Printer Friendly

Methanol extract of Antrodia cinnamomea mycelia induces phenotypic and functional differentiation of HL60 into monocyte-like cells via an ERK/CEBP-[beta] signaling pathway.

ARTICLE INFO

Keywords:

Antrodia cinrzamomea

CCAAT/enhancer-binding protein [beta]

CDI4

Differentition

Extracellular signal-regulated kinase

Leukemia

ABSTRACT

Antrodicia cinncirnornea (named as Niu-chang-chih), a well-known Taiwanese folk medicinal mushroom, has a spectrum of biological activities, especially with anti-tumor property. This study was carried out for the first time to examine the potential role and the underlying mechanisms of A. cinnamomea in the differentiation of human leukemia HL6O cells. We found that the methanol extract of liquid cultured rnycelia of A. cinnarnomea (MEMAC) inhibited proliferation and induced G1-phase cell cycle arrest in HL60 cells. MEMAC could induce differentiation of HL6O cells into the monocytic lineage as evaluated by the morphological change, nitroblue tetrazolium reduction assay, non-specific esterase assay, and expression of CD14 and CD1lb surface antigens. In addition, MEMAC activated the extracellular signal-regulated kinase (ERK) pathway and increased CCAAT/enhancer-binding protein [beta] (C/EBP[beta]) expression. Reverse transcriptase polymerase chain reaction analysis showed that MEMAC upregulated the expression of C/EBP[beta] and CD14 mRNA in HL6O cells. DNA affinity precipitation assay and chromatin immunoprecipitation analyses indicated that MEMAC enhanced the direct binding of CIEBP[beta] to its response element located at upstream of the CDI4 promoter. Furthermore, inhibiting ERK pathway activation with PD98059 markedly blocked MEMAC-induced HL6O monocytic differentiation. Consistently, the MEMAC-mediated upregulation of C/EBP[beta] and CD14 was also suppressed by PD98059. These findings demonstrate that MEMAC-induced HL6O cell monocytic differentiation is via the activating ERK signaling pathway, and downstream upregulating the transcription factor C/EBP[beta] and differentiation marker CD14 gene, suggesting that MEMAC might be a potential differentiation-inducing agent for treatment of leukemia.

[c] 2011 Elsevier GmbH. All rights reserved.

Introduction

Acute myeloid leukemia (AML) represents a group of clonal hematopoietic stem cell disorders in which both failure to differentiate and overproliferation in the stem cell compartment result in accumulation of non-functional cells termed myeloblasts. Even though various treatment strategies such as chemotherapy, targeted therapy, allogeneic or autologous stem cell transplantation, and experimental treatment approaches were developed, the management of AML presents significant challenges, still has an unsatisfactory relapse rate (Lengfelder et al. 2005; Lowenberg et al. 1999). Only about one-third of patients who are diagnosed with AML can be cured; disease-free survival is rare in adults. Hence, new drugs with greater efficacy and better tolerability than existing treatments are urgently required for these patients.

The concept of differentiation therapy has been viewed as a promising and revolutionary approach for the treatment of AML and other cancers for forty years ago. Currently, the use of all-trans-retinoic acid (ATRA) and arsenic trioxide (ATO), in combination with chemotherapy is the accepted treatment of acute promyelocytic leukemia (APL, one subtype of AML), presenting a potential paradigm for differentiation therapy in clinical oncology. The differentiation therapy of APL has up-front use of ATRA/ATO plus induction chemotherapy leads to complete remission rates in excess of 93% with these patients achieving 5-year overall survival rates approaching 100% (Wang and Chen 2008). However, the differentiation therapy with ATRA gave the poor outcomes in non-APL AML Although it has been shown that ATRA signaling plays an important role in myetomonocytic differentiation (Glasow et al. 2005) and should be a good target for anti-AML therapy, some key problems limited the use of ATRA in the treatment of AML.

Nature compounds and their derivatives have recently been increasingly received attention by the potential for therapeutic application. Fungi comprise a vast and yet largely untapped source of effective new pharmaceutical products. In particular, and most importantly for modern medicine, they represent an unlimited source of polysaccharides, polyphenols, and terpenes with anti-cardiovascular, anti-viral, antioxidant, hepatoprotective, immune-modulating, and antitumor properties (Ac et al. 2009; Moradali et al. 2007; Zjawiony 2004). A. cinnamomea (named as Niu-chang-chih), a well-known medicinal mushroom in Taiwan, which have been taken orally since ancient times for the prevention or treatment of numerous diseases including liver diseases, food and drug intoxication, diarrhea, abdominal pain, hypertension, itchy skin and cancers. It has been reported that administration of A. cinnamomea markedly prevented ethanol-induced hepatic toxication in rat model (Lu et al. 2007). Both the fruiting bodies and mycelium of A. cinnamomea have potent anti-proliferative activity against various cancers in vitro and in vivo. The fermented culture broth of A. cinnamomea was shown to inhibit NE-KB activation in RAW264.7 cells (Hseu et al. 2005). Previous study demonstrated that methanolic extracts of mycelia ofA. cinnamomea in submerged culture could induce hepatoma HepG2 cells apoptosis via activation of caspase-3 and -8 cascades and regulation of the cell cycle progression (Song et al. 2005). Aqueous extracts of A. cinnamomea were reported that exhibit cytotoxicity against leukemia HL60 cells but not cultured human umbilical vein endothelial cells (Hseu et al. 2002). Therefore, the antitumor effect of A. cinnamomea is a potential area for developing novel pharmaceutical products. However, the underlying molecular mechanisms of the antitumor effects of A. cinnamomea have not yet been fully explored. Whether A. cinnamomea has the ability to induce differentiation of leukemia cells is not yet to be examined.

The cell line HL60, established from a patient with APL (Gallagher et al. 1979), is known to sensitive to the differentiating agents by cell cycle arrest and acquiring some of characteristics of either granulocytes or monocytes depended on the differential stimuli (Reitsma et al. 1983). This cell line has been become one of the important cell models and widely used in the studies of hematopoietic differentiation. This study aimed to understand the effects and mechanisms of methanol extract of liquid cultured mycelia of A. cinnamomea (MEMAC) underlying growth arrest and differentiation in human AML HL60 cell line. We showed for the first time that MEMAC caused the cell cycle arresting in GO/G1 phase and induction of monocytic differentiation in HL60 cells. Moreover, the activation of extracellular signal-regulated kinase (ERK) signaling pathway and up-regulation of CCAAT/enhancer-binding protein [beta] (C/EBP[beta]) play important role in the differentiation induced by MEMAC.

Materials and methods

Strain and culture condition

Antrodia cinnamomea (CCRC 35396), was purchased from the Culture Collection and Research Center (Hsinchu, Taiwan). The culture was maintained on malt extract agar of Blakeslee's formula and transferred to a fresh agar plate every month, grown at 25-28 -C, Twenty-five-day-old seeding mycelium of A. cinnamomea on the surface of medium was cut into small pieces (approximately 1 cm in diameter) colony before being transferred to 200 ml of modified malt extract broth in 600-ml vessels, cultured at 28 [degrees]C under 130 rpm shaking in the dark for 12 days, after homogenization, the cultured mycelial suspension was used as an inoculum. Mycelia (10 ml) was inoculated into 200 ml of modified malt extract broth in 600-ml vessels, and then cultured at 25-28 [degrees]C for 60 days by shaking at 130 rpm to obtain a mucilaginous medium containing the mycelia.

Preparation for the methanolic extracts of mycelia from liquid culture of A. cinnamomea (MEMAC)

After 60 days of the incubation, the mycelia were collected by centrifugation (4 [degrees]C, 8000 rpm for 20 min) and then washed with distilled water. Finally, the mycelia were freeze-dried to a powder form. Powdered mycelia (500g) were soaked in 100% methanol (51) for 3 days. The sample was filtered with filter paper (Whatman No. 1) while the residue was further extracted under the same condition twice. The filtrates collected from three separate extractions were combined and evaporated to dryness under vacuum. The methanolic extracts of mycelia was dissolved in dimethyl sulfoxide (DMSO) and stored at-20 [degrees]C before analysis for leukemia differentiation properties.

HPLC chemical fingerprint analysis and phytochemical analysis

The HPLC fingerprint of MEMAC fraction (stock solution 2.5 mg/ml) was carried out using a Shimadzu instrument equipped with a Shimadzu 10A controller and a PDA UV-visible absorbance detector. Column: C-18 reverse phase 250 mm x 4.6 mm (i.d.); mobile phase: A= [H.sub.2]0 and B = acetonitrile (ACN); gradient: 0-25 min 90-10% A; 25-45 min 10% A; detection: 280 nm, flow rate: 1 ml/min; run time 45 min, MEMAC sample 20 [micro]l. The chemical constituents of MEMAC were screened using chemical methods and thin-layer chromatography (TLC), according to the methodology described as elsewhere (Anwarul et al. 2006).

Cell culture

HL60, a human promyelocytic leukemia cell line was purchased by ATCC (American Type Culture Collection, Manassas, VA, USA). The cell line was maintained in RPMI 1640 medium supplemented with 10% heat inactivated fetal calf serum, 1% L-glutamine, penicillin (100 units/ml) and streptomycin (100 [micro]g/m1) at 37 [degrees]C in a humidified atmosphere containing 5% [CO.sub.2]. For all experiments, the cells were suspended in fresh medium containing various concentrations of MEMAC or the equivalent volume of DMSO as a vehicle control.

Isolation of the peripheral blood mononuclear cells (PBMC)from patient and healthy volunteer

The specimen of peripheral blood from a patient with acute myeloid leukemia FAB classification M2 was obtained following the patient's informed consent according to the 1RB (Institutional Review Board) protocol. Peripheral blood obtained from the patient and healthy volunteer were prethluted with phosphate buffered saline (PBS) by 1:1 ratio. Volume of Ficoll (Sigma, St. Louis, MO) equal to that of the diluted blood was added to a sterilized centrifuge tube, and then the blood was careful layered onto the top of Ficoll. The blood Ficoll samples were then centrifuged at 400 xg for 30 min at room temperature. After centrifugation, the opaque interface (mononuclear cells) were transferred into a clean centrifuge tube and washed for three times with PBS. The cells were then cultured for test.

Cell viability assay

Cell proliferation and viability were determined by the trypan blue dye exclusion test (Renzi et al. 1993). HL60 cells were seeded in 24-well culture plates at a concentration of 2 x [10.sup.5] per ml and incubated with various concentrations of MEMAC (0, 25, 50, 75, 100 [micro]g/ml) for indicated time point. The number of viable cells that excluded the trypan blue dye was counted using a hemocytometer.

Flow cytometry analysis

To analyze the expression of cell surface markers, cells (2 x [10.sup.5]) were treated with or without varying concentrations of MEMAC for indicated time period. The cells were washed with PBS and incubated simultaneously with phycoeiythrin (PE)-conjugated anti-human CD1lb or fluorescein isothiocyanate (FITC)-conjugated anti-human CD14 monoclonal antibodies (BD Bioscience in San Jose, CA). Negative-control staining was performed via the staining of the cells with mouse IgG1 and IgG2a (BD Bioscience), and then incubation at 4 C for 20 min. Quantitative immunofluorescence measurements were conducted using a FACSCalibur (Becton Dickinson, San Jose, CA, USA) and analyzed with CELLQuest[TM] soft-ware. One-parameter fluorescence histograms were generated via the analysis of at least 1 x [10.sup.4] cells.

Morphologic changes

The morphology of HL60 cells was determined by Wright-Giemsa method (Jing et al. 1999). After 5 days of induction, the cells were harvested and cytocentrifuged onto a microscope slide using a cytospin (Shandon Southern Instrument Inc.), and the slides were stained with Giemsa staining solution for 20 min and rinsed in deionized water, air-dried, and observed under a light microscope. The stained cells were assessed for size, regularity of the cell margin, and morphological characteristics of the nuclei. Differential counts were performed under microscopy among a minimum of 200 cells.

Nitro blue tetrazolium (NBT) reduction assay

The ability of NBT (Sigma-Aldrich, St. Louis, MO, USA) reduction was evaluated as described elsewhere (Kawaii et al. 1999). Cells (2 x [10.sup.5]cell/ml) were treated without or with MEMAC for 72h, and then harvested via centrifugation and incubated with an equal volume of 1% NBT dissolved in PBS, containing 200ng/ml of freshly diluted TPA (Sigma-Aldrich, St. Louis, MO, USA) at 37 C for 30 min in darkness. The reaction was stopped by PBS washed twice. NBT-positive cells containing blue-black nitroblue diformazan deposits were identified using a light microscopy. The percentage of positive cells was determined from a total of 200 cells in each sample.

Non-specific esterase (NSE) assay

For the assessment of non-specific esterase (NSE), also known as monocyte specific esterase (MSE), after 72 h of incubation, cells were put on cytospin slides and fixed in a formaldehyde-acetone mixture buffer, and then stained for 45 min at room temperature with the following solution: 8.9 ml of 67 mM phosphate buffer (pH 7.6), 0.6 ml of hexazotized pararosaniline, 1 mg/m1 alpha-naphtyl acetate, and 0.5 ml ethylene glycol monomethyl ether. NSE-positive cells were stained red/brown color under light microscope were assessed. The percentage of NSE-positive cells was determined by counting 200 total cells in triplicate using a light microscope.

Western blotting analysis

After treatment of HL60 cells with MEMAC for indicated time period, the cells were harvested and washed twice with ice-cold 1 x PBS, cell pellets were resuspended in extraction lysis buffer (50 mM HEPES, pH 7.0, 250 mM NaC1, 5 mM EDTA, 0.1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 5 mM NaF, 5 mg/m1 each of leupeptin and aprotinin) and incubated for 20 min at 4 C. Cell debris was removed by microcentrifugation, followed by quick freezing of the supernatants. The protein concentration was determined by using the Bio-Rad protein assay reagent accord-ing to the manufacturer's instruction. Equal amount of total protein were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (PerkinElmer Life Sciences, Inc., Boston, MA, USA). The membranes were blocked in 5% non-fat milk for 1 h. Then membranes were subsequently probed with monoclonal anti-MEK, phospho-MEK, ERK1/2 and phospho-ERK antibody (Santa Cruz Biochemicals, Santa Cruz, CA, USA), phospho-C/EBP and CiEBP anti-body (Cell Signaling) overnight at 4 [degrees]C. The blots were washed with buffer three times and incubated with horseradish peroxidase-conjugated rabbit anti-mouse or anti-rabbit IgG (PerkinElmer Life Sciences, Inc., Boston, MA, USA) for 1 h at room temperature. Immunoreactive bands were visualized using the ECL-Plus detection system (PerkinElmer Life Sciences, Inc., Boston, MA, USA).

Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was extracted using RNA-Bee[TM] RNA isolation kit (TEL-TEST, Friendswood, TX). Two micrograms RNA was annealed with random primers at 70 [degrees]C for 10 min. The cDNA was synthesized using a lst-STRAND[TM] cDNA Synthesis Kit (Clontech) in 20 p,1 of solution containing 20 mM Tris-HC1 (pH 8.4), 50 mM KCL, 10 mM dithiothreitol, 500 mM dNTP, and 200 units of reverse transcriptase, at 42 [degrees]C for 50min. For PCR amplification, the reaction mixture was prepared on ice and contained 20 mM Tris-HC1 (pH 8.4), 50 mM KC1, and 2 mM Mg[Cl.sub.2], 1 unit of Taq polymerase, 200 [micro]M of each dNTP, 100 pmol of both forward and reverse primers, and 2.5 [micro]g of cDNA product. The reaction conditions were denaturing cDNA for 7 min at 95 [degrees]C and submitted to multiple cycles of amplification (1 cycle: 95 [degrees]C, 45s; 55 [degrees]C, 45s; 72 [degrees]C, 45s) followed by a final extension of 7 min at 72 [degrees]C in a Bio-Rad icycler (Bio-Rad). For each combination of primers, the kinetics of PCR amplification was studied. The number of cycles corresponding to the plateau was determined. PCR was performed at an exponential range, the primers were as follows: (1) C/EBP-[beta]: forward primer (5'-GTTCTTGA CGTTCTTCGGCCG-3'), reverse primer (5'-TGGACAAGCACAGCGACGAGT-3'); (2) CD14: forward primer (5'-CACAGGACTTGCACTTTCCA-3'), reverse primer (5'-CTGTTGCAGCTGAGATCGAG-3'); (3) GAPDH: forward primer (5'-GCCAAAAGGGTCATCATCTC-3'), reverse primer (5'-GGCCATCCACAGTCTTCT-3'). GAPDH gene was analyzed as an internal control. PCR products were electrophoresed through an 1% agarose gel electrophoresis and visualized by ethidium bromide staining and UV irradiation.

DNA affinity precipitation assay (DAPA)

DNA affinity precipitation assay was performed as previously described (Singh et al. 2002). Briefly, cells were plated in 10-cm dishes (2 x [10.sup.5] cells), and were treated with various doses of MEMAC for 24 h. Nuclear extracts from different treatments were precleared with streptavidin-agarose beads for 1 h, with gentle rotation at 4 [degrees]C. The DNA motif probes were prepared by annealing a biotinylated sense oligonucleotide (for C/EBP[beta], 5'-[Bio]GCTAAATTAGTTCTGCAATT TAC-3') with the respective unbiotinylated complementary oligonucleotide (for C/EBP[beta], 5'-GTAAATTGCAAGAACTAATTT AGC-3'). After centrifugation, the supernatants were incubated with biotinylated probe in binding buffer [12% glycerol, 12 mM Hepes (pH 7.9), 150 mM KCI, 1 mM EDTA, 1 mM DTT, and 10[micro]g of poly(dl-dC)] at 4 [degrees]C for 4h. Streptavidin-agarose beads were added, and incubated for 1 h with gentle rotation at 4-C. The precipitated DNA-protein complexes were then washed three times with binding buffer, resolved on SDS-PAGE, and detected by Western blot using anti-C/EBP[beta] specific antibody.

Chromatin immunoprecipitation (ChIP) assay

Isolated chromatin was cross-linked, sonicated, and then immunoprecipitated with C/EBP[beta] antibody or normal rabbit IgG2. Protein-A agarose beads with salmon sperm DNA were added, and the chromatin-bead complexes were washed with low salt, high salt, LiC1, and Tris-EDTA buffers. The protein-DNA complexes were eluted and decross-linked by heating at 65 [degrees]C overnight; the DNA fragments were then purified and analyzed by PCR. The primers for the core C/EBP[beta] promoter region were as follows: forward, 5'-CATTTTGTTTTGTTTTCTGTT-3' and reverse, 5'-CCACTGTGCCTGGCAGTA-3'. The PCR products were analyzed by gel electrophoresis.

Statistical analysis

The data were expressed as the mean [+ or -]S.D. of three replicates and repeated three times (n = 9). Figures are representative of three separate experiments with similar patterns. A one-way analysis of variance (ANOVA) was applied to the data. Assessments of the statistical difference between the mean values were performed using a least difference (LSD) test. Statistical significance is expressed as * p < 0.05, **p < 0.01, and ***p < 0.001, using the SAS program (SAS Institute, Inc., USA).

Results

Phytochemistry screening

The HPLC fingerprint chromatogram was established for the quality control of MEMAC (Fig. 1A) which showed one major (peak 11 ) and sixteen minor peaks. The major peak (peak 11 ) and one of the minor peaks (peak 8) were identified as camphorataanhyclride A (retention time = 27.13 min, peak 11) and camphorataimide B (retention time = 25.21 min, peak 8) (Fig. 1B). The phytochemical screening results of the MEMAC showed the presence of different types of active constituents like terpenoids, sterols, triterpenes, maleic and succinic acid derivatives in MEMAC.

Effect of MEMAC on the growth of HL60 cells

HL60 cells were treated with various concentrations of MEMAC for the indicated time points, cell viability was determined by the trypan blue dye exclusion test. As shown in Fig. 2A, the growth of HL60 cells was significantly inhibited by MEMAC at 50 [micro]g/ml, the cell proliferation was almost completely inhibited after 75 [micro]g/m1 MEMAC incubation; however, treatment with 100 [micro]g/ml MEMAC resulted in significantly cytotoxic effect in HL60 cells (Fig. 2A). Next, to test the cytotoxic effect of MEMAC on normal peripheral blood mononuclear cells, the cells were incubated with 0, 50, 75 and 100 [micro]g/m1 MEMAC for the indicated time periods. Fig. 2B shows that no cytotoxic effect was observed under all the tested conditions. Data from flow cytometry revealed that MEMAC induced G1 cell cycle arrest of HL60 cells in a dose-and time-dependent manner (Fig. 2C). The G1 -phase accumulation was accompanied by a corresponding reduction in the percentages of cells in the S phase. These results indicated that the observed growth inhibitory effect of MEMAC in HL60 cells might be due to the cell cycle G 1 -phase arrest. In addition, time-dependent increase in sub-G1 population was observed after 100 [micro]g/m1 MEMAC administration, indicating that higher doses of MEMAC induced apoptotic cell death.

MEMAC induces monocytic differentiation in HL60 cells

To investigate whether MEMAC was able to modulate the morphology of AML cells, cytospin preparations of treated cells were stained by Wright-Giemsa solution. As shown in Fig. 3A, Giemsa-stained undifferentiated control HL60 cells were predominantly promyelocytes with round and regular cell margins, and large nuclei, indicating that the cells were highly active in DNA synthesis and were rapidly proliferating. However, treatment with MEMAC resulted in the decreasing of cell size and the increased cytoplasm to nuclear ratio, revealing that these cells were less active with regard to DNA synthesis. Some of the cells evidenced nuclear indentation or horseshoe shaped nuclei, which is a sign of cell differentiation into a monocytic lineage (Fig. 3A).

Next, NBT-reducing activity and non-specific esterase (NSE) activity, the typical markers of myelomonocytic differentiation (Newburger et al. 1984; Yam et al. 1971), were examined. After 72 h of treatment with 75 [micro]g/m1 MEMAC, approximately 61.6% of the HL60 cells were positive for NBT reduction (p <0.001) (Fig. 3B). Additionally, treatment of HL60 cells with 75 [micro]g/m1 MEMAC for 72 h increased NSE activity compared with DMSO-treated controls from 8.3% positive to 85% (p <0.001) (Fig. 3C).

We then evaluated the expression of cell-surface markers associated with myeloid maturation, CD14 and CD11b. Incubation of HL60 cells with MEMAC showed a dose-dependent increase in expression of CD14 by flow cytometric analysis, whereas only a slight increase in CD11 b was observed (Fig. 3D). After treatment of HL60 cells with 75 [micro]g/m1 MEMAC for 72 h, the proportion of cells expressing the CD14 and CD1lb antigen increased from 9 [+ or -]0.9 to 87 [+ or -]0.6% (p < 0.001) and 4 + 0.7 to 15 [+ or -]0.8% (p <0.001), respectively (Fig. 3D).

Involvement of MEK/ERK pathway and C/EBP[beta] transcription factor in MEMAC-induced differentiation of HL60 cells

Increased expression and/or activation of several intracellular signaling pathways is crucial for monocytic differentiation (Hughes et al. 2010), these include protein kinase C isoforms (Shimizu et al. 2002), the phosphatidylinositol 3-kinase-Akt pathway (Hmama et al. 1999: Marcinkowska and Kutner 2002; Zhang et al. 2006), the extracellular signal-regulated kinase (ERIC), p38 and c-Jun-N-terminal kinase (Marcinkowska etal. 2006; Studzinski et al. 2006: Wang et al. 2003). To examine the underlying mechanisms responsible for MEMAC-induced differentiation, HL60 cells were treated with various concentrations of MEMAC for 48 h, the levels of total and phosphorylated MEK (p-MEK) and ERIC (p-ERIC) were determined by Western blot analysis. As shown in Fig. 4A, treatment with MEMAC increased the levels of p-MEK and p-ERK whereas the levels of total MEI< and ERIC did not alter upon MEMAC treat-ment. However, the levels of total and phosphorylated p38 and JNK were not affected by MEMAC (data not shown).

Previous reports have indicated that CCAAT enhancer binding protein beta (C/EBP[beta]) is important for the function of macrophages and for differentiation of myeloid leukemic cells along the monocytic lineage (Ramji and Foka 2002; Studzinski et al. 2005), it seems that the expression of C/EBP[beta] correlated with the degree of monocytic differentiation, and the expression appeared to be under the control of MAPIK pathways (Studzinski et al. 2005). We therefore examine the function and expression of C/EBP[beta] in MEMAC-treated H1,60 cells. Western blot analysis showed that the expression of both total and phosphorylatecl C/EBP[beta] was markedly increased following exposure at 75 [micro]g/ml MEMAC (Fig. 4A). Next, the expressed levels of C/EBP[beta] and CD14 mRNA were evaluated by RT-PCR. Consistent with increased protein expression, the levels of C/EBP[beta] and CD14 mRNA were significantly increased in MEMAC-treated HL60 cells (Fig. 4B).

Notably, a potential C/EBP[beta] binding site is located in the upstream region of the CD14 promoter (Studzinski et al. 2005). To investigate whether the C/EBP[beta] activation involvement in the regulation of CD14 expression in differentiated HL60 cells, a double-stranded oligonucleotide containing the C/EBP[beta] recognized sequence was used in a DNA affinity precipitation assay (DAPA). As shown in Fig. 4C, C/EBP[beta] binding was undetectable in nuclear lysates from untreated cells. However, the binding affinity of C/EBP[beta] to the DNA oligo probe was significantly enhanced in response to MEMAC. To verify that C/EBP[beta] is recruited within the C/EBP[beta] responsive region of human CD14 promoter in vivo, ChIP assay was performed using anti-C/EBP[beta] antibody. C/EBP[beta] occupancy of the consensus C/EBP[beta] binding region of the CD14 promoter significantly increased following MEMAC treatment in HL60 cells (Fig. 40).

The ERK1/2 pathway is upstream of the expression of C/EBP[beta] and CD 14, as well as HL60 differentiation

It has been reported that activation of ERK 1/2 pathway plays an important role in monocytic differentiation of HL60 cells (Wang and Studzinski 2001). To define whether MEMAC-mediated ERK 1/2 activation involved in HL60 monocytic differentiation, a specific pharmacological inhibitor of ERIC pathway 2-(2V-amino-3V-methoxypheny1)-oxanaphthalen-4-one (PD98059) was used. The results showed that the inhibition of the ERK 1/2 pathway by PD98059 significantly suppressed the MEMAC-induced monocytic differentiation and the expression of CD14 (Fig. 5A) and C/EBP[beta] (Fig. 5B) in HL60 cells. Moreover, PD98059 also diminished the MEMAC-induced up-regulation of C/EBP[beta] and CD14 mRNA (Fig. 5C). These results demonstrate that the expression of C/EBP[beta] and CD14 were downstream targets controlled by ERK 1/2 pathway in MEMAC-treated HL60 cells. Effects of MEMAC on the differentiation of leukemia cells in primary culture

To further test whether our cell line model findings might be reproduced in clinical cases of AML, we isolated mononuclear leukemia cells from the peripheral blood of a patient with AML (M2 subtype). Isolated mononuclear leukemic cells were incubated with vary concentrations of MEMAC (0, 25, 50, and 75 [micro]g/m1) for 48 h, and then cells were judged for differentiation by morphological examination and surface antigen (CD11 b and CD14) expression. As depicted in Fig. 6A, an increment of cells with monocytic features following MEMAC treatment. Data from flow cytometric analysis also confirmed that MEMAC treatment showed a dose-dependent induction of both surface CD14 and CD11b antigens (Fig. 6B) in the primary myeloid leukemic blasts. These observations indicate that MEMAC could induce leukemic cell differentiation toward monocyte-like cells ex vivo.

Discussion

Despite advances in understanding of the pathophysiology of AML, cure rates for patients with AML remain low. The basic therapeutic approach to patients with AML has changed little over the past twenty years (Stone 2007). Hence, new drugs with a higher therapeutic efficacy are urgently needed for these patients. Mushrooms comprise a vast and yet largely untapped source of powerful new pharmaceutical products. In particular, and most importantly for modern medicine, they represent an unlimited source of bioactive compounds with antitumor property (Borchers et al. 2004). Among them, A. cinnamomea is a unique medicinal mushroom of Taiwan, which has been taken orally since ancient times for protection of diverse diseases, including cancers (Geethangili and Tzeng 2009). In an effort to translate this Chinese traditional medicine into Western-accepted cancer therapies, scientists have demonstrated that the extracts from both fruit-bodies and mycelium of A. cinnamomea have potent anti-proliferative and apoptotic activities against various cancers in vitro and in vivo. For example, the CH[Cl.sub.3] extract from fruiting bodies of A. cinnamomea showed cytotoxic activity against human lymphoma Jurkat, hepatoma HepG2, Colon 205 and breast cancer MCF 7 cell lines (Rao etal. 2007). The ethylacetate extract from fruiting bodies of A. cinnamomea (EAC) induces apoptosis by directly targeting mitochondria' apoptotic pathway through regulation of BcI-2 family proteins expression and activation of caspase-9 in human liver cancer HepG2 and PLC/PRF/5 cell lines (Hsu et al. 2005). EAC also caused a calcium-calpain-dependent mitochondrial apoptotic pathway in human liver cancer Hep3B cells (Kuo et al. 2006). A. cinnamomea solid-state cultured mycelium showed adjuvant anti-proliferative effects with cisplatin and mitomycin in hepatoma C3A and PLC/PRF/5 cells and on xenografted cells in tumor implanted nude mice (Chang et al. 2008). Chang et al. (2008) reported that ethanol extract from fruiting bodies of A. cinnamomea induced human premyelocytic leukemia HL 60 cells apoptosis via histone hypoacetylation by upregulation of histone deacetyltransferase 1 and downregulation of histone acetyltransferase activity. In addition, aqueous extract from submerged cultivation mycelium of A. cinnamomea induces apoptosis in human myeloid leukemia HL60 cells, this event was accompanied by the reduction of Bc1-2 expression and activation of caspase-3 (Hseu et al. 2004). In this study, we report for the first time that methanol extract of liquid cultured mycelia of A. cinnamomea (MEMAC) induced G0/G1 cell cycle arrest and differentiation in human leukemia cells. Four assays can be demonstrate, CD14 cell surface expression, morphology changes, NBT reduction and nonspecific esterase activity correlate with each other, and suggest the monocytic lineage of differentiation. Morphologic analysis exhib-ited a horseshoe-shaped nucleus in MEMAC-treated HL60 cells (Fig. 3A). Moreover, MEMAC-induced a significant dose-dependent increase in the number of NBT reduction and [alpha]-naphthyl acetate esterase positive cells (Fig. 3B and C). Additionally, MEMAC-treated HL60 cells reacted strongly with antibody against CD14 and CD11 b monocytic surface markers (Fig. 3D). Collectively, our experimental data suggest that MEMAC-stimulated HL60 cell differentiation mostly leads to monocytic lineage. Importantly, exposure of primary leukemia cells (obtained from an AML subtype M2 patient) to MEMAC, also showed a strong differentiation effect (Fig. 6). Our findings reveal that MEMAC has potential to be developed as a differentiation inducing therapeutics for AML patients.

Induction of mortality by terminal differentiation represents an alternative approach to the cytodestruction of cancer cells. In this respect, retinoid acids are well-known inducers of the granulocytic differentiation of primary acute promyelocytic leukemia blasts and leukemic cell lines, apparently acting through transcriptional regulation of critical genes (Chambon 1994). The CCAAT enhancer binding proteins (C/EBPs) are a family of basic leucine zipper transcription factors which participate in the differentiation of several cell types including myeloid cells (Morosetti et al. 1997; Natsuka et al. 1992; Ramji and Foka 2002; Scott et al. 1992). In patients with a dysfunctional C/EBP pathway, targeted therapies may overcome the block in differentiation, and in combination with conventional chemotherapy, may lead to complete eradication of the malignant clone (Koschmieder et al. 2009). Out of the six members of C/EBP family of transcription factors, C/EBP[alpha] and C/EBP[epsilon] are known to be critical for normal granulocytic differentiation (Gery et al. 2005; Pabst et al. 2001; Porse et al. 2005; Tenen et al. 1997), while C/EBP[beta] is particularly important for macrophage function (Lekstrom-Himes and Xanthopoulos 1998; Poll 1998; Ramji and Foka 2002; Yamanaka et al. 1998). It is well documented that CD14 is a monocyte/macrophage differentiation marker and is strongly up-regulated during monocytic cell differentiation (Shimizu et al. 2002). It has been reported that C/EBP is an important transcription factor for CD14 promoter activity and that the C/EBP binding site is crucial for the synergistic signaling from 1,25-dihydroxyvitamin D3 and TGF-( to induce monocyte differentiation (Pan et al. 1999). A previous study demonstrates that C/EBP[beta] is required for 1,25-dihydroxyvitamin D3-induced monocytic differentiation in human leukemia cell lines (Ji and Studzinski 2004). In the current study, MEMAC-induced differentiation of HL60 cells, the function and expression of C/EBP[beta] were significantly increased in parallel. However, the expression of C/EBP[alpha] was not significantly affected by MEMAC (data not shown). Moreover, in MEMAC-treated 1-IL60 cells, the increased C/EBP[beta] was functional and capable to interact with the C/EBP[beta] response element (C/EBPORE) within the CD14 promoter in vivo as evidenced by DAPA and ChIP analysis (Fig. 4C and D) showing that CJEBP13 occupancy of the C/EBPPRE containing pro-moter region is concomitant with the upregulation of CD14 gene (Fig. 4B). These results indicate that CD14 might be transcriptionally regulated by C/EBP[beta] in MEMAC-treated HL60 cells. Similarly, Duprez et al. demonstrate that C/EBP[beta] is increased and required in ATRA-induced differentiation of acute promyelocytic leukemia cells (Duprez et al. 2003). Additional studies aimed at the upregu-lation of C/EBP[beta] upon MEMAC treatment in leukemia cells will be required in order to understand the mechanism of activation.

The mechanism by which cells receive and transmit differentiation signals is complex and involves the coordinated action of many different signaling molecules. Growing evidence indicates that the activation of the MAPK signaling pathway is associated with hematopoietic cell differentiation (Miranda et al. 2002; Wang et al. 2000; Yen et al. 1998). Previous reports demonstrate the involvement of the MEK/ERK pathway in ATRA-, PMA-, 1,25-dihydroxyviatrnin D3-induced myeloid differentiation (Herrera et al. 1998; Kim et al. 2009; Miranda et al. 2002; Park et al. 2008; Wang et al. 2000; Yen et al. 1998). Additionally, another study has indicated that 1,25-dihydroxyviatmin D3-induced MEK/ERK activation play a crucial role in upregulation of C/EBP[beta] during myeloid differentiation (Studzinski et al. 2005). In this study, we showed that exposure of HL60 cells to MEMAC resulted in a marked activation of MEN/ERIC pathway, the levels of p-MEK and p-ERK were significant increased (Fig. 4A). Interestingly, while inhibition of ERIC pathway (by pharmacological inhibitor, PD98059) also inhibited MEMAC-induced monocytic differentiation and that the expression of C/EBP[beta] and CD14 was also reduced in parallel. These data explain that inhibition of p-MEK and p-ERK prior to the induction of monocytic differentiation could block the expression of not only C/EBP[beta] (a transcription factor of monocytic differentiation) but also the CD14 (a specific marker of monocytic differentiation), indicating the dependence of C/EBP[beta] and CD14 expression on the MEK/ERK pathway. Consistently, several reports show that inhibition of MEKJERK activation by P098059 effectively reduced the differentiation of H1.60 cells (Meshkini and Yazdanparast 2008; Studzinski et al. 2005; Traore et al. 2005). Besides, our data reveal that approximately 35% of the MEMAC-treated HL60 still differentiated into monocyte in the presence of PD98059, suggesting that other signaling pathways may also require for MEMAC-elicited differentiation in HL60 cells.

Past several years, over 78 compounds have been isolated and identified form Antrodia cinnamomea, consisting of zhankuic acids, terpenoids, triterpenes, benzenoids, lignans, benzoquinone derivatives, succinic and maleic derivatives, and polysaccharides (Geethangili and Tzeng 2009). Our pbytochemical screening showed that MEMAC contain the ingredients: terpenoids, sterols, triterpenes, maleic and succinic acid derivatives, Accumulating evidence indicates that terpenoids and triterpenes possess anticancer activity (Reddy and Couvreur 2009; Laszczyk 2009; Lucas et al. 2010), which may partly explain the anti-AML activity of MEMAC. Recently, we isolated and identified two pure compounds, camphorataanhydride A and camphorataimide B (which belong to maleic and succinic acid derivatives) from MEMAC. However, the pharmacological properties, especially anti-cancer activity of camphorataanhydride A and camphorataimide B are limited eval-uated due to the difficulty of production of these compounds. A previous report demonstrates that both camphorataanhydride A and camphorataimide B exhibit significantly cytotoxic activity against LLC tumor cells (Nakamura et al. 2004). Whether MEMAC-mediated anti-AML activity attributes from camphorataanhydride A and camphorataimide B remains to be addressed. Besides, additional studies are necessary to identify the possible correlation between activities and chemical composition of MEMAC to ensure the appropriate medicinal use of this medicinal mushroom.

Conclusion

In the present study, our findings propose a underlying mechanism by which methanol extract of liquid cultured mycelia of A. cinnamomea (MEMAC) induces functional monocytic differentiation in human myeloid leukemia cells through an ERK-C/EBP[beta] signaling pathway. MEMAC activates ERIC, resulting in upregulation and activation of C/ELP[beta], and consequently leading to increase of CD14 expression as well as monocytic differentiation in myeloid leukemia HL60 cells (Fig. 7). These results suggest MEMAC may have useful potential for differentiation therapy of leukemic diseases. However, the phytochemical studies together with pharmacological and toxicological investigations are essential for complete understanding of the medicinal application.

Acknowledgements

This work was supported in part by grants from the Taichung Veterans General Hospital (TCVGH997319D and TGHUST98-G7-3) and the National Science Council (Taiwan) (NSC99-3112-B-075A-001) to Dr. Shih-Lan Hsu.

Abbreviations: ERK, extracellular signal-regulated kinase: C/EBP[beta], CCAAT/enhancer-binding protein [beta]; AML, acute myeloid leukemia; ATRA, all-trans-retinoic acid; APL., acute promyelocytic leukemia; ATO, arsenic trioxide; PBMC, peripheral blood mononuclear cells; NBT, nitroblue tetrazolium; NF-KB, nuclear factor kappa-light-chainenhancer of activated B cells; TPA, 12-O-tetradecanoylphorbol 13-acetate; PMA, phorbol-12-myristate-13-acetate; DMSO, dimethyl sulfoxide; NSE, non-specific esterase (NSE); MSE, monocyte specific esterase; CD14, cluster of differentiation 14; CD11 b, cluster of differentiation 11b; MEK, mitogen activated protein kinase kinase; C/EBPORE, C/EBP[beta] responding element: DAPA, DNA affinity precipitation assay; ChIP, chromatin immunoprecipitation; RT-PCR, reverse transcriptase polymerase chain reaction.

* Corresponding author.

** Corresponding author at: Department of Education & Research, Taichung Veterans General Hospital, No. 160, Section 3, Chung-Gang Road, Taichung 40705, Taiwan.

Tel.: +88642359 2525x4037;

fax: +8864 2359 2705.

E-maii address: h2326@vghtc.gov.tw (S.-L. Hsu).

0944-711 3/S - see front matter [c] 2011 Elsevier GmbH. All rights reserved.

doi:10.1016/j.phymed.2011.11.003

References

Amami, H.G., Muhammad, N.G., Peter, J.H., Qaiser, J., Syed, DC, Maliha, J., Sheikh. A.S., 2006. Studies on the hypotensive, cardio-suppressant, vasodilator and antiplatelet activities of betel nut crude extract and its constituents. hit. J. Pharmacol. 2, 33-41.

Ao, ZH., Xu, Z.H., Lu, Z.M., Xu, N.Y., Zhang, X.M., Dou, W.F., 2009. Niuchangchih (Antrodia camphorata) and its potential in treating liver diseases. J. Ethnopharmacol. 121, 194-212.

Borchers, A., Keen, C., Gershwin, M., 2004. Mushrooms, tumors, and immunity: an update. Exp. Biol. Med. (Maywood, NJ) 229, 393-406.

Chambon, P., 1994. The retinoid signaling pathway: molecular and genetic analyses. Semin. Cell Biol. 5, 115-125.

Chang, C.Y., Huang, Z.N., Yu, H.H., Chang, L.H.. Li, S.L., Chen, Y.P., Lee, ICY., Chuu, J.J., 2008. The adjuvant effects of Antrodia camphorata extracts combined with antitumor agents on m ultid rug resistant human hepatoma cells. J. Ethnopharmacol. 118,387-395.

Duprez, E., Wagner, IC, Koch, Ii., Tenen, D.G., 2003. C/EBPbeta: a major PML-RARAresponsive gene in retinoic acid-induced differentiation of APL cells. EMBO J. 22, 5806-5816.

Gallagher, R., Collins, S., Trujillo, J., McCredie, IC, Ahearn, M., Tsai, S., Metzgar, R., Aulakh, G., Ting, R., Ruscetti, F., Gallo, R., 1979. Characterization of the continuous, differentiating myeloid cell line (HL-60) from a patient with acute promyelocytic leukemia. Blood 54, 713-733.

Geethangili, M., Tzeng, Y., 2009. Review of pharmacological effects of Antrodia camphorata and its bioactive compounds. Evic1.-Based Complement. Alternat. Med.

Gery, S., Gombart, A.F., Vi, W.S., Koerner, C., Hofmann, W.K., Koerner, H.P., 2005. Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia. Blood 106, 2827-2836.

Glasow, A., Prodromou, N., Ku, K., von Lindero. M., Zelent, A., 2005. Retinoids and myelomonocytic growth factors cooperatively activate RARA and induce human myeloid leukemia cell differentiation via MAP kinase pathways. Blood 105, 341-349.

Herrera, R., Hubbell, S., Decker, S., Petruzzelli, L., 1998. A role for the MEK/MAPK pathway in PMA-induced cell cycle arrest: modulation of megakaryocytic differentiation of K562 cells. Exp. Cell Res. 238,407-414.

Hmama, Z., Mandan, D, Sly, L, Knutson, K.L., Herrera-Velit, P., Reiner, N.E., 1999. I alpha, 25-d i hydroxyvitamin D(3)-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signaling complex. J. Exp. Med. 190, 1583-1594.

Hseu, Y.C., Chang, Wk., Hseu, Y.T., Lee, C.Y., Yech, Y.J., Chen, P.C., Chen, J.Y., Yang, HI, 2002. Protection of oxidative damage by aqueous extract from An trodia camphorata mycelia in normal human erythrocytes. Life Sci. 71, 469-482.

Hseu. Y.C., Wu, FN., Wu, J.J., Chen, J.Y., Chang, 'W.11., Lu, F.J., Lal, Y.C., Yang, ELL, 2005. Anti-inflammatory potential of An trodia camphorata through inhibition of iNOS. COX-2 and cytokines via the NF-kappaB pathway. Int. Immunopharmacol. 5, 1914-1925.

Hseu, Y.C., Yang, H.L, Lai, Y.C., Lin, J.G., Chen, G.W., Chang, Y.H., 2004. Induction of apoptosis by Antrodia cam phorata in human premyelocytic leukemia HL-60 cells. Nutr. Cancer 48, 189-197.

Hsu, Y.L., Kuo, Y.C., Kuo, Pt, Ng, L.T., Kuo, Y.H., Lin, C.C., 2005, Apoptotic effects of extract from Antrodia camphorata fruiting bodies in human hepatocellular carcinoma cell lines. Cancer Lett. 221, 77-89.

Hughes, p.J., Marcinkowska, E, Gocek, E., Studzinski, G.P., Brown, G., 2010. Vitamin D3-driven signals for myeloid cell differentiation-implications for differentiation therapy. Leuk. Res. 34, 553-565.

Ji, Y., Studzinski, G.P., 2004. Retinoblastoma protein and CCAAT/enhancer-binding protein beta are required for 1,25-dihydroxyvitamin D3-induced monocytic differentiation of HL60 cells. Cancer Res. 64, 370-377.

Jing, Y., Nakajo, S., Xia, L. Nakaya, K., Fang, Q., Waxman, S., Han, R., 1999. Boswellic acid acetate induces differentiation and apoptosis in leukemia cell lines. Leuk. Res. 23, 43-50.

Kawaii, S., Tomono, Y., Katase, E., Ogawa, IC, Yano, M.. Takemura. Y.. Ju-ichi, M., Ito, C., Furukawa, H., 1999. Acridones as inducers of HL-60 cell differentiation. Leuk. Res. 23. 263-269.

Kim, S.H., Yoo, J.C., Kim, TS, 2009. Nargenicin enhances 1,25-dihydroxyvitamin D(3)-and all-trans retinoic acid-induced leukemia cell differentiation via PKCbetalIMAPK pathways. Biochem. Pharmacol. 77, 1694-1701.

Koschmieder, S., Halmos, B., Levantini, E., Tenen, D.G., 2009. Dysregulation of the CJEBPalpha differentiation pathway in human cancer. J. Clin. Oncol. 27,619-628.

Kuo, P.L, Hsu, Y.L., Cho, C.Y.. Ng, LT., Kuo, Y.H., Lin, C.C., 2006. Apoptotic effects of Antrodia cinnamomea fruiting bodies extract are mediated through calcium and calpain-dependent pathways in Hep 3B cells. Food Chem. Toxicol. 44, 1316-1326.

Laszczyk, M.N., 2009. Pentacyclic triterpenes of the lupane, oleanane and ursane group as tools in cancer therapy. Planta Med. 75, 1549-1560.

Lekstrom-Himes, J., Xanthopoulos, K.G., 1998. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J. Biol. Chem. 273, 28545-28548.

Lengfelder, E., Saussele, S., Weisser, A., Buchner, T., Hehlmann, R., 2005. Treatment concepts of acute promyelocytic leukemia. Crit. Rev. Oncol. Hematol. 56. 261-274.

Lowenberg, B., Downing, J.R., Burnett, A., 1999. Acute myeloid leukemia. N. Engl. J. Med. 341, 1051-1061 Lu, Z.M., Tao, W.V., Zou, X.L, Fu, H.Z., Ao, Z.H., 2007. Protective effects of mycelia of Antrodia camphorata and Armillariella tabescens in submerged culture against ethanol-induced hepatic toxicity in rats. J. Ethnopharmacol. 110. 160-164.

Lucas, D.M., Still, P.C., Perez, LB., Greyer, MAR., Kinghorn, A.D., 2010. Potential of plant-derived natural products in the treatment of leukemia and lymphoma. Curr. Drug Targets 11,812-822.

Marcinkowska, E., Garay, E., Gocek, E., Chrobak, A., Wang, X., Studzinski, G.P., 2006. Regulation of C/E13Pbeta isoforms by MAPK pathways in HL60 cells induced to differentiate by 1,25-dihydroxyvitamin D3. Exp. Cell Res. 312. 2054-2065.

Marcinkowska, E., Kutner, A., 2002. Side-chain modified vitamin D analogs require activation of both PI 3-K and erk1,2 signal transduction pathways to induce differentiation of human promyelocytic leukemia cells. Acta Biochim. Pol. 49, 393-406.

Meshkini, A., Yazdanparast, R., 2008. Involvement of ERK/MAPK pathway in megakaryocytic differentiation of K562 cells induced by 3-hydrogenkwadaphnin. Toxicol. In Vitro 22, 1503-1510.

Miranda, M., McGuire, T., Johnson, D., 2002. Importance of MEK-1/-2 Signaling in Monocytic and Granulocytic Differentiation of Myeloid Celt Lines. Leukemia. vol. 16. Official Journal of the Leukemia Society of America, Leukemia Research Fund, UK, p. 683.

Moradali, M.F.. Mostafavi, H., Ghods, S., Hedjaroude, G.A., 2007. Immunomodulating and anticancer agents in the realm of macromycetes fungi (macrofungi). Int. Immunopharmacol. 7,701-724.

Morosetti, R., Park, DJ., Chumakov, A.M., Grillier, I., Shiohara, M., Gombart, A.F., Nakamaki, T Weinberg, K., Koeffler, H.P., 1997. A novel, myeloid transcription factor, C/EBP epsilon, is unregulated during granulocytic, but not monocytic, differentiation. Blood 90, 2591-2600.

Nakamura, N., Hirakawa, A., Gao, J.J., Kakuda, H., Shiro, M.. Komatsu, Y., Sheu, C.C., Hattori, M., 2004. Five new maleic and succinic acid derivatives from the mycelium of Antrodia camphorota and their cytotoxic effects on LLC tumor cell line. J. Natl. Prod. 67,46-48.

Natsuka, S.. Akira, S., Nishio, Y., Hashimoto, S., Sugita, T., Isshiki, H., Kishimoto, T., 1992. Macrophage differentiation-specific expression of NF-1L6. a transcription factor for interleuki n-6. Blood 79, 460-466.

Newburger, P.E., Speier, C., Borregaard, N., Walsh, C.E.,Whitin, J.C., Simons, E.R., 1984. Development of the superoxide-generating system during differentiation of the HL-60 human promyelocytic leukemia cell line. J. Biol. Chem. 259, 3771-3776.

Pabst, T., Mueller, B.U., Zhang, P., Radomska, H.S., Narravula, S., Schnittger, S., Behre, G., Hiddemann, W., Tenen, D.C., 2001. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat. Genet. 27, 263-270.

Pan, Z., Hetherington, C.J., Zhang, D.E., 1999. CCAAT/enhancer-binding protein activates the CD14 promoter and mediates transforming growth factor beta signaling in monocyte development. J. Biol. Chem. 274, 23242-23248.

Park, M.H., Park, SY., Kim, Y., 2008. Induction of proline-rich tyrosine kinase2 (Pyk2) through C/EBPbeta is involved in PMA-induced monocyte differentiation. FEBS Lett. 582, 415-422.

Poll, V., 1998. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J. Biol. Chem. 273, 29279-29282.

Porse, B.T., Bryder, D., Theilgaard-Monch, K.. Hasemann, MS, Anderson, K., Damgaard, 1., Jacobsen, RE., Nerlov, C., 2005. Loss of CIEBP alpha cell cycle control increases myeloid progenitor proliferation and transforms the neutrophil granulocyte lineage. J. Exp. Med. 202, 85-96.

Ramji, D.P., Foka. P., 2002. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem. J. 365, 561-575.

Rao, VAC, Fang, S.H.,Tzeng, Y.M., 2007. Evaluation of the anti-inflammatory and antiproliferation tumoral cells activities of Ant rodia carnphorata, Cordyceps sinensis. and Cinnamomum osmophloeum bark extracts. J. Ethnopharmacol. 114,78-85.

Reddy, L.H., Couvreur, P., 2009. Squalene: a natural triterpene for use in disease management and therapy. Adv. Drug Deliv. Rev. 61, 1412-1426.

Reitsma, P.H., Rothberg, P.G., Astrin, S.M., Trial, J., Bar-Shavit, Z., Hall, A., Teitelbaum, S.L., Kahn, A.J., 1983. Regulation of myc gene expression in HL-60 leukaemia cells by a vitamin D metabolite. Nature 306,492-494.

Renzi, D., Valtolina, M., Foster, R., 1993. The evaluation of a multi-endpoint cytotoxicity assay system. ATLA 21,89-96.

Scott, LM., Civin, C.I., Rorth, P., Friedman, A.D., 1992. A novel temporal expression pattern of three CJEBP family members in differentiating myelomonocytic cells. Blood 80, 1725-1735.

Shimizu, T., Taira, N., Senou, M., Takeda, K., 2002. Involvement of diverse protein kinase C isoforms in the differentiation of ML-1 human myeloblastic leukemia cells induced by the vitamin 1113 analogue KV11060 and the phorbol ester TPA. Cancer Lett. 186, 67-74.

Singh, J., Murata, K., Itahana, Y., Desprez, P.Y., 2002. Constitutive expression of the 1d-1 promoter in human metastatic breast cancer cells is linked with the loss of NF-1/11b/HDAC-1 transcription repressor complex. Oncogene 21, 1812-1822.

Song, T.Y., Hsu, S.L., Yen, G.C., 2005. Induction of apoptosis in human hepatoma cells by mycelia of Antrodia camphorata in submerged culture. J. Ethnopharmacol. 100,158-167.

Stone, R.M., 2007. Novel therapeutic agents in acute myeloid leukemia. Exp. Hematol. 35, 163-166.

Studzinski, G.P., Garay, E., Patel, R., Zhang, J., Wang, X., 2006. Vitamin D receptor signaling of monocytic differentiation in human leukemia cells: role of MAPK pathways in transcription factor activation. Curr. Top. Med. Chem. 6, 1267-1271.

Studzinski, G.P., Wang, X., Ji, Y., Wang, Q., Zhang, Y., Kutner, A., Harrison, J.S., 2005. The rationale for deltanoids in therapy for myeloid leukemia: role of KSR-MAPKC/EBP pathway. J. Steroid Biochem. Mol. Biol. 97,47-55.

Tenen, D.G., Hromas, R., Licht, J.D., Zhang, D.E., 1997. Transcription factors, normal myeloid development, and leukemia. Blood 90,489-519.

Traore, K., Trush, M., George, M., 2005. Signal transduction of phorbol 12-myristate 13-acetate (PMA)-induced growth inhibition of human monocytic leukemia THP-1 cells is reactive oxygen dependent. Leuk. Res. 29, 863-879.

Wang, Q., Wang, X., Studzinski, G.P., 2003. N-terminal kinase pathway enhances signaling of monocytic differentiation of human leukemia cells induced by 1 .25-dihydroxyvitamin D3. J. Cell Biochem. 89 (June), 1087-1101.

Wang, X., Rao, J., Studzinski, G.P., 2000. Inhibition of p38 MAP kinase activity up-regulates multiple MAP kinase pathways and potentiates 1,25-dihydroxyvitamin D(3)-induced differentiation of human leukemia HL60 cells. Exp. Cell Res. 258,425-437.

Wang, X., Studzinski, G.P., 2001. Activation of extracellular signal-regulated kinases (ERKs) defines the first phase of 1,25-dihydroxyvitamin D3-induced differentiation of HL60 cells. J. Cell Biochem. 80.471-482.

Wang, Z.Y., Chen, Z., 2008. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 111, 2505-2515.

Yam, LT., Li, C.Y., Crosby, W.H., 1971. Cytochemical identification of monocytes and granulocytes. Am. J. din. Pathol. 55, 283-290.

Yamanaka, R., Lekstrom-Himes, J., Barlow, C., Wynshaw-Boris, A., Xanthopoulos, K.G., 1998. CCAAT/enhancer binding proteins are critical components of the transcriptional regulation of hematopoiesis (Review). Int. J. Mol. Med. 1, 213-221.

Yen, A., Roberson, M.S., Varvayanis, S., Lee, A.T., 1998. Retinoic acid induced mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase-dependent MAP kinase activation needed to elicit HL-60 cell differentiation and growth arrest. Cancer Res. 58, 3163-3172.

Zhang. Y., Zhang, J., Studzinski, G.P., 2006. AKT pathway is activated by 1,25-dihydroxyvitamin D3 and participates in its anti-apoptotic effect and cell cycle control in differentiating HL60 cells. Cell Cycle 5,447-451.

Zjawiony, J.K., 2004. Biologically active compounds from Aphyllophorales (poly-pore) fungi. J. Nat. Prod. 67,300-310.

Chi-Luan Wen (a), (b), Chieh-Lin Tenge(c), (d), (e), Chih-Hung Chiang (f), Chia-Chuan Chang (g), Wen-Lee Hwang (c), Chao-Lin Kuo (b) *, Shih-Lan Hsu (b), (e), (f) **

(a.) Taiwan Seed Improvement and Propagation Station, Council of Agriculture, Propagation Technology Section. Taichung, Taiwan

(b.) School of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung, Taiwan

(c.) Division of Hematology/Oncology, Department of Medicine, Taichung Veterans General Hospital, Taiwan

(d.) Department of Life Science, Tunghai University, Taiwan

(e.) Department of Medicine, Chung Shan Medical University, Taiwan

(f.) Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan

(g.) Division of Medicinal Chemistiy, National Research Institute of Chinese Medicine, Taipei 112, Taiwan

doi:10.1016/j.phymed.2011.11.003
COPYRIGHT 2012 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:extracellular signal-regulated kinase; CCAAT/enhancer-binding protein [beta]
Author:Wen, Chi-Luan; Tenge, Chieh-Lin; Chiang, Chih-Hung; Change, Chia-Chuan; Hwang, Wen-Lee; Kuo, Chao-Li
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9TAIW
Date:May 1, 2012
Words:8279
Previous Article:Use of curcuminoids in a cohort of patients with oral lichen planus, an autoimmune disease.
Next Article:Antiproliferation effect of rosemary (Rosmarinus officinalis) on human ovarian cancer cells in vitro.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters