Printer Friendly

MUTATION ANALYSIS OF PAX9 GENE IN AFFECTED FAMILY OF HYPODONTIA ATTENDING TERTIARY CARE HOSPITAL OF QUETTA.

Byline: Muhammad Nawaz, Nasrullah Mengal, Agha Muhammad Raza, Nisar Ahmed and Jamil Ahmad

ABSTRACT

Objective: To identify the phenotype and genotype of hypodontia for a Pakistani family with hypodontia and to map the genes locus responsible for this disease.

Study Design: Descriptive study.

Place and Duration of Study: This descriptive study was performing in human molecular genetics (HMG) laboratory of Baluchistan University of information technology, engineering and management sciences (BUITEMS). The study was of 4 months duration.

Material and Methods: Blood samples (5ml) were collected from all 15 families' members (35participant). Genomic DNA was extracted by using inorganic method. All the three coding exons of PAX9 (NM_006194) were amplified and sequenced. Sequencing of the PAX9 coding exons and splice sites showed a homozygous misses substitution in exon 3 (c. 718G>C; p.Ala240Pro) in the affected individuals of the family.

Results: Intra-oral and panoramic radiographs revealed that the proband (II-1) and her father (I-1) have hypodontia denoted by the complete absence of teeth in maxillary arch, while all other family members maintained normal dentitions. The missing teeth are both upper lateral incisors (12, 22 FDI numbering) and third molars (18, 28). Mandibular arch show; retained deciduous teeth and no teeth permanent teeth missing. Pedigree construction indicated that phenotypes in this family showed an autosomal recessive segregation pattern. The sequencing of coding exons and splice sites of PAX9 gene showed a homozygous missense mutation in exon number 3 (c. 718G>C; p.Ala240Pro) in the affected individuals of the family.

Conclusion: We identified a missense mutation (p.Ala240Pro) in gene PAX9 coding exon 3 in Pakistani family with hypodontia.

Keywords: Congenital, Hypodontia, Missense mutation, PAX9 gene.

INTRODUCTION

Tooth agenesis usually known as hypodontia is the congenital absence of one or more teeth. It may occur in primary or secondary dentition and is among the most common craniofacial anomalies1. Hypodontia occurs in both sporadic and familial forms and can be classified as either non-syndromic (isolated) or syndromic based on the presence of other inherited abnormalities2,5. Permanent dentition is more frequently affected than primary dentition5-6. Clinical classification of this anomaly occurs according to the number of missing teeth. Hypodontia is defined as the absence of one to six permanent teeth (excluding third molars), Oligodontia occurs when more than six permanent teeth are lacking (excluding third molars), Anodontia refer for complete absence of permanent dentition7,9. The prevalence of hypodontia (excluding the third molars) is 1.3% for males and 4.7% for females and third molar agenesis is the most common with an incidence of 20% in general population of Pakistan9.

The etiology of hypodontia is mainly genetics and environmental factors3,10-12. To date, more than 300 genes have been found to be involved in tooth development, but only a few of these genes, such as MSX1, PAX9, AXIN2, WNT10A, TGFA, IRF6, MMP1, MMP20 and EDA are directly involved in tooth genesis2,13,14. PAX9, in chromosome 14 (14q21-q13) have been identified in families with oligodontia of most molars15. PAX9 encodes a member of another transcription factor protein family, characterized by the presence of a DNA-binding paired-box domain16. The morphogenesis of teeth is under strict genetic control. The most important events during the regulation of tooth development are inductive interactions between the epithelial and mesenchymal tissues17.

In the early stage of tooth development, the paired domain transcription factor Pax9 is expressed at the prospective sites of all teeth prior to any morphological manifestations or expression of other known transcription factors and signaling molecules18. A high level of PAX9 expression is maintained throughout the initiation, bud stage and cap stage, and the expression of PAX9 is down regulated at the bell stage19. In the process, Pax9 PAX9 mediates its tooth-specific function through its interaction with other proteins. In Pax9 (-/-) mice, the development of the tooth organ ceases at the cap stage when compared with wild type and the expression of Msx1 and Bmp4 in the mesenchyme is significantly reduced19. In view of the important role of PAX9 in tooth development, researchers have chosen PAX9 (MIM: 167416) as a candidate gene for hypodontia and identified18 distinct disease-causing mutations20,23.

They range from missense mutations that change just one amino acid in the entire protein to premature stop codons that result in truncation of the protein products. Some researchers analyzed the function of the PAX9 mutants in vitro and suggested that the tooth agenesis phenotype may result from the haploin sufficiency of PAX923-24. The purpose of the present research study is to identify the phenotype, genotype of hypodontia for the first time in Pakistan and to map the genes locus responsible for this disease. In Pakistan only epidemiological data including prevalence of hypodontia have been published9.

MATERIAL AND METHODS

This descriptive study was performed in human molecular genetics (HMG) laboratory of Baluchistan university of information technology, engineering and management sciences (BUITEMS). The study was done of 4 months duration. Sampling technique was non-probability purpo-sive sampling.

Family selection and pedigree construction

Total 15 families (35 participants) were taken in our study. The proband was 12 years old when she was referred from general dental OPD of Sandeman Provincial Hospital Quetta to the department of Orthodontics for orthodontic consultation. The main chief complaint was spacing in the front teeth due to absence of permanent upper lateral incisors. Since her family had a dental history involving the absence of teeth, the proband and her family member were invited to participate in this study. Diagnosis of the anomaly was verified by clinical intra oral examination detail (Fig: 4A-C), panoramic radiographs (Fig: 3), lateral cephalogram and cast model analysis of all family members, allowing the pedigree to be determined (Fig: 1). After the institutional review board (IRB#00007818) approval, at the department of Biotechnology, Baluchistan university of information technology, engineering and management sciences (BUITEMS), Quetta, Pakistan these families were enrolled in current study.

The study was conducted according to the tenets of the declaration of Helsinki. Written inform consent was obtain from all participant and their parent.

DNA collection, screening and mutational analysis

Venous blood 5ml was collected from the patients under aseptic conditions. The collected blood was preserved into a collecting tube containing EDTA to avoid clotting of the blood; the samples were stored at -20 degree Celsius. DNA was extracted by using inorganic method from the blood leukocytes (samples) following a standardized protocol already established in human molecular genetics (HMG) laboratory of Baluchistan university of information technology, engineering and management sciences BUITEMS. The final extracted DNA was run in electrophoresis gel to check the quality of the extracted DNA (fig-2). Primers for coding exon of PAX9 gene were designed by using computer web program Primer3, UCSC genome bio-informatics and ensembl genome browser (table-I). After primer was designed, they were assembled from macrogen company korea. Amplification of the axons using pre designed primer was done by polymerize chain reaction (PCR).

The polymerase chain reaction (PCR) protocol of BUITEMS human molecular genetic laboratory was followed for this purpose. The amplified DNA was sequenced to check any possible mutations in PAX9 gene from Macrogen Company Korea. Data was analyzed using bioEdit, chromas, Segman softwares.

Table-I: Primers for coding exon of PAX9 gene.????

Exon###Left Primer(5>3)###Right Primer(5>3)###Product###Ann.

###size###Temp

2###CATCCGACCGTGTGACATC###AGGATGTCGGTGACGGAGT###498###61OC

3###TGGAAAGGCCTACTCTGAGG###GAAGGATCTGGCTCGTAGCA###499###61OC

4###TCAGAGCATTGCTGGCTTAC###ATGTGAGACCTGGGAATTGG###443###62OC

Table-II: Sequence of primers used for PCR amplification of human PAX9 exons and PCR conditions.

Relatives###Phenotype###Missing teethb###PAX9 - c718G > Cc

I-1###Hypodontia###12,18,22,28###G>C

I-2###Unaffected

II-1a###HYpodonita###12,18,22,28###G>C

II-2###Unaffected

RESULTS

Out of 15 families (35 participants) only one family has shown PAX9 gene mutation. The diagnosis of non syndromic hypodontia was confirmed in the effected proband (II-1) and her father (I-1) by intra oral clinical examination (fig-4) and radiographic analysis (fig-3). Diagnosis confirms congenital absence of permanent upper lateral incisors and third molars. Preoperative panoramic X-ray shows; in maxillary arch retained deciduous teeth are (FDI numbering) 54, 53 and 65, erupting permanent teeth are 17, 13, 25 and 27, maxillary arch also shows missing both upper lateral incisors (12, 22) and third molar (18,28). Mandibular arch show; retained deciduous teeth are 35 and 45, both, erupting permanent teeth are 35 and 45 and no teeth permanent teeth missing. Pedigree construction indicated that phenotypes in this family showed an autosomal recessive segregation pattern (fig-1).

Mutational analyses of the PAX9 gene, phenotypes and missing teeth observed in the studied family are shown in (table-II).Clinical examination and medical records did not disclose health problems or disorders related to nails, hair follicles or sweat glands. Associated dental anomalies were identified in affected father (I-1) of the patient (II-1). The sequencing of coding exons and splice sites of PAX9 gene showed a homozygous missense mutation in exon number 3 (c. 718G>C; p.Ala240Pro) in the affected individuals of the family (Fig: 5).

DISCUSSION

We have identified a PAX9 homozygous missense mutation in individuals with hypodontia from a Pakistani family. The mutation results in the substitution of proline for alanine in exon 3 of PAX9 gene. This mutation appeared in affected members of family, whereas all unaffected family members were negative for this variant. In humans, thirty two PAX9 mutations have been identified including 21 missense/nonsense, 6 insertion/deletions and 2 for complex re-arrangements (www.hgmd.cf. ac.uk). Many genes, including MSX1, PAX9, WNT10A, EDA and AXIN2, have been involved in non-syndromic tooth agenesis. PAX9 mutations cause molar agenesis whereas MSX1 mutations cause second premolar agenesis25. Whereas WNT10A aberrations usually cause autosomal recessive or isolated tooth agenesis26. EDA mutations are more likely to cause anterior teeth agenesis27. In addition, AXIN2-associated tooth agenesis is often accompanied with predisposing to colorectal cancer28.

For this study we have selected PAX9 prior to the other candidate genes. Up to date, more than thirty PAX9 mutations have been found and all of these mutation were differentiated into two subsets29. The first subset, in-frame mutations, includes missense mutations and in-frame insertions or deletions. The second subset, truncating mutations, includes nonsense mutations, out-of-frame insertions or deletions, initiation codon mutations and deletion of the entire gene. Now, we focused on functional studies of the mutant PAX9 to explain the oligodontia phenotype. The study of Mensah indicated that the 219 insG PAX9 mutant could not function properly because it stayed in the cytoplasm, while the wild-type PAX9 was trans located to the nucleus23. Cytoplasmic localization was not found in eight other tooth agenesis causing Pax9 mutations in the study of Wang et al30.

CONCLUSION

The sequencing of the PAX9 gene showed a homozygous missense substitution in exon 3 (c. 718G>C; p.Ala240Pro) in the affected individuals of the family. Due to this mutation the maxillary lateral incisors along with maxillary third molars were congenitally absent.

CONFLICT OF INTEREST

This study has no conflict of interest to be declared by any author.

REFERENCES

1. Laing E, Cunningham SJ, Jones S, Moles D, Gill D. Psychosocial impact of hypodontia in children. Am J Orthod Dentofacial Orthop 2010; 137(1): 35-41.

2. Mostowska A, Biedziak B, Jagodzinski PP. Novel MSX1 mutation in a family with autosomal-dominant hypodontia of second premolars and third molars. Arch Oral Biol 2012; 57(6): 790-5.

3. Arte S, Pirinen S. Hypodontia. Orphanet encyclopedia 2004:1-7.

4. Xuan K, Jin F, Liu YL, Yuan LT, Wen LY, Yang FS, et al. Identification of a novel missense mutation of MSX1 gene in Chinese family with autosomal-dominant oligodontia. Arch Oral Biol 2008; 53(8): 773-9.

5. Han D, Gong Y, Wu H, Zhang X, Yan M, Wang X, et al. Novel EDA mutation resulting in X-linked non-syndromic hypodontia and the pattern of EDA-associated isolated tooth agenesis. Eur J Med Genet 2008; 51(6): 536-46.

6. Vastardis H. The genetics of human tooth agenesis: new discoveries for understanding dental anomalies. Am J Orthod Dentofacial Orthop 2000;117(6): 650-6.

7. Arte S, Nieminen P, Apajalahti S, Haavikko K, Thesleff I, Pirinen S. Characteristics of incisor-premolar hypodontia in families. J Dent Res 2001; 80(5): 1445-50.

8. Abdalla EM, Mostowska A, Jagodzinski PP, Dwidar K, Ismail SR. A novel WNT10A mutation causes non-syndromic hypodontia in an Egyptian family. Arch Oral Biol 2014; 59(7): 722-8.

9. Amin F. Prevalence of hypodontia in orthodontic patients in a pakistani sample. Pak Oral Dental J 2010; 30(1): 4.

10. Grahnen H. Hypodontia in the permanent dentition: a clinical and genetical investigation: Gleerup; 1956.

11. Ahmad W, Brancolini V, ul Faiyaz MF, Lam H, ul Haque S, Haider M, et al. A locus for autosomal recessive hypodontia with associated dental anomalies maps to chromosome 16q12.1. Am J Hum Genet 1998; 62(4): 987-91.

12. Brook AH, Elcock C, Aggarwal M, Lath DL, Russell JM, Patel PI, et al. Tooth dimensions in hypodontia with a known PAX9 mutation. Arch Oral Biol 2009; 54 Suppl 1: S57-62.

13. Wang J, Xu Y, Chen J, Wang F, Huang R, Wu S, et al. PAX9 polymorphism and susceptibility to sporadic non-syndromic severe anodontia: a case-control study in southwest China. J Appl Oral Sci 2013; 21(3): 256-64.

14. Mu YD, Xu Z, Contreras CI, McDaniel JS, Donly KJ, Chen S. Mutational analysis of AXIN2, MSX1, and PAX9 in two Mexican oligodontia families. Genet Mol Res 2013; 12(4): 4446-58.

15. Lammi L, Halonen K, Pirinen S, Thesleff I, Arte S, Nieminen P. A missense mutation in PAX9 in a family with distinct pheno-type of oligodontia. Eur J Hum Genet 2003; 11(11): 866-71.

16. Cobourne MT. Familial human hypodontia--is it all in the genes? Br Dent J 2007; 203(4): 203-8.

17. Irma T, vaahtokari, anne partanen, Anna-maija Regulation of organogenesis. Common molecular mechanisms regulating the development of teeth and other organs. Int J De Riol 1995; 39: 35-50.

18. Neubuser A, Peters H, Balling R, Martin GR. Antagonistic interactions between FGF and BMP signaling pathways: A mechanism for positioning the sites of tooth formation. Cell 1997; 90(2): 247-55.

19. Peters H, Neubuser A, Balling R. Pax genes and organogenesis: Pax9 meets tooth development. Eur J Oral Sci 1998; 106(S1): 38-43.

20. Stockton DW, Das P, Goldenberg M, D'Souza RN, Patel PI. Mutation of PAX9 is associated with oligodontia. Nature genetics 2000; 24(1): 18.

21. Nieminen P, Arte S, Tanner D, Paulin L, Alaluusua S, Thesleff I, et al. Identification of a nonsense mutation in the PAX9 gene in molar oligodontia. EJHG 2001; 9(10): 743.

22. Mostowska A, Kobielak A, Biedziak B, Trzeciak WH. Novel mutation in the paired box sequence of PAX9 gene in a sporadic form of oligodontia. Eur J Oral Sci 2003; 111(3): 272-6.

23. Mensah JK, Ogawa T, Kapadia H, Cavender AC, D'Souza RN. Functional analysis of a mutation in PAX9 associated with familial tooth agenesis in humans. J Biol Chem 2004; 279(7): 5924-33.

24. Ogawa T, Kapadia H, Feng JQ, Raghow R, Peters H, D'Souza RN. Functional consequences of interactions between Pax9 and Msx1 genes in normal and abnormal tooth development. J Biol Chem 2006; 281(27): 18363-9.

25. Kim JW, Simmer J, Lin BJ, Hu JC. Novel MSX1 frameshift causes autosomal-dominant oligodontia. Dent Res J 2006; 85(3): 267-71.

26. van den Boogaard MJ, Creton M, Bronkhorst Y, van der Hout A. Hennekam E, Lindhout D. Mutations in WNT10A are present in more than half of isolated hypodontia cases. J Med Genet 2012; 49(5): 327-31.

27. Han D, Gong Y, Wu H, Zhang X, Yan M, Wang X, et al. Novel EDA mutation resulting in X-linked non-syndromic hypodontia and the pattern of EDA-associated isolated tooth agenesis. Eur J Med Genet 2008; 51(6): 536-46.

28. Lammi L, Arte S, Somer M, Jarvinen H, Lahermo P, Thesleff I, et al. Mutations in AXIN2 cause familial tooth agenesis and predispose to colorectal cancer. Am J Hum Genet 2004; 74(5): 1043-50.

29. Zhong Q, Simonis N, Li QR, Charloteaux B, Heuze F, Klitgord N, et al. Edgetic perturbation models of human inherited disorders. Mol Syst Biol 2009; 5(1): 321.

30. Wang Y, Groppe JC, Wu J, Ogawa T, Mues G, D'souza RN, et al. Pathogenic mechanisms of tooth agenesis linked to paired domain mutations in human PAX9. Hum Mol Genet 2009; 18(15): 2863-74.
COPYRIGHT 2018 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Pakistan Armed Forces Medical Journal
Geographic Code:9PAKI
Date:Dec 31, 2018
Words:2893
Previous Article:COMPARISON OF ONLAY VERSUS SUBLAY MESH REPAIR FOR VENTRAL ABDOMINAL HERNIAS. A RANDOMIZED CONTROLLED TRIAL.
Next Article:COMPARISION OF PRE-OPERATIVE ONDANSETRON VERSUS COMBINATION OF DEXAMETHASONE AND ONDANSETRON FOR POSTOPERATIVE NAUSEA AND VOMITING IN ELECTIVE...

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |