Printer Friendly

MOLECULAR SCREENING OF COMPLEX VERTEBRAL MALFORMATION AND CITRULLINEMIA CARRIERS IN PAKISTANI NILI-RAVI BUFFALO(BUBALUS BUBALIS)BREEDING BULLS.

Byline: K. Zahra, M. Imran, M. Y. Zahoor, K. Ashraf, K. H. Jaffry, A. Nadeem, I. Rashid, M. Younas, M. Akhtar and W. Shehzad

Keywords: Complex vertebral malformation, citrullinemia, Nili-Ravi buffaloes.

INTRODUCTION

Livestock bolsters the growth and stability of agrarian economies by contributing substantially to the gross domestic product directly and through value addition. This sector is considered the mainstay of food security and sustainable development due to its essential contribution towards the provision of meat and dairy products. Together with other utilities, livestock products supply around 12.9% of the calories consumed worldwide(FAO, 2009a). With the increase in human population, the demand for food products has increased many times and the development of resilient food processing systems has become inevitable.

Livestock resources, as an alternative source of income and food, can act as a buffer against the loss of livelihood and food resources when catastrophic losses of crops occur(FAO, 2009b). It is obvious that an increased investment in the livestock sector in terms of money and technology will lead to better outputs of products, ensuring secure livelihoods and food supply chains(Adil et al., 2004; Cruz, 2007;Rehmanet al., 2017). Livestock farming in Pakistan generates 56% of the total agricultural revenue. Livelihoods ofanestimated 67.5% of the Pakistanis are directly or indirectly connected to livestock(Dhanda, 2005). Being such an important economic activity in the country, the livestock sector of Pakistan holds a diverse collection of domesticated fauna.

With numbers far exceeding those of the dairy cows, buffaloes are regarded as a very important component of this fauna(Raza et al., 2000). Buffaloes(Bubalusbubalis) area part of the traditional small mixed farming systems that are integrated with crop production. About 61% of the total milk produced in the country comes from buffaloes(Government of Pakistan, 2017). Of all the buffalo breeds employed locally, the Nili-Ravi buffalo is considered the most important water buffalo breed native to Pakistan and India. Its populations are concentrated in Punjab, Pakistan providing a major portion of the milk produced from buffalo sources(Alexiev, 1998). Nili-Ravi buffalo produces an average of 4-8 kg of milk per day, although its potential can go beyond 30 kg of milk per day. It is evident that the full production potential of the Nili-Ravi buffalo is yet b nto be achieved and exploited.

Pakistan, for instance, can emulate the Indian model of "green, white and red revolution" which was implemented for the improved production of animal feed, milk and meat(Pasha and Hayat, 2012).

Despite having adequate resources for the support of livestock and holding a herd of 31.7 million buffaloes alone, Pakistan is yet a non-exporter of dairy products. The obstacles to successful exploitation include inadequate finances, fluctuating climatic conditions, defective farming facilities and importantly, potential threat of infectious, metabolic or hereditary diseases inflicting the animals. A number of inherited diseases afflicting buffaloes have been reported including: transverse hemimelia, arthrogryposis, dystocia, perosomus elumbus, umbilical hernia, schistosoma reflexus, hydrocephalus, polycephaly, etc.(Nasreenet al., 2009; Mehmood et al., 2014; Albarella et al., 2017). Despite the availability of these reports, comprehensive information on genetic disorders of buffalo breeds still needs to be made available. The situation in Pakistan is no different with only a few reports available on bovine inherited malformations.

Complex vertebral malformation(CVM) is a noteworthy problem of the cattle breeds worldwide(Duncan et al., 2001). CVM is caused by a missense mutation in a uridine diphosphate N-acetylglucosamine transporter coding SLC35A3 gene. A single base substitution GaT has been located in the defective allele(position 559) in the SLC35A3 gene(Thomsen et al., 2006). CVM can affect multiple organ systems resulting in anomalies of the skeletal system in calves, which in most cases are aborted. The neonates appear to have craniofacial dysmorphism, axial skeletal deformities, short forelimbs and necks because of contracted tendons. Contractions canbe observed in fetlocksand carpal joints as well, along with rotation of distal limbs, ankylosis of cervico-thoracic vertebrae, elongation of tarsus and severe deformation of the spinal region hemivertebrae, scoliosis, symmetric arthrogryposis of the lower limb joints and cardiac anomalies(Nielsen et al., 2003; Agerholm et al., 2004; Rusc and Kaminiski, 2007).

In Bostaurus, the gene responsible for the ailmentislocated on chromosome 3, while the chromosome location in buffaloes is still to be detected(Konersmann, 2003; Agerholm et al., 2004). Previous reports confirmed that the use of the proband called Penstate Ivanhoe Star(US1441440) and his son Carlin-M Ivanhoe Bell(US1667366) were the cause of dissemination of defective alleles, when both were extensively used worldwide for selective breeding programs(Healy, 1996; Revell, 2001; Agerholm, 2007; Windsor and Agerholm, 2009). Studies for the identification of the mutant allele carriers were conducted in Denmark(Agerholm, 2007), Australia(Healy, 1996; Windsor and Agerholm, 2009), United Kingdom(Revell, 2001), United States(Robinson et al., 1993b; Duncan et al., 2001), Sweden(Berglund et al., 2004), Czech Republic(Citek et al., 2006), Japan(Ghanem et al., 2008) and are still being carried out by various scientists globally.

Bovine citrullinemia is a congenital metabolic disorder of cattle which is inherited in an autosomal recessive manner. Its lethality for the affected animal is certain during the early postnatal period(Robinson et al., 1993a; Windsor and Agerholm, 2009). Citrullinemia is caused by a CaT transition in exon 5 of argininosuccinate gene, leading to a CGA/arginine into TGA/stop codon transition.This mutation has been traced to codon 86 of the argininosuccinate synthase coding gene leading to a truncated peptide that gives rise to a defective Argininosuccinate synthetase enzyme. Argininosuccinate synthetase(ASS, EC 6.3.4.5) is a urea cycle enzyme which is expressed at high levels in the liver.

The enzyme catalyzes the conversion of citrulline, aspartate, and ATP to yield argininosuccinate, the immediate precursor of arginine(Husson et al., 2003). The affected animals experience a defective urea cycle and can survive up to the first 7 days of their life, showing symptoms of distress along with feeding inabilities.

The citrullinemia gene is located on chromosome 11 of Bos taurus(Grupe et al., 1996; Patel et al., 2006; Sun et al., 2011). Earlier reports of the condition in breeds of cattle include those from the United States(Robinson et al., 1993a), Germany(Grupe et al., 1996), India(Padeeri et al., 1999), Hungary(Fesus et al., 1999), Taiwan(Lin et al., 2001), Czech Republic(Citek et al., 2006) and China(Wang et al., 2009). Furthermore, in the present decade, a number of studies have been published by scientists, based on molecular screening of citrullinemia in the cattle populations of their native regions, from all over the world. But reports were lacking from Pakistan. Screening of livestock disorders and their underlying causes is vitally important for the welfare of the stake holders and procurement of benefits from livestock agriculture. Existing approaches used to detect the mutations or genetic polymorphisms include phenotypic, cytological, biochemical and PCR-based techniques.

Among the various strategies utilized, PCRbased methods are far better, as careful design of gene specific primers allow direct relative quantification. These advancements can be adopted for significant progression in livestock welfare(Henriques et al., 2012). The present study was aimed at the detection of two such disorders; complex vertebral malformation and citrullinemia in Nili-Ravi buffalo bulls. This is the first report on inherited disorders in Pakistani elite breeding buffalo bulls and will contribute to the ongoing research in this area.

MATERIALS AND METHODS

Nili-Ravi bulls(n=152) reared at Semen Production Unit(Qadirabad, Punjab, Pakistan) and Buffalo Research Institute(Pattoki, Punjab, Pakistan) were randomly sampled for the present study. The sampling was carried out during January, 2016 to April, 2017. Blood samples were obtained fromthe jugular vein of the bulls, transported to the laboratory and stored at 20 AdegC. DNA was extracted using phenol-chloroform(organic method) and was stored at 4 AdegC. PCR amplification was carried out using newly designed primers for SLC35A3 gene(codon 559) and ASS1 gene(Exon5; codon 86). The primer sequences and PCR temperature profiles are given in table. The amplicons were visualized on 1.2% Ethidium Bromide stained agarose gel.

The PCR products were precipitated and the CVM and Citrullinemia genotypes were identified by Sanger sequencing using ABI 3100 Avant Automated DNA sequencer(Applied Biosystems, CA, USA). The sequences were read using FinchTVA(r). DNA Sequencing was facilitated by Center of Applied Molecular Biology, University of the Punjab, Lahore, Pakistan.

Table 1. Primer sequences and temperature profile for PCR amplification of SLC35A3 and ASS1 genes

###PCR

Genes###Primer Sequence (5' a 3')###Temperature cycling###Product###Reference

###profile###(bp)

###95AdegC = 05 minutes

###94AdegC = 45 seconds

SLC35A3###Forward: CAGATTCTCAAGAGCTTAATTCTA###54AdegC = 45 seconds###281###Meydan et

###Reverse: TATTTGCAACAACAAGCAGTT###72AdegC = 60 seconds###al. (2010)

###72AdegC = 10 minutes

###95AdegC = 05 minutes

ASS1###94AdegC = 30 seconds

(Newly###Forward: AGGCCATCGGAGACTCTGT###55AdegC = 45 seconds###505###This study

Designed)###Reverse: AGTCAGGGACAGCTCCACTC###72AdegC = 45 seconds

###72AdegC = 10 minutes

RESULTS

The primers amplified the partial sequences of SLC35A3 gene(281 bp; Figure 1) and ASS1 gene(505 bp; Figure 2) for CVM and citrullinemia, respectively. Possible point mutations of both disorders were screened in all the samples by sequencing analyses. The sequences from electropherogram were aligned using NCBI-BLAST(https://www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence alignment was done by Clustal Omega. 98% homology was detected with Bos taurus. Single nucleotide polymorphisms(SNPs) were not detected in SLC35A3 gene fragment; however, a novel SNP was detected as a transversion in ASS1 gene fragment(c.250C>A).

DISCUSSION

The occurrence of genetic disorders causes direct economic losses in breeding cattle populations in terms of animal mortality, reduced reproductive ability and milk production(Khan et al., 2007). Despite the fact that the dairy animals have been well exploited for their economic traits, information available on the congenital defects of buffaloes is not ample enough as compared to that on cattle breeds such as Bos taurus. As artificial insemination is widely used in cattle breeding, it is recommended to screen prospective sires to minimize horizontal dissemination of defective alleles. Bulls represent half of the herd and a single insemination can affect hundreds of off-springs, thus employment of genetic testing approach can subsequently be helpful in screening of carrier bulls. With the advent of molecular based technologies, evaluation of the status of carriers among breeding animal populations has been made easy.

Although, biochemical tests may be available for few disorders but DNA based testing can replace conventional methods that gave unreliable or overlapping results. DNA testing for genetic disorders in animals has made a significant contribution to the control and eradication of some devastating conditions among dairy andbeefcattle(Al-Haggar, 2013). More than fifty hereditary disorders have been well documented in Bos taurus breeds worldwide but little information regarding hereditary disorders in Bubalus bubalis is available especially from Pakistan. The actual number of clinical cases of CVM and citrullinemia are unreported in the Pakistani buffalo breeds. Thus, the current study was designed in an attempt to detect the prevalence of CVM and citrullinemia carriers among Pakistani Nili-Ravi buffaloes through molecular screening. A total of 152 healthy elite bulls were randomly selected from Buffalo Research Institute, Punjab, Pakistan and Semen Production Unit, Qadriabad, Pakistan.

Blood samples were collected from the jugular vein and preserved in EDTA containing vacutainers. Extraction of blood was carried out under standard veterinary regimes. Whole genomic extraction was carried out by organic method and DNA yield was quantified by 0.8% agarose gel and spectrophotometer(NanoDrop, Thermo Fisher Scientific, Massachusetts, USA). The genetic screening of CVM and BC carriers was done by amplification of SLC35A3 gene partial sequence(281 bp) using already reported primers by Meydan et al., 2010) and ASS1 gene partial sequence(505 bp) by primers newly designed for this study. The findings of the current study reported that carriers of CVM and citrullinemia were not detected among buffalo breeding sires at the government managed breeding institutes in the Punjab province.

Previously, a number of studies have been carried out for the detection of CVM carriers, with the earliest being that on Danish Holsteins(Agerholm et al., 1993). Later studies in other countries include those from the United States(Duncan et al., 2001), Australia(Healy, 1996), United Kingdom(Revell, 2001), Czech Republic(Citek et al., 2006) and Japan(Nagahata et al., 2002; Ghanem et al., 2008).The fact that no carriers of CVM were found was in accordance with a number of studies reporting either no carriers or a low frequency of carriers in cattle. Meydan et al.(2010) reported 12 CVM carriers among 350 animals(at a low frequency; 0.017%) in Turkish Holstein population, while, Avanus and Altinel(2017) detected 3.2% carriers in Turkey. With a screening technique of high resolution melting analysis(HRMA) used for SNP detection in Slovak cattle by(Gabor et al., 2012), the genotyping of mutant allele "T" was carried out with 47 samples and out of those tested animals, 4 were heterozygous.

Rezaee et al.(2009) screened 144 Iranian Holsteins but found no carriers among the lot while, Alaie et al.(2012) screened 100 Holsteins and 100 Guilan cows by PCR-SSCP method but found no carriers among Iranian cattle. Wang et al.(2011) detected 10 CVM carriers out of 342 studied animals(2.9% carrier frequency). In another study, Zhang et al.(2012) used real-time PCR assay and detected 56 out of 587 animals studied in Chinese cattle, with 1.36% heterozygous carrier frequency. Paiva et al.(2013) studied Brazilian Girolando cattle(783 animals) and found the carrier frequency as 1.53%. Similarly, Adamov et al.(2014) identified one CVM carrier out of ninety Macedonian Holstein-Friesian cattle. It is notable that the results of the present study coincide with the findings of two neighbouring countries, Iran and China. Some other studies also reported a high prevalence of the condition.

Agerholm(2007), pointed out that the disorder was of high prevalence worldwide and was a result of in breeding as a proband(Penstate Ivanhoe Star; US 1441440) and his son(Carlin-M Ivanhoe Bell; US 1667366) were the founders carrying defective alleles. Berglundet al.(2004) identified high carrier frequency of CVM(23%) in Swedish cattle. Rusc and Kaminiski(2007) determined the status of CVM carriers inatotal of 605 Polish Holstein-Friesians. A high incidence was detected among them with 150 heterozygotes, by using polymerase chain reaction-single stranded conformation polymorphism(PCR-SSCP). Similarly, 10% carrier frequency was detected by Betka et al.(2008) in Slovenia. Ghanemet al.(2008) identified 26 carrier cows out of 200 in Japan(10% carrier frequency). Mahdipour et al.(2010) studied Indian Karan Fries and out of 52 animals, 12 were carriers of the CVM allele.

According to the findings of our study, no carriers of either CVM or citrullinemia were detected in buffalo bulls. As it is noticeable that the previous studies indicated a high prevalence of CVM concern with Bos taurus rather than with buffaloes(Meydanet al., 2010).

Nili-Ravi buffaloes were also screened for citrullinemia using newly designed primers. A 505 bp ASS1 gene fragment was amplified for the first time in Pakistani buffaloes. Sanger sequencing revealed a novel transversion in bubaline ASS1 gene(c.250C>A) but this SNP had no phenotypic effects when it was compared with Ensembl genone browser. The results of our study suggest that citrullinemia occurs with perhaps a very low incidence in buffaloes. Our study found no carriers but a further study with a much larger sample size might be able to report a few, if at all, carriers. A number of previous studies support this supposition. Initially, Robinsonet al.(1993a)detected citrullinemia for the first time in US bulls, followed by Grupe et al.(1996) in Germany. The incidence of carriers was low in both the countries. It was disseminated throughout the Australian Holstein population following importation of semen from the US sire Linmarck Kriss King(Healy et al., 1991).

Padeeri et al.(1999) studied the incidence of citrullinemia in Indian cows and buffaloes. According to their findings, one Holstein bull was detected as a carrier with 0.67% frequency and no carriers were detected among the studied buffalo breeds. Fesus et al.(1999) reported a few carriers in Hungarian Holstein populations. Lin et al.(2001) and Wang et al.(2009) studied the citrullinemia carrier in Taiwan and China, respectively. From the Czech Republic, Citek et al.(2006) found no incidence of citrullinemia. Similarly, Meydanet al.(2010), Oner et al.(2010) and Eydivandi et al.(2012), screened the cattle populations in Turkey and Iran respectively, but no carriers were detected in these regions. JianBin et al.(2011), identified citrullinemia carriers in Chinese Holstein by PCR-RFLP analysis. Among the 615 animals, one citrullinemia carrier was identified with a 0.16% carrier frequency. Gaur et al.(2012), found a few carriers in Indian Holstein population.

Incidence of citrullinemia was altogether absent in Turkish Holsteins as reported by Agaoglu et al.(2015) and Avanus and Altinel(2017). Branda et al.(2016), carried out PCR-RFLP for detection of citrullinemia in Uruguay where no carrier was detected among the study population(n=190). Similarly, Ramesha et al.(2017) screened Indian native cattle and buffalo populations and reported no citrullinemia carriers among the studied animals. In a study carried out in India, Kotikalapudi et al.(2014) identified a carrier bull among the Indian Holstein population. They also reported a novel polymorphism within exon 3 of ASS1 gene. It was however, a silent mutation at codon 80 with no change in amino acid(Serine AGCaAGT) at 240 bp position(NCBI accession No. KF933365). The findings of the present study are supported by these previous studies that citrullinemia is more prevalent in Bos taurus breeds and the incidence is low in Bubalus bubalis.

In conclusion, it is emphasised that the DNA based detection analyses provide reliable detection of carriers even in the prospective populations. These methods are rapid and more convenient than the conventional methods with enhanced accuracy of carrier identification. As the existing data on carriers of hereditary disorders among dairy animals in Pakistan needs to be upgraded this study can be helpful in PCRbased genetic screening of CVM and BC carriers with extended sample sizes. This study was an effort to generate first hand data on hereditary disorders among theNili-Ravi buffalo breed through molecular screening.

Acknowledgement: The authors are grateful to Punjab Agriculture Research Board for the financial assistance as this study was part ofPARB Project No. 492.

REFERENCES

Adamov, N., D. Mitrov, I. Esemerov, P. Dovc(2014). Detection of recessive mutations(BLAD and CVM) in Holstein-Friesian cattle population in Republic of Macedonia. Maced. Vet. Rev. 37: 61-68.

Adil, S.A., H.Badar and T.Sher(2004). Factors affecting gross income of small farmers in District Jhang Pakistan.Pakistan J.Life.Soc.Sci. 2:153-155.

Agaoglu, O.K., A.R. Agaoglu and M. Saatci(2015). Estimating allele frequencies of some hereditary diseases in Holstein cattle reared in Burdur Province, Turkey. Turk. J. Vet. Anim. Sci. 39: 338-342.

Agerholm, J.S.(2007). Inherited disorders in Danish cattle.Apmis115:1-76.

Agerholm, J.S., O. Andersen, M. Almskou, C. Bendixen, J. Arnbjerg, G. Aamand, U. Nielsen, F. Panitz and A.H. Petersen(2004). Evaluation of the inheritance of the complex vertebral malformation syndrome by breeding studies. Acta.Vet.Scand.45:133.

Agerholm, J.S., A. Basse and K. Christensen(1993). Investigations on the occurrence of hereditary diseases in the Danish cattle population 19891991. Acta.Vet.Scand. 34:245-253.

Alaie, H., S.Z. Mirhoseini, M. Mehdizadeh, and S.B. Dalirsefat(2012). Identification of Complex Vertebral Malformation Carriers in Holstein and Guilan Native Cow Breeds in Iran Using SSCP Markers. Iranian. J. Appl. Anim. Sci. 2: 319322.

Albarella, S., F. Ciotola, E. D'Anza, A. Coletta, L. Zicarelli and Peretti V(2017). Congenital malformations in River Buffalo(Bubalus bubalis).Anim.7:9-23.

Alexiev, A.(1998). The water buffalo. Bulgaria: St. Kliment Ohridski University Press, p.14.

Al-Haggar, M.(2013). Evolving molecular methods for detection of mutations. Gene.Technol. 2:1-2.

Avanus, K. and A. Altinel(2017). Inherited Diseases of Holstein Cattle: Story so far in Turkey. J. Istanbul.Vet.Sci.2:40-46.

Berglund, B., A. Persson and H. Stalhammar(2004). Effects of complex vertebral malformation on fertility in Swedish Holstein cattle. Acta. Vet. Scand.45:161.

Betka, L., T. Kavar and V. Meglic(2008). Detection of recessive mutations(CVM, BLAD and RED FACTOR) in Holstein bulls in Slovenia. J. Cent. Eur.Agric.9:101-106.

Branda, S., M. Federici, F. Dutra, A. Romero, C. Briano, M.D. Rizza and S. Llambi(2016). Identification of Holstein heifer's carriers BLAD and citrullinemia in the Eastern region of Uruguay by PCR-RFLP and sequencing. Vet(Monte video).52:23-27.

Citek, J., V. Rehout, J. Hajkova and J. Pavkova(2006). Monitoring of the genetic health of cattle in the Czechrepublic. Vet Med 51:333-339.

Cruz, L.(2007). Trends in buffalo production in Asia. Ital.J.Anim.Sci.6:9-24.

Dhanda, O.(2005). Developments in water buffalo in Asia and Oceania. In: Proceedings of the Seventh World Buffalo Congress. Manila, Philippines:WBC, pp.17-28.

Duncan, R., C. Carrig, J. Agerholm and C. Bendixen(2001). Complex vertebral malformation in Holstein calf: report of a case in the USA. J. Vet.Diagn.Invest.13:333-336.

Eydivandi, C., C. Amirinia, N. Jomeh-Kashan, M. Chamani, J.Fayazi and H.R. Seyedabadi(2012). Study of citrullinemia disorder in Khuzestan Holstein cattle population of Iran. Afr. J. Biotechnol.11:2587-2590.

Fesus, L., I. Anton and A. Zsolnai(1999). Marker assisted selection in livestock, DUMPS, Weaver-diseases and citrullinemia in cattle populations. Llattenyesztes es Takarmanyozas. 48:193-203.

Food and Agriculture Organization(2009a). Livestock in the balance: State of Food and Agriculture. Italy, Rome:FAO, pp.2-9.

Food and Agriculture Organization(2009b). State of Food Insecurity in the world. Italy, Rome: FAO, p.27.

Gabor, M., M. Miluchova, A. Trakovika, Z. Riecka, J. Candrak and K. Vavrisinova(2012). Detection of complex vertebral malformation carriers in Slovak Holstein cattle by high resolution melting analysis. Acta.Vet.62:239-248.

Gaur, U., T.G. Sathe, A. Roy, P.S.S. Sunkara, R.K. Patel and P.S. Venkates(2012). Polymorphism in Argininosuccinate Synthase gene in Indian Holstein.Int.J.Vet.Sci. 1:115-117.

Ghanem, M.E., M. Akita, T. Suzuki, A. Kasuga and M. Nishibori(2008). Complex vertebral malformation in Holstein cows in Japan and its inheritance to crossbred F1 generation. Anim. Reprod.Sci.103:348-354.

Government of Pakistan(2017). Pakistan Economic Survey 2016-17. Islamabad, Pakistan: Economic Advisor's Wing, Finance Division, p.36.

Grupe, S., G. Dietl and M. Schwerin(1996). Population survey of citrullinemia on german Holsteins. Livest.Prod.Sci.45:35-38.

Healy, P.(1996). Testing for undesirable traits in cattle: an Australian perspective. J.Anim. Sci. 74: 917922.

Healy, P., J. Dennis, L. Camilleri, J. Robinson, A. Stell and R. Shanks(1991). Bovine citrullinemia traced to the sire of Linmack Kriss King. Aust. Vet.J.68:155-157.

Henriques, A., F. Carvalho, R. Pombinho, O. Reis, S. Sousa and D. Cabanes(2012). PCR-based screening of targeted mutants for the fast and simultaneous identification of bacterial virulence factors.Biotechniques. 53:1-7.

Husson, A., C. Brasse-Lagnel, A. Fairand, S. Renouf and A. Lavoinne(2003). Argininosuccinate synthetase from the urea cycle to the citrulline NO cycle.FEBSJ.270:1887-1899.

JianBin, L., W. Hongmei, Z. Yi, H. Minghai, Z. Jifeng and Z. Yuan(2011). Identification of BLAD and citrullinemia carriers in Chinese Holstein cattle. Anim.Sci.Pap.Rep. 29:37-42.

Khan, M.S., N. Ahmad and M. Khan(2007). Genetic resources and diversity in dairy buffaloes of Pakistan.PakistanVet.J.27:201-207.

Konersmann, Y.(2003). Herkunft, Verbreitung und bedeutung des CVM-gendefects in der Holstein Friesian-population.Zuchtungskunde. 75:9-15.

Kotikalapudi, R., R.K. Patel, R.S. Kushwah and P.S.S. Sunkara(2014). Identification of citrullinaemia carrier and detection of a new silent mutation at 240bp positionin ASS1 gene ofnormal Holstein cattle.Genetika.46:515-520.

Lin, D.Y., Y.C. Huang, J.C. Chen, T.W. Yang, T.F. Shiao and H.L. Chang(2001). Investigation of citrullinemia ofdairycattle in Taiwan. J.Taiwan Livest.Res.34:279-284.

Mahdipour, M., A. Sharma, P.P. Dubey, V. Kumar, B. Misra and A. Singh(2010). Identification of Complex Vertebral Malformation using polymerase chain reaction-primer introduced restriction analysis in Karan Fries bulls. Curr. T. Biotechnol.Pharm.4:850-854.

Mehmood, M.U., A. Qamar, S. Raza, H. Khan, Q. Shahzad and A. Sattar(2014). Dystocia due to Perosomus Elumbis(Acaudatus) in a buffalo. PakistanJ.Zool.46:1468-1470.

Meydan, H., M.A. Yildiz and J.S. Agerholm(2010). Screening for bovine leukocyte adhesion deficiency, deficiencyofuridine monophosphate synthase, complex vertebral malformation, bovine citrullinaemia, and factor XI deficiency in Holstein cows reared in Turkey. Acta. Vet. Scand.52:56.

Nagahata, H., H. Oota, A. Nitanai, S. Oikawa, H. Higuchi, T. Nakade, T. Kurosawa, M. Morita and H. Ogawa(2002). Complex vertebral malformation in a stillborn Holstein calf in Japan.J.Vet.Med.Sci.64:1107-1112.

Nasreen, F., N.A. Malik, M.N. Riaz and J.A. Qureshi(2009). Detection and screening of bovine leukocyte adhesion deficiency in Pakistan using molecular methods.Hereditas.146:74-78.

Nielsen, U.S, G.P. Aamand, O. Andersen, C. Bendixen, V.H. Nielsen and J.S. Agerholm(2003). Effects of complex vertebral malformation on fertility traits in Holstein cattle. Livest. Prod. Sci. 79: 233-238.

Oner, Y., A. Keskin and C. Elmaci(2010). Identification of BLAD, DUMPS, citrullinaemia and Factor XI deficiency in Holstein Cattle in Turkey. Asian.J. Anim.Vet.Adv.5:60-65.

Padeeri, M., K. Vijaykumar, S. Grupe, M.P. Narayan, M. Schwerin and M.H. Kumar(1999). Incidence of hereditary citrullinemia and bovine leucocyte adhesion deficiency syndrome in Indian dairy cattle(Bos taurus, Bos indicus) and buffalo(Bubalus bubalis) population. Archiv. fur Tierzucht.42:347-352.

Paiva, D.S., I. Fonseca, I.S.B. Pinto, P. Ianella, T.A. Campos, A.R. Caetano, S.R. Paiva, M.V.G.B Silva and M.F. Martins(2013). Incidence of bovine leukocyte adhesion deficiency, complex vertebral malformation, and deficiency of uridine-5-monophosphate synthase carriers in Brazilian Girolando cattle. Genet. Mol. Res. 12: 3186-3192.

Pasha, T. N. and Z. Hayat(2012). Present situation and future perspective of buffalo production in Asia. J.Anim.PlantSci.22:250-256.

Patel, R.K., K.M. Singh, K.J. Soni, J.B. Chauhan and K.R.S. Rao(2006). Lack of carriers of Citrullinaemia and DUMPS in Indian Holstein cattle.J.Appl.Genet.47:239-242.

Ramesha, K.P., A. Rao, R. Alex, G.R. Geetha, M. Basawaraju, M.A. Kataktalware, D.N. Das and S. Jayekumar(2017). Screening for genetic disorders in Indian Murrah and Surti buffalo(Bubalus bubalis) bulls. Buffalo Bull. 36: 133142.

Raza, S., A.Ullah, S.Khan and N.Teufel(2000). Buffalo milk production by small, medium and large farmers and their response to different innovations in the Punjab(Pakistan). In: Proceedings ofthe third Asian buffalo Congress. Kandy, SriLanka: ABC, pp.191-196.

Rehman, A., L. Jingdon, A.A. Chandio and I. Hussain(2017). Livestock production and population census in Pakistan: Determining their relationship with agricultural GDP using econometric analysis. Inform. Process. Agric. 4: 168-177.

Revell, S.(2001). Complex vertebral malformation in a Holste in calf in the UK.Vet.Rec.149:659-660.

Rezaee, A.R., M.R. Nassiry, B. Sadeghi, A.S. Motlagh, M. Tahmoorespour and R. Valizadeh(2009). Implication of complex vertebral malformation and deficiency of uridine monophosphate synthase on molecular-based testing in the Iranian Holstein bulls population. Afr. J. Biotechnol.8:6077-6081.

Robinson, J., J.Burns, C. Magura and R. Shanks(1993a). Low incidence of citrullinemia carriers among dairy cattle of the United States.J.DairySci.76: 853-858.

Robinson, J., R. Popp, R. Shanks, A. Oosterhof and J. Verkamp(1993b). Testing for deficiency of uridine monophosphate synthase among Holstein-Friesian cattle of North America and Europe. Livest.Prod.Sci.36:287-298.

Rusc, A.and S.Kaminiski(2007). Prevalence of complex vertebral malformation carriers among Polish Holstein-Friesian bulls. J. Appl. Genet. 48: 247252.

Sun, D., X. Fan, Y. Xie, Q. Chu, Y. Sun, S. Zhang, W. Gong, S. Chen and Y. Li(2011). Distribution of recessive genetic defect carriers in Chinese Holstein.J.DairySci.94:5695-5698.

Thomsen, B., P. Horn, F. Panitz, E. Bendixen, A.H. Petersen, L.E. Holm, V.H. Nielsen, J.S. Agerholm, J. Arnbjerg and C. Bendixen(2006). A missense mutation in the bovine SLC35A3 gene, encoding a UDP-N-acetylglucosamine transporter, causes complex vertebral malformation.GenomeRes.16:97-105.

Wang, C., Q. Tong, X.Z. Hu, L.G. Yang, X.Q. Zhong, Y. Yu, J.J. Wu, W.J. Liu, X. Li, G.H. Hua, H.Q. Zhao and S.J. Zhang(2011). Identification of complex vertebral malformation carriers in Holstein cattle in south China. Genet. Mol. Res. 10:2443-2448.

Wang, H., J. Li, M. Hou, X. Zhang, W. Liu and J. Zhong(2009). Development and application of PCRRFLP for detecting bovine citrullinemia and deficiency of uridine monophosphate synthase. ChineseJ.Vet.Sci.29:661-664.

Windsor, P. and J.S. Agerholm(2009). Inherited diseases of Australian Holstein-Friesian cattle. Aust. Vet. J.87:193-199.

Zhang, Y., X. Fan, D. Sun, Y. Wang, Y. Yu, Y. Xie, S. Zhangand Y.Zhang(2012).Anovel method for rapid and reliable detection of complex vertebral malformation and bovine leukocyte adhesion deficiency in Holstein cattle. J. Anim. Sci. Biotechnol.3:24.
COPYRIGHT 2020 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2020 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:K. Zahra, M. Imran, M. Y. Zahoor, K. Ashraf, K. H. Jaffry, A. Nadeem, I. Rashid, M. Younas, M. Akhta
Publication:Journal of Animal and Plant Sciences
Geographic Code:9INDI
Date:Apr 24, 2020
Words:5093
Previous Article:ANTI-OXIDATIVE EFFECT OF L-LYSINE ON POST THAW QUALITY OF NILI-RAVI BUFFALO BULL SEMEN(BUBALUS BUBALIS).
Next Article:EFFECT OF IBUPROFEN ALONE AND INCONJUGATION WITH VITAMINE AND SELENIUM ON EXPERIMENTALLY INDUCED COCCIDIOSIS IN BROLIERS.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |