution within the affinis subgroup, a strong consensus has emerged within the pseudoobscura subgroup. The two most closely related species are D. pseudoobscura and D. persimilis, with D. miranda more distant. In the only studies to include it, Lakovaara and Saura (1982) and Beckenbach et al. (1993) found that D. lowei formed the deepest branch in this monophyletic group. For the COI data, the subspecies D. pseudoobscura bogotana is more distant than the species D. pseudoobscura and D. persimilis ([ILLUSTRATION FOR FIGURE 1 OMITTED], left). This is not surprising because D. pseudoobscura and D. persimilis may be exchanging mtDNA in areas of sympatry (Powell 1983). While the strain of North American D. pseudoobscura (from Texas) analyzed here was not from an area in which D. persimilis is found, this North American D. pseudoobscura is more likely to experience gene flow from areas of sympatry than is the Bogota population.

Within the Old World subgroup, some relationships appear in the analyses presented in this paper as well as in other studies (Table 3). The triad subobscura-madeirensis-guanche (node 6) is a monophyletic group with D. guanche having the deepest branch. Another well-supported triad is the obscura-ambigua-tristis clade (node 4), with D. tristis forming the deepest branch. Finally, in the three studies that included the African species D. microlabis and D. kitumensis, Cariou et al. (1988, allozymes), Ruttkay et al. (1992, DNA sequences), and Krimbas (1993, chromosomes) found that these species form a monophyletic group with the deepest branch of the whole group (nodes 2 and 3). Bachmann et al. (1992) have characterized a DNA satellite unique to these two species, providing further evidence of their sister taxa status.

A historical narrative consistent with the phylogenetic relationships and biogeographic data is as follows: The sub-genus Sophophora originated in tropical Afro-Asia (Throckmorton 1975). The melanogaster group retained the ancestral distribution while another lineage became adapted to temperate climates and spread northward to form the obscura group; thus the two African species of the obscura group are early relics of this split and therefore have the deepest branches in the phylogeny. In temperate Eurasia, the obscura group began to diversify and invaded the New World. It is likely that diversification (i.e., new species formation) occurred in temperate Eurasia before invasion into the New World, resulting in the paraphyly of the Old World species.
TABLE 3. Evidence supporting nodes in Figure 2.

Node             Type of data                  References

1            morphology, chromo-         Throckmorton (1975)
              somes, DNA se-             Caccone et al. (1992)
              quences, DNA by-           DeSalle (1992a)
              bridization                Powell and DeSalle (1995)
                                         This paper

2            allozymes, DNA se-          Cariou et al. (1988)
              quences                    Ruttkay et al. (1992)

3            allozymes, DNA se-          Cariou et al. (1988)
              quences, chromo-           Bachmann et al. (1992)
              somes                      Ruttkay et al. (1992)
                                         Krimbas (1993)

4 and 5      chromosomes, DNA            Bachmann and Sperlich
              sequences                   (1993)
                                         Krimbas (1993)
                                         Barrio et al. (1994)
                                         This paper

6            chromosomes, allo-          Lakovaara and Saura
              zymes, DNA se-              (1982)
              quences                    Ruttkay et al. (1992)
                                         Krimbas (1993)
                                         Barrio et al. (1994)
                                         Russo et al. (1995)
                                         This paper

7            DNA sequences, chro-        Krimbas (1993)
              mosomes                    Barrio et al. (1994)
                                         Russo et al. (1995)
                                         This paper

8            DNA hybridization,          Goddard et al. (1990)
              chromosomes                Powell and DeSalle (1995)

9            morphology, chromo-         Sturtevant (1942)
              somes, allozymes,          Lakovaara and Saura
              DNA sequences,              (1982)
              DNA hybridization          Goddard et al. (1990)
                                         Beckenbach et al. (1993)
                                         Barrio et al. (1994)
                                         Wells (1996)
                                         This paper

10           allozymes, DNA se-          Lakovaara and Saura
              quences                     (1982)
                                         Beckenbach et al. (1993)

11 and 12    morphology, chromo-         Dobzhansky (1935)
              somes, allozymes,          Anderson et al. (1977)
              DNA sequences,             Lakovaara and Saura
              DNA hybridization           (1982)
                                         Goddard et al. (1990)
                                         Beckenbach et al. (1993)
                                         Barrio et al. (1994)
                                         Russo et al. (1995)
                                         This paper




Perhaps the most ambiguous major question concerning the history of the obscura group is whether the New World was invaded once or twice, that is, are the pseudoobscura and affinis subgroups sister taxa? The mtDNA sequence data of Beckenbach et al. (1993) support the monophyly of North American species. However, our COI data do not, but with bootstrap values of only around 50% (left in [ILLUSTRATION FOR FIGURE 1 OMITTED]). The combined mtDNA data could not resolve this node with bootstrap value above 50%, and thus there is a polytomy in the right part half of Figure 1. As for nuclear genes, while Adh has been sequenced in several of the obscura group species, it has not been sequenced in the affinis subgroup and therefore does not provide relevant information. Wells (1996) concluded that Gpdh was most consistent with a trichotomy of the two New World and Old World subgroups. Thus, at this point we can only conclude that the available DNA sequence data are ambiguous as to the monophyly of North American species.

However there are two datasets in favor of a single origin of the North American species. DNA-DNA hybridization between the pseudoobscura and affinis subgroup species yielded a mean [Delta]Tm of 2.52, and between these subgroups and Eurasian species the mean [Delta]Tm was 4.02; these measurements have an error around 0.2 (Goddard et al. 1990). However, we must add a caveat: only two Eurasian species were studied by Goddard et al., and it is conceivable a more thorough sampling of taxa would change the conclusions. A less ambiguous character supporting the monophyly of North American species is a fusion of chromosomal elements (arms) A and D in both the pseudoobscura and affinis subgroups; these arms remain separate (the ancestral condition) in all Eurasian species (Powell and DeSalle 1995).

While some of this scenario rests on solid evidence, more data are needed to complete the history of this important group, especially with respect to the relationships among the Eurasian members. However, from the data presented and analyzed here, it would seem that only limited information is available from mtDNA, which is surprising. From previous experience with Drosophila mtDNA, we expected greater resolution, especially considering that we analyzed eight genes representing over 3 kb of sequence. Although transitions are saturated for these genes at the evolutionary distances of most interest (between major lineages), the transversions are unlikely to be saturated. There are 283 phylogenetically informative transversions, a number of characters that should be sufficient to resolve 13 to 14 taxa. We suggest that further studies should concentrate on nuclear sequences or other sources of phylogenetic information.

ACKNOWLEDGMENTS

We thank D. Sperlich, L. Bachmann, D. Hartl, and R. Singh for providing strains of flies; and T. Spinka for comments on the manuscript. J. Chong and C. Min contributed to the data collection. Financial support came from National Science Foundation Grant DEB 9318836 to JRP. JMG was supported by a PHS Training Grant 2T32GM0 7499-16.

LITERATURE CITED

ANDERSON, W. W., F. J. AYALA, AND R. E. MICHOD. 1977. Chromosomal and allozymic diagnosis of three species of Drosophila. J. Hered. 68:71-74.

BACHMANN, L., AND D. SPERLICH. 1993. Gradual evolution of a specific satellite DNA family in Drosophila ambigua, D. tristis, and D. obscura. Mol. Biol. Evol. 10:647-659.

BACHMANN, L., E. MLLER, M. L. CARIOU, AND D. SPERLICH. 1992. Cloning and characterization of KM190, a specific satellite DNA family of Drosophila kitumensis and D. microlabis. Gene 120: 267-269.

BARRIO, E., A. LATORRE, AND A. MOYA. 1994. Phylogeny of the Drosophila obscura species group deduced from mitochondrial DNA sequences. J. Mol. Evol. 39:478-488.

BECKENBACH, A. T., Y. W. WEI, AND H, LIU. 1993. Relationships in the Drosophila obscura species group, inferred from mitochondrial cytochrome oxidase II sequences. Mol. Biol. Evol. 10: 619-634.

BURLA, H. 1951. Systematik, Verbreitung und Oekologie der Drosophila Arten der Schweiz. Rev. Suisse Zool. 58:23-175.

CACCONE, A., J. M. GLEASON, AND J. R. POWELL. 1992. Complementary DNA-DNA hybridization in Drosophila. J, Mol. Evol. 34:130-140.

CARIOU, M.-L., D. LACHAISE, L. TSACAS, J. SOURDIS, C. KRIMBAS, AND M. ASHBURNER. 1988. New African species of the Drosophila obscura species group: Genetic variation, differentiation and evolution. Heredity 61:73-84.

CLARY, D. O., AND D. R. WOLSTENHOLME. 1985. The mitochondrial DNA molecule of Drosophila yakuba: Nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 22:252-271.

DE BRUIJN, M. H. 1985. Drosophila melanogaster mitochondrial DNA, a novel organization and genetic code. Nature 304:234-241.

DESALLE, R. 1992a. The phylogenetic relationships of flies in the family Drosophilidae deduced from mtDNA sequences. Mol. Phylogenet. Evol. 1:31-40.

-----. 1992b. Origin and possible time of divergence of the Hawaiian Drosophilidae. Mol. Biol. Evol. 9:905-916.

DESALLE, R., T. FRIEDMAN, E. PRAGER, AND A. C. WILSON. 1987. Tempo and mode of sequence evolution in mtDNA of Hawaiian Drosophila. J. Mol. Evol. 26:157-164.

DOBZHANSKY, TH. 1935. Drosophila miranda, a new species. Genetics 20:377-391.

DOBZHANSKY, TH., AND J. R. POWELL. 1975. Drosophila pseudoobscura and its American relatives, Drosophila persimilis and Drosophila miranda. Pp. 537-587 in R. C. King, ed. Handbook of genetics. Vol. 3. Invertebrates of genetic interest. Plenum Press, New York.

FELSENSTEIN, J. 1985. Confidence limit on phylogenies: An approach using the bootstrap. Evolution 39:783-791.

GARESSE, R. 1988. Drosophila melanogaster mitochondrial DNA: Gene organization and evolutionary considerations. Genetics 118:649-663.

GODDARD, K., A. CACCONE, AND J. R. POWELL. 1990. Evolutionary implications of DNA divergence in the Drosophila obscura group. Evolution 44:1656-1670.

KOBAYASHI, S., AND M. OKADA. 1990. Complete cDNA sequence encoding mitochondrial large ribosomal RNA of Drosophila melanogaster. Nucleic Acids Res. 18:4592.

KRIMBAS, C. 1992. The inversion polymorphism of Drosophila subobscura. Pp. 128-220 in C. Krimbas and J. R. Powell, eds. Drosophila inversion polymorphism. CRC Press, Boca Raton, FL.

KRIMBAS, C. 1993. Drosophila subobscura: Biology, genetics, and inversion polymorphism. Verlag Dr. Kovac, Hamburg, Germany.

KRIMBAS, C., AND M. LOUKAS. 1980. The inversion polymorphism of Drosophila subobscura. Evol. Biol. 12:163-234.

KUMAR, S., K. TAMURA, AND M. NEI. 1993. MEGA: molecular evolutionary genetics analysis. Vers. 1.01. Pennsylvania State Univ., University Park, PA.

LAKOVAARA, S., AND A. SAURA. 1982. Evolution and speciation in the Drosophila obscura group. Pp. 2-59 in M. Ashburner, H. L. Carson, and J. N. Thompson Jr., eds. The genetics and biology of Drosophila. Vol. 3b. Academic Press, New York.

NIGRO, L., M. SOLIGNAC, AND P. M. SHARP. 1991. Mitochondrial DNA sequence divergence in the melanogaster and oriental species subgroups of Drosophila. J. Mol. Evol. 33:156-162.

POWELL, J. R. 1983. Interspecific cytoplasmic gene flow in the absence of nuclear gene flow: Evidence from Drosophila. Proc. Nat. Acad. Sci. USA 80:492-495.

-----. 1992. Inversion polymorphism in Drosophila pseudoobscura and Drosophila persimilis. Pp. 73-126 in C. Krimbas and J. R. Powell, eds. Drosophila inversion polymorphism. CRC Press, Boca Raton, FL.

-----. 1997. Progress and prospects in evolutionary biology: The Drosophila model. Oxford Univ. Press, New York.

POWELL, J. R., AND R. DESALLE. 1995. Drosophila molecular phylogenies and their uses. Evol. Biol. 28:87-138.

RUSSO, C. A. M., N. TAKEZAKI, AND M. NEI. 1995. Molecular phylogeny and divergence times of Drosophila species. Mol. Biol. Evol. 12:391-404.

RUTTKAY, H., M. SOLIGNAC, AND D. SPERLICH. 1992. Nuclear and mitochondrial ribosomal RNA variability in the obscura group of Drosophila. Genetica 85:143-179.

SAITOU, N., AND M. NEI. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic tree. Mol. Biol. Evol. 4:406-425.

SIMON, C., F. FRATI, A. BECKENBACH, B. CRESPI, H. LIU, AND P. FLOOK. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87: 651-701.

STURTEVANT, A. H. 1942. The classification of the genus Drosophila with the description of nine new species. Univ. Texas Publ. 4213:5-51.

SWOFFORD, D. L. 1993. PAUP: phylogenetic analysis using parsimony. Vers. 3.1.1. Smithsonian Institution, Washington, DC.

SWOFFORD, D. L., AND G. L. OLSEN. 1990. Phylogeny reconstruction. Pp. 411-501 in D. M. Hillis and C. Moritz, eds. Molecular systematics. Sinauer, Sunderland, MA.

TAMURA, K. 1992. The rate and pattern of nucleotide substitution in Drosophila mitochondrial DNA. Mol. Biol. Evol. 9:814-825.

TAMURA, K., AND M. NEI. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10:512-526.

THROCKMORTON, L. H. 1975. The phylogeny, ecology, and geography of Drosophila. Pp. 421-469 in R. C. King, ed. Handbook of genetics. Vol. 3. Plenum Press, New York.

WELLS, R. S. 1996. Nucleotide variation at the Gpdh locus in the genus Drosophila. Genetics 143:375-384.

WERMAN, S. D., E. H. DAVIDSON, AND R. J. BRITTEN. 1990. Rapid evolution in a fraction of the Drosophila nuclear genome. J. Mol. Evol. 30:281-289.

[TABULAR DATA FOR APPENDIX OMITTED]
COPYRIGHT 1997 Society for the Study of Evolution
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1997 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gleason, Jennifer M.; Caccone, Adalgisa; Moriyama, Etsuko N.; White, Kevin P.; Powell, Jeffrey R.
Publication:Evolution
Date:Apr 1, 1997
Words:4600
Previous Article:Statistical tests of host-parasite cospeciation.
Next Article:Costs and benefits of mosquito refractoriness to malaria parasites: implications for genetic variability of mosquitoes and genetic control of malaria.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters