Printer Friendly

Methods for karyotyping and for localization of developmentaly relevant genes on the chromosomes of the purple sea urchin, Strongylocentrotus purpuratus.

Introduction

The genome of the purple sea urchin, Strongylocentrotus purpuratus, has been fully sequenced, extensively annotated, and accompanied by a comprehensive analysis of when and where many genes are expressed during development (SUGSC, 2006). Genes characterized in this genome also indicate the potential importance of sea urchin genomics for comparative studies of genetics, immunology, olfaction, vision, and many other aspects of the life of embryonic and adult purple sea urchins. Until now, genes identified in this cloning effort have not been localized on chromosomes of this species, and only highly amplified ribosomal genes have been placed on the chromosomes of any sea urchin species (Caradonna et al., 2007). This is principally because of the small size (1-6 [micro]m) of sea urchin chromosomes and the technical difficulties involved in preparing them. The phylogenetically related green sea urchin from the eastern coast of the United States, Strongylocentrotus droebachiensis (Lee, 2003), also has highly conserved homologs for genes found in the purple sea urchin (e.g., green sea urchin opsin, GenBank Accesson # DQ285097), and none of these has been localized on a specific chromosome.

We present techniques for the preparation of metaphase sea urchin chromosomal karyotypes and preliminary karyograms for both 5. droebachiensis and 5. purpuratus. Additionally, we have successfully localized bindin genes (that produce species-specific vitelline membrane-binding protein) by using fluorescent in situ hybridization (FISH) and three fluorescently labeled bacterial artificial chromosome (BAC-FISH) clones (brachyury, foxa, and foxb) from the Caltech BAC library on chromosomes from both species of strongylocentrotid sea urchins. Our protocols provide an important proof-of-concept for developing gene maps for the many interesting genes in the sea urchin genome.

Materials and Methods

Collection and fertilization of sea urchins

The specimens of Strongylocentrotus purpuratus used in this study from the coast of California were provided by Dr. Eric Davidson, California Institute of Technology; those of S. droebachiensis were collected intertidally at Odiorne Point on the New Hampshire coast; both species had ripe gonads containing ova and spermatozoa (Walker et al., 2005). Intracoelomic injection of 0.5 mol [1.sup.-1] KC1 through the peristomial membrane (Auclair, 1965) resulted in spawning. Ova were washed and fertilized in 3-4 mmol [1.sup.-1] p-aminobenzoic acid (PABA) in 0.2-[micro]m filtered seawater (FSW) at pH 7.8.

Blastomere dissociation and chromosomal spreads

Cleavage-stage embryos (harvested after about 4 h at 18[degrees]C for 5. purpuratus and 18 h at 4 [degrees]C for S. droebachiensis and with between 16 and 32 blastomeres for both species) were treated for 1 h with 1.0 mg/ml colchicine in FSW followed by resuspension in 1 mol [1.sup.-1] urea. The resulting embryos were passed through a Nytex filter (120 [micro]m) to physically remove the fertilization membrane and to dissociate the blastomeres. The resulting blastomeres were treated in 8% sodium citrate solution and washed three times with Carnoy's fixative (Saotome et al., 2002); then 10-[micro]l aliquots were placed on heated (46 [degrees]C), positively charged slides (Fisher Scientific, Colorfrost Plus slides). Blastomeres in each aliquot were spread (squashed) under coverslips manually using thumb pressure on a coverslip (22 X 22 mm).

Generating karyotypes for both strongylocentrotid species

Blastomere spreads were stained with Giemsa, 4'-6-dia-midino-2-phenylindole (DAPT), or propidium iodide (PI) to visualize their chromosomes. CDP staining (specific for GC-rich regions) was conducted using 0.4 [micro]/ml PI and 0.8 [micro]g/ml DAPI. Karyotypes were generated from clearly discernible chromosomal spreads by pairing the chromosomes on the basis of their constriction sites, centromere position, size, and faint DAPI banding patterns. All observations were made on a Zeiss Axioplan II MOT microscope equipped with epifluorescence, an AxioCam MR camera, and AxioVision 4.3 software (Carl Zeiss, Inc., Thornwood, NJ).

Preparation of chromosomes for FISH and BAC/FISH

Slides with chromosomal preparations (prepared as above) were submerged in liquid nitrogen and coverslips were removed using a razor blade (VWR). Resulting slides with chromosomal preparations were treated with 0.1% pepsin in 0.01 N HC1 at 37 [degrees]C for 10 min to remove histones and other chromosomal proteins. Following pepsin digestion, slides were rinsed in Dulbecco's modified phosphate buffered saline (PBS) for 10 min. Chromosomal preparations were denatured using 70% formamide in 2X SSC (3.5% NaCl, 0.89% sodium citrate) for 90 s at 80 [degrees]C. Finally, chromosomal preparations were dehydrated in an ethanol series (-20[degrees]C) and allowed to air dry.

Labeling of FISH and BAC/FISH probes

A 955-bp PCR product for bindin was amplified using primers (F:GTTGGGGTTCGGTGTGACTGAG and R: CCGCCCATCTGTTGAGGACT) developed from a sequence derived from S. purpuratus sperm (NCBI accession number AF077310). The resulting PCR product was purified using the High Pure PCR Cleanup Micro kit (Roche Applied Sciences) and was nick-translated by incubation for 1.5 h at 15 [degrees]C using the DIG-Nick Translation kit (Roche Applied Sciences, Indianapolis, IN). BAC clones provided by Caltech were nick-translated using the DIG-Nick Translation kit (Roche, Indianapolis, IN) and the BioNick kit (Invitrogen, Carlsbad, CA).

Hybridization and detection of genes on chromosomes

All probes resulting from protocols outlined above were prepared in hybridization buffer (50% dionized formamide, 10% dextran sulfate in 2X SSC), denatured at 90 [degrees]C for 10 min, and immediately placed on ice. Probes were delivered to slides of chromosomal preparations for both species, cover-slipped, and secured with rubber cement. Slides were incubated al 37 [degrees]C overnight in a moist chamber. Rubber cement was removed and coverslips were allowed to float off in 2X SSC. Slides were washed in 2X SSC for 10 min at 42 [degrees]C followed by 1X PBS for 10 min. Detection buffer containing anti-digoxigen rhodamine, streptavidin-Alexa-flor 555, and/or anti-digoxigen fluorescein was placed over chromosomal preparations and incubated at 37 [degrees]C for 1 h in a moist environment. Slides were washed three times for 5 min in TNT buffer (0.1 mol [1.sup.-1] Tris-HCl pH 7.6, 0.15 mol [1.sup.-1] NaCl, 0.05% Tween-20) and placed in 1 X PBS. Slides were drained, treated with Vectashield-DAPI, and observed on a Zeiss Axioplan II MOT microscope equipped with epifluorescence, an AxioCam MR camera, and AxioVision 4.6 software (Carl Zeiss, Inc., Thornwood, N.J).

Slides that yielded positive results for one gene were preserved at--20 [degrees]C prior to re-hybridization with alternative probes. Re-hybridization was accomplished by allowing coverslips to float off in 2X SSC followed by rinsing in Dulbecco's modified PBS for 1 h. Chromosomal preparations and alternative hybridization probes were prepared as above.

Results

Established techniques described in the literature for chromosome preparation for other species of invertebrates (Shoguchi et al., 2006) required modification when applied to sea urchins. We obtained excellent chromosomal preparations from a manual coverslip-squash technique. Use of heated slides in a moist environment as described in previous literature (Gerhart et al., 1979) did not reliably yield interpretable chromosomal preparations. Excellent chromosomal preparations consistently resulted from protocols involving colchicine treatment, use of Nytex mesh for dissociation of blastomeres, and manual squashing of blastomeres under coverslips (Fig. 1). The most important procedures for generating cells for chromosomal squashes are complete removal of the fertilization membrane and complete separation of blastomeres from one another. Among a variety of concentrations tested (ranging from 10 [micro]mol [1.sup.-1] to 8 mmol [1.sup.-1]), 3-4 mmol [1.sup.-1] PABA thoroughly removed the fertilization membrane. Selected on the basis of its high cleavage rate, the optimum embryonic stage for generating chromosomal preparations was between 16 and 32 blastomeres. Application of colchicine at these developmental stages inhibits microtubule polymerization and results in the maximum accumulation of blastomeres in meta-phase. Gentle shaking with urea followed by passage through Nytex mesh was necessary to fully dissociate blastomeres. Faint DAPI banding was more informative than Giemsa, PI, or CDP staining in establishing karyotypes for both species of strongylocentrotid sea urchins.

Both species have 21 chromosomal pairs--20 homomor-phic (autosomal) and one heteromorphic (putative sex) pair (Fig. 2). In our preparations, the chromosomes of Strongy-locentrotus purpuratus are structurally indistinguishable from those of S. droebachiensis. There are 2 large, 8 medium, and 10 small pairs of autosomal chromosomes in both species. Among 34 clearly readable S. purpuratus chromosomal spreads, 19 had a heteromorphic pair and 15 had two of the longest chromosomes. Since preparations that lack the small chromosome have two large chromosomes, the additional large chromosome is believed to be the homolog for the small chromosome. On the basis of these spreads, we have generated a preliminary karyogram for both species of strongylocentrotid sea urchins. We feel confident in numbering chromosomal pairs 1, 2, and 21; precise pairing and localization of specific genes on small (3-10) and medium (11-20) sized chromosomal pairs 3-20 will depend upon more extensive use of our techniques.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Figure 3a shows the bindin gene alleles localized on two pair of homologous chromosomes. Bindin genes were localized at the end of the long pair and also on a medium-sized chromosome in S. purpuratus. In separate preparations, use of BACs as probes for FISH gave a strong signal that can easily be visualized on specific chromosomes. The BAC clone for brachyury contains a single-copy gene that localized to a medium-sized chromosome that has a secondary constriction site. The BAC clones containing foxa and foxb both localized to different medium-sized chromosomes with no morphologically unique characteristics (Fig. 3b-d).

[FIGURE 3 OMITTED]

Discussion

Localizing genes on chromosomes of organisms with sequenced genomes is vital to assembling a map of the genome sequences and also to understanding how genes may interact in intact interphase nuclei (Branco and Pombo, 2006; Shoguchi et al., 2006). The availability of a complete catalog for the genes for Strongylocentrotus purpuratus provides important data necessary for localizing genes on the chromosomes of this sea urchin species. Data on the chromosomal locations of genes would permit an evaluation of their locations within chromosomal territories, where genes that are on different chromosomes may interact when they are located near each other (Levine and Davidson, 2005; Branco and Pombo, 2006).

Sea urchins have small chromosomes (1-6 [micro]mol [1.sup.-1]) that are highly similar, and conventional cytogenetic techniques have yielded preliminary karyograms for only three unrelated species: Arbacia punctulata (2n = 44--Auclair, 1965); Pseudocentrotus depressus, a strongylocentrotid urchin related to both species used in the current study (Lee, 2003; 2n = 42--Yamanaka et al., 1989); and Paracentrotus lividus (2n = 36--Lipani et al., 1996). We have localized bindin genes using FISH and single BACs on chromosomes using BAC-FISH. These are the first successful single-copy gene localizations on the chromosomes of the purple and green sea urchins or any sea urchin species. Although we expect that a complete mapping of the genome of the purple sea urchin will provide extensive information, the data set we have generated in this study has already yielded previously unavailable information on the locations of specific genes:

Bindin. While a careful analysis of chromosomal preparations from the adult tissues of sexed individuals will be necessary to confirm the existence of sex chromosomes in sea urchins, another approach might be to determine the locations of genes encoding sex-specific proteins. At the molecular level, several proteins are differentially expressed in males and females of a variety of sea urchins. Numerous ovary-specific proteins are manufactured by the oocyte or the ovary and are eventually found in the cortical granules of ova (Walker et al, 2007). Among others, these include hyalin (Wessel et al., 1998), glycosaminoglycans (Schuel et al., 1974), serine proteases (Haley and Wessel, 1999), and ovoperoxidase and proteoliaisin (Somers et al., 1989; Nomura et al., 1999). Proteins unique to the testis include histone H1, H2B-1, and H2B-2, which are produced in mitotically active spermatogonial cells (Poccia et al., 1989); and bindin, which is produced by late spermatocytes and early spermatids (Cameron et al., 1990). We hypothesized that a male-specific gene might be localized on one of the chromosomes in the heteromorphic (or putative sex chromosomal) pair. In an effort to test this hypothesis, we used the bindin gene because it is expressed only in the testis, and bindin mRNA is not present in female gonads or eggs (Gao et al., 1986). Despite our initial hypothesis, we show that bindin is located on two sets of homologous chromosomes and that neither of these is the heteromorphic pair.

Brachyury, Foxa, and Foxb. Brachyury is a transcription factor that functions in gastrulation and endoderm development; downstream genes transcribed by brachyury are involved in morphogenesis of the gut (Rast et al., 2002). Foxa represses the mesodermal fate in the vcg2 endomesoderm, is required in postgastrular development for the expression of gut-specific genes, and is necessary for stomodeal formation (Oliveri et al., 2006). Foxb transcription occurs in primary mesenchyme cells and in the endomesoderm; foxb is regulated by the gene products of brachyury and foxa (Levine and Davidson, 2005). We have shown that genes for brachyury, foxa, and foxb, which have interrelated functions and may be regulated by similar upstream gene products in the endomesodermal and other gene regulatory networks, are located on different chromosomes. These results make further analysis of gene locations within intact interphase nuclei possible and may yield positional information relevant to their documented interactions during sea urchin development (Levine and Davidson, 2005; Branco and Pombo, 2006).

Our methods provide a proof-of-concept for generating karyotypes of sea urchins and for use of FISH and BAC-FISH techniques on the chromosomes of two species of strongylocentrotid sea urchins. We hope that others will find these techniques useful in developing full gene maps for these strongylocentrotid sea urchins and that, as additional genomes are sequenced for other species of sea urchin, this information will be useful in determining interactions of genes during development and in adults of these model organisms.

Acknowledgments

Funding was provided by a University of New Hampshire Marine Program Grant to CCE and a Hatch (335) grant to CWW. Specimens of S. purpuratus were provided by Dr. E. Davidson of Caltech. Drs. A. Cameron and E. Helguero of Caltech prepared the BAC clones using data from the Sea Urchin Genome Project (http://www.spbase.org/SpBase/). J. Walling of University of Wisconsin-Madison assisted with FISH methodology.

Literature Cited

Auclair, W. 1965. The chromosomes of sea urchins, especially Arbacia punctulata; a method for studying unsectioned eggs at first cleavage. Biol. Bull, 128: 169-176.

Branco, M. R., and A. Pombo. 2006. Intermingling of chromosome territories in interphase suggests role in translocations and transcription-dependent associations. PloS Biol. 4(5): 780-788.

Cameron, R. A., J. E. Minor, D. Nishioka, R. J. Britten, and E. H. Davidson. 1990. Locale and level of bindin mRNA in maturing testis of the sea urchin, Strongylocentrotus purpuratus. Dev. Biol. 142: 44-49.

Caradonna, F., D. Bellavia, A. M. Clemente, G. Sisino, and R. Bar-bieri. 2007. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus. Genome 50: 867-870.

Gao, B., L. E. Klein, R. J. Britten, and E. H. Davidson. 1986. Sequence of mRNA coding for bindin, a species-specific sea urchin sperm protein required for fertilization. Dev. Biol. 83: 8634-8638.

Gerhart, S. G., E. B. Wagenaar, and C. C. Lin. 1979. Chromosome analysis of two species of sea urchin (Strongylocentrotus purpuratus and Lytechinus variegatus). Genetics 91: s38.

Haley, S. A., and G. M. Wessel. 1999. The cortical granule serine protease CGSP1 of the sea urchin, Strongylocentrotus purpuratus, is autocatalytic and contains a low-density lipoprotein receptor-like domain. Dev. Biol. 211: 1 - 10.

Lee, Y. 2003. Molecular phytogenies and divergence times of sea urchin species of Strongylocentrotidae, Echinoida. Mol. Biol. Evol. 20: 1211-1221.

Levine, M., and E. H. Davidson. 2005. Gene regulatory networks for development. Proc. Natl. Acad. Sci. USA 102: 4936-4942.

Lipani, C, R. Vitturi, G. Sconzo, G. Barbata. 1996. Karyotype analysis of the sea urchin Paracentrotus lividus (Echinodermata): evidence for a heteromorphic chromosome sex mechanism. Mar. Biol. 127: 67-72.

Nomura, K., K. Hoshino, and N. Suzuki. 1999. The primary and higher order structures of sea urchin ovoperoxidase as determined by cDNA cloning and predicted by homology modeling. Arch. Biochem. Biophys. 367: 173-184.

Oliveri, P., K. D. Walton, E. H. Davidson, and D. R. McClay. 2006. Repression of mesodermal fate by foxa, a key endoderm regulator of the sea urchin embryo. Development 133: 4173-4181.

Poccia, D., T. Lieber, and G. Childs. 1989. Histone gene expression during sea urchin spermatogenesis: an in situ hybridization study. Mol. Reprod. Dev. 1: 219-229.

Rast, J. P., R. A. Cameron, A. J. Poustka, and E. H. Davidson. 2002. Brachyury target genes in the early sea urchin embryo isolated by differential macroarray screening. Dev. Biol. 246: 191-208.

Saotome, K., R. Kamimura, H. Kurokura, and R. Hirano. 2002. Male chromosomes of sea urchin hybrid andromerogones created with cryo-preserved sperm. Zool. Sci. 19: 185-189.

Schuel, H. J., J. W. Kelly, E. R. Berger, and W. L. Wilson. 1974. Sulfated acid mucopolysaccharides in the cortical granules of eggs. Effects of quaternary ammonium salts on fertilization. Exp. Cell Res. 88: 24-30.

Shoguchi, E., T. Kawashima, Y. Satou, M. Hamaguchi, T. Sin-I, Y. Kohara, N. Putnam, D. S. Rokhsar, and N. Satoh. 2006. Chromosomal mapping of 170 BAC clones in the ascidian Ciona intestinalis. Genome Res. 16: 297-303.

Somers, C. E., D. E. Battaglia, and B. M. Shapiro. 1989. Localization and developmental fate of ovopcroxidase and proteoliaisin. two proteins involved in fertilization envelope assembly. Dev. Biol. 131: 226-235.

SUGSC (Sea Urchin Genome Sequencing Consortium). 2006. The genome of the sea urchin, Strongylocentrotus purpuratus. Science 314: 914.

Walker, C. W., L. M. Harrington, M. P. Lesser, and W. R. Fagerberg. 2005. Nutritive phagocyte incubation chambers provide a structural and nutritive microenvironment for germ cells of Strongylocentrotus droebachiensis, the green sea urchin. Biol. Bull. 209: 31-48.

Walker, C. W., T. Unuma, and M. P. Lesser. 2007. Gametogenesis and reproduction of sea urchins. Pp. 11-33 in Edible Sea Urchins: Biology and Ecology. J.M. Lawrence, ed. Elsevier, Amsterdam, The Netherlands.

Wessel, G. M., L. Berg, D. L. Adelson, G. Cannon, and D. R. McClay. 1998. A molecular analysis of hyalin-a substrate for cell adhesion in the hyaline layer of the sea urchin embryo. Dev. Biol. 193: 115-126.

Yamanaka, K., W. Jun-Gang, N. Komagata, A. Suzuki, R. Kuwabara, and R. Hirano. 1989. A method of chromosome observation and karyotype in Pseudocentrotus depressus. Nippon Suisan Gakkaishi 55: 1465.

CELESTE C. ENO, STEFANIE A. BOTTGER *, AND CHARLES W. WALKER[dagger]

Molecular, Cellular and Biomedical Sciences, University of New Hampshire, 46 College Road, Durham, New Hampshire 03824.

Received 22 March 2009; accepted 23 July 2009.

* Current address: Department of Biology. West Chester University, 750 South Church Street, West Chester. PA 19383.

[dagger] To whom correspondence should be addressed. E-mail: cwwalkcr@unh.cdu

Abbreviations: BAC, bacterial artificial chromosomes; BAC-FISH, fluo-rescently labeled bacterial artificial chromosome in situ hybridization; DAPI, 4'-6-diamidino-2-phenylindole; FISH, fluorescent in situ hybridization; FSW, filtered seawater; PABA. p-aminobenzoic acid; SSC buffer. 3.5% NaCl, 0.89% sodium citrate; PI. propidium iodide.
COPYRIGHT 2009 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Eno, Celeste C.; Bottger, Stefanie A.; Walker, Charles W.
Publication:The Biological Bulletin
Article Type:Report
Geographic Code:1USA
Date:Dec 1, 2009
Words:3144
Previous Article:Cryptic species differentiated in Conus ebraeus, a widespread tropical marine gastropod.
Next Article:GYRKPPFNGSIFamide (Gly-SIFamide) modulates aggression in the freshwater prawn Macrobrachium rosenbergii.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |