Printer Friendly

MOLECULAR EXPRESSION OF CYCLIN DEPENDENT KINASE INHIBITOR (p21) IN CANINE TUMORS.

Byline: S. Manzoor, R. Saif, H. Sadia, S. Firyal, M. Tayyab, M. Mansha, A. K. Mahmood, A. S. Hashmi, A. R. Awan and M. Wasim

Keywords: Dog, Mutation, Quantitative RT-PCR, CDKN1A, Carcinomas, Tumor suppressor gene.

INTRODUCTION

Cancer is one of the most important cause of morbidity and mortality in pet animals, upto 41% in canine species (Bonnet et al., 2005).The anatomical and physiological similarities between canine and humans have been the basis of using the canine in oncology research for over a century. Many features make the dog an attractive model for human cancer biology research due to following reasons: long life span, life style, spontaneous cancer development and conventional chemotherapy treatment as compared to other laboratory animals (Kirknesset al., 2003). Canine mammary tumor is the most common tumor in sexually intact female dog and it represents the second most frequent tumor in dogs and humans after skin and lung cancer respectively (Sorenmoet al., 2003). In 53% of the cases tumor is malignant and more than 95% of these malignant tumors are carcinoma (Misdrop, 2002).

Similarly, canine mast cell tumor is the most common neoplasm, representing 7 to 25% and 11 to 27% of all skin tumors and malignant skin tumors in dogs (Bostocket al., 1973). This tumor is 3 to 10 cm in size, arises from dermis and sub cutis, mostly occur on cutaneous sites; 50 to 63% in trunk and perianal region, 33 to 40% on extremities and 10 to 15% on head and neck region (Strefezziet al., 2009). The p21 (tumor suppressor gene) is also known as cyclin dependent kinase inhibitor 1A, located on canine chromosome 12.These cyclin dependent kinase inhibitors(CDKIs), group of inhibitory proteins that control the cyclin dependent kinase activity and cell cycle progression in response to the intracellular and extracellular signals (Vidal and Koff 2000). On the basis of structural similarities and regulation of cell cycle, CDK1s are divided into 2 groups. CDKN1 or CIP/KIP family and CDKN2 or INK-4 family.

The CIP/KIP family (CDK interacting protein)/(kinase inhibitory protein) consist of three members, specifically p21/CIP1, p27/KIP1, and p57/KIP2, all of these protein shares common inhibitory domain for the binding of CDK complex (Sharpless, 2005). These proteins show structural similarities (60 residue homology) that are important for their inhibitory activity (Xing et al., 1993). The CIP/KIP proteins have broad specificity as compared to INK4 proteins for binding and inhibiting the cyclin-CDK complexes. The activity of cyclin-D-CDK4 is inhibited by these proteins, preventing the Rb phosphorylation during the transition of G1 to S phase and inhibit the activity of cyclin-A-CDK2 and cyclin-E-CDK2 in late G1 and early S phase respectively (Sharpless, 2005). The p21 gene expression is tightly regulated by transcriptional level (Tp53 dependent and independent mechanism) and posttranscriptional level (ubiquitin dependent and independent proteasome mediated degradation).

The two conserved p53 binding sites present on p21 promoter, and one of this site is required for Tp53 responsiveness after DNA damage (El-Deiry et al., 1995). p21 interacts with DNA polymerase accessory factor, PCNA (proliferation cell nuclear antigen), that regulates the DNA replication and damage repair (Abbas and Dutta, 2009). The over expression of p21 gene is positively correlated with the size, grade, invasiveness and aggressiveness of the tumor. The objectives of the present study are to have an insight of mutation and gene expression analysis of p21 gene using direct DNA sequencing and RT-qPCR respectively in the two types of canine tumors (mammary tumor and mast cell tumor) and normal tissue samples and to assess the possibility, whether the gene could be a putative target gene for the therapy of these tumors.

MATERIALS AND METHODS

Sample Collection: Total twenty six (n=26) tumors and normal healthy control tissue samples of canine specie were collected from Pet center UVAS and Asim Pet Clinic Lahore from 2012 to 2015(Table 1). All tissue samples, excisional biopsies, were frozen in liquid nitrogen and stored at -80AdegC for downstream processing. The study was approved by ethical committee of University of Veterinary and Animal Sciences, Lahore Pakistan.

Histological Examination: Formalinfixed paraffin embedded sections (5um thickness) from each tumor were stained with hematoxylin and eosin. Tumors were categorized by veterinary pathologist according to WHO classification.

DNA Extraction: Genomic DNA was extracted from tumor and normal healthy control tissues by using DNeasy Blood and Tissue Qaigen kit according to manufacturer's protocol. DNA concentration was measured using Nano Drop 2000 spectrophotometer (Thermo fisher scientific, Pittsburg PA, USA) and visualized by 0.8% agarose gel electrophoresis. All DNA samples were normalized with 50ng/uL concentration for PCR amplification.

Primer designing, Optimization and Amplification: Primers for Exon 2 and 3 were designed from p21 gene DNA sequence (Accession no; ENSCAFG00000029853) by primer3 software (http/www.Primer3.com), manufactured by Advance Bioscience International (Table 2). Primers were optimized with wide range of annealing temperature (52-65AdegC) by gradient PCR and touch down PCR along with variable concentration of MgCl2 (2.5 to 3.0mM), dNTPs and template DNA in thermo cycler (Applied Bio System).

DNA Sequencing: Amplified PCR products were run on 1.5% agarose gel along with 1kb ladder (Fermentas, USA) The gel was stained with ethidium bromide and visualized under UV-trans illuminator (Bio Red). The PCR products were purified by means of ethanol precipitation and sequenced at 3730ABI Genetic Analyzer."BioEdit v7.0.5" was used for sequence analysis.

Total RNA Extraction: Total RNA was extracted from tumor and normal tissues using a Thermo Scientific Gene Jet RNA purification kit (Boom et al., 1990). TriZol reagent was also used for fresh tissue samples (Hummon et al., 2007).Total RNA integrity and concentration was confirmed by agarose gel electrophoresis and Nanodrop Spectrophotometer.

Reverse Transcription: cDNA was synthesized using Revert Aid first strand cDNA synthesis Kit (Themo Fisher Scientific, Pittsburg, PA,USA).Random Hexamer and Oligo(dt) primers were used to synthesized the first strand cDNA according to manufacturer.

Primer Probe for qPCR: Pre-designed primer and probe for p21target gene was selected and purchased online by Applied Bio System and for data normalization, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was custom designed using ABI primer express software(Table # 3).

Quantitative Real-Time PCR and Data Analysis: The qPCR reaction conditions were determined during initial optimization. The PCR reactions were carried out in 96 well plates that contained cDNA sample for target and housekeeping gene according to the AB1 standard protocol. Data was presented as fold change in gene expression level in the target sample normalized to GAPDH housekeeping gene and relative to the control sample. A fold change above 1 was considered as up-regulation and below 1 was considered as down regulation of gene. Relative expression of the target gene (p21) was calculated by Livak method (Livak et al., 2000).

Table 1. Canine tumors with histological diagnosis.

Dogs###Sample-###Breed###Age###Sex###Tumor Tissues###and Grade

###ID

1###MAC-1###German shepherd###11###F###Mammary Tumors###Adenocarcinoma, II

2###MAC-2###German shepherd###9###F###Mammary Tumors###Adenocarcinoma, II

3###MAC-3###Golden retriever###10###F###Mammary Tumors###Adenocarcinoma, II

4###MAC-4###German shepherd###11###F###Mammary Tumors###Adenocarcinoma, II

5###MAC-5###German shepherd###5.5###F###Mammary Tumors###Adenocarcinoma, II

6###MAC-6###German shepherd###7###F###Mammary Tumors###Adenocarcinoma, III

7###MAC-7###German shepherd###5.5###F###Mammary Tumors###Adenocarcinoma, III

8###MAC-8###German shepherd###3.5###F###Mammary Tumors###Adenocarcinoma, III

9###MCT-1###Rottweiler###2###F###Mast Cell tumor###Cutaneous,I

10###MCT-2###German shepherd###3###F###Mast Cell tumor###Cutaneous,I

11###MCT-3###Labrador###5###M###Mast Cell tumor###Cutaneous,I

12###MCT-4###Labrador###12###M###Mast Cell tumor###Cutaneous,II

13###MCT-5###German shepherd###7###M###Mast Cell tumor###Cutaneous,II

Table 2. Primers of p21 gene

Primers###Primer Sequences ( 5' -3')###Product size###Annealing Temperature

Exon -2F###GTGCCATTCCCCAAGTGAC###548bp###56AdegC

Exon -2R###GCACCACGGATTCTGAGAGT

Exon -3F###CTTCGGCCCTAGGAGACATC###493bp###59AdegC

Exon -3R###CAGCCCCACCTTACCTCTG

Table 3. RT-qPCR primers for p21 and housekeeping gene.

Specie###Gene###Assay ID###Assay location/ Exon boundaries###Amplicon Length###Dye

Dog###p21###cf-02693025-m1###Exon 2-3###56bp###FAM

Dog###GAPDH###cat#4331348custom designed###655bp###59bp###VIC

Table 4: p21 gene expression with histological grade of malignancies.

Tumors type###Histologyand Grading###No. of Dogs###p21 Gene Expression

###Higher###Lower

Mammary Tumors###Adenocarcinoma, Grade II###5###4(80%)###1(20%)

###Adenocarcinoma, Grade III###3###2(67%)###1(33%)

Mast Cell Tumors###Cutaneous, Grade I###3###1(33%)###2(67%)

###Cutaneous, Grade II###2###2(100%)###-

Table 4. Tabulated representation of the p21 gene expression in canine tumors.

TUMOR SAMPLES###NORMAL SAMPLES###GENE EXPRESSION

###p21 GENE###GAPDH###SAMPLE###p21 GENE###GAPDH

SAMPLE###EXPRESSION###EXPRESSION###ID###EXPRESSION###EXPRESSION###FOLD

ID###(MEAN+-S.D)###(MEAN+-S.D)###ICT###(MEAN+-S.D)###(MEAN+-S.D)###ICT###ICT###CHANGE

MAC-1###28.396+-0.15###27.392+-1.21###1.004###NC-1###31.456+-0.24###29.734+-0.60###1.722###-0.718###1.64

MAC-2###20.328+-0.34###21.722+-0.22###-1.394###NC-2###25.387+-0.17###23.660+-0.40###1.727###-3.121###8.69

MAC-3###26.259+-0.68###24.155+-0.75###2.104###NC-4###25.889+-0.44###24.935+-0.20###0.954###1.15###0.45

MAC-4###19.649+-0.51###19.504+-0.80###0.145###NC-3###23.963+-0.11###21.436+-0.76###2.527###-2.382###5.21

MAC-5###27.076+-0.15###26.732+-0.54###0.344###NC-5###32.589+-0.63###29.75+-0.36###2.839###-2.495###5.63

MAC-6###21.431+-0.49###23.171+-0.37###-1.74###NC-6###25.632+-0.51###24.445+-0.54###1.187###-2.927###7.60

MAC-7###28.225+-0.19###27.312+-0.23###0.913###NC-7###30.514+-0.49###28.659+-0.33###1.855###-0.942###1.92

MAC-8###29.387+-0.70###26.868+-0.52###2.519###NC-7###32.596+-0.59###31.032+-0.80###1.564###0.955###0.51

MCT-1###25.634+-0.40###23.694+-0.28###1.94###NC-9###28.125+-0.75###27.435+-0.18###0.69###1.25###0.42

MCT-2###21.747+-0.24###18.857+-0.50###2.89###NC-10###25.356+-0.81###23.181+-0.62###2.175###0.715###0.609

MCT-3###31.573+-0.73###31.358+-0.29###0.215###NC-11###30.57+-0.39###28.945+-0.50###1.625###-1.41###2.657

MCT-4###32.356+-0.20###32.076+-0.75###0.28###NC-12###31.212+-0.42###28.062+-0.40###3.15###-2.87###7.31

MCT-5###24.738+-0.18###23.609+-0.70###1.129###NC-13###32.165+-0.05###30.185+-0.38###1.98###-0.851###1.803

RESULTS

The genomic DNA extracted from tumor and normal tissue samples were amplified by using exon2 and 3 of p21 gene. The amplified product of exon-2(548bp) and exon-3(493bp) were subjected to DNA sequence analysis by Sanger's method which showed no polymorphism in coding exons of p21 gene. Real time PCR experiment was conducted on canine tumors and normal samples and all templates DNA(c-DNA) were standardized with concentration 5ng/uL for experiment. Cycle threshold (CT) values of target and housekeeping gene were retrieved from ABI software and 2-IICtmethod was used for calculation of fold change on Microsoft excel 2010. ICT values of test (tumor sample) and calibrator (normal sample) were used for calculating the IICT and then these values underwent to the 2-IICt that represent the efficiency of the experiment.

Eight mammary adenocarcinoma samples of German shepherd and Golden retriever breed of dog were collected in this study; normal mammary tissues were also collected from same dog. p21 gene was up-regulated in (6/8) 75% in mammary adenocarcinoma samples MAC-2 and MAC-6 with highest fold change 8.69 and 7.6 respectively and down regulation of p21 gene was measured in MAC-3 and MAC-8 with fold change 0.45 and 0.51 respectively (Figure 1).Similarly, five mast cell tumor samples of German shepherd, Rottweiler and Labrador breed of dog were collected and normal skin tissues also collected from the same dog. p21 gene was up-regulated in 3/5 (60%) mast cell tumor samples with highest fold change 7.31 in MCT-4 and slightly up regulation was measured in MCT-3 and MCT-5 with fold change 2.65 and 1.81 respectively. MCT-1 and MCT-2 samples showed the down regulation of p21 gene with fold change 0.42 and 0.6 respectively (Figure 2).

Four of the five, grade II mammary adenocarcinomas showed higher p21 gene expression with 8.69 highest fold change whereas 2/3 grade III adenocarcinomas showed higher expression with 7.6 highest fold change (Table 4, Fig 1). One of the three, grade I mast cell tumors showed higher p21 gene expression where as both tumors of grade II also showed higher expression with 7.31 fold change (Table 4, Fig 2).

DISCUSSION

Cancer is the most common disorder in dogs although some dog breeds have a higher risk of developing certain cancer types. Priester and Mantel (1971) reported that particular breed of pedigree dogs show higher incidence of a particular type of tumor. Boxer and Rottweiler breeds have been reported to be particularly susceptible to cancers (Priester 1967; Peters 1969; Richard et al., 2001). Several studies reported the occurrence of particular tumors in particular breeds such as, mammary tumor in German shepherd and Cocker spaniel (Frye et al., 1967) and mast cell tumors in Labrador and Golden retriever (Mcnielet al., 2004; Murphy et al., 2004). In the present study, two types of canine tumors, mammary and mast cell tumors were collected from different breed of dogs mainly represented by German shepherd, Golden Retriever, Rottweiler and Labrador (Table 1). Mutation analysis and its associations with changes in levels of expression is a widely explored area.

In fact, gene expression studies provide new information regarding the putative role of genes in normal, diseased and other physiological conditions within the body. Expression profiling information can open new avenues to gain insight into different pathways involved in diseased conditions and how a gene product is influenced by different homeostasis body conditions. A similar hypothesis can be applied to the expression experiments conducted in present work. Precisely, in this study our concern was basically to determine the role of the tumor suppressor gene (p21) in canine tumors. Direct DNA sequencing and RT-qPCR techniques were used to find out any change in coding region and in expression of study gene. p21 is a cyclin dependent kinase inhibitor, that plays an important role in cell growth, differentiation and apoptosis (Xing et al., 1993) and also work as critical downstream effector of TP53 tumor suppressor gene (Ikeguchi et al., 1999).

It was initially thought that somatic mutation in p21 gene might be involved in tumor development, particularly for cases having wild type TP53; however, p21 gene mutation proved to be extremely rare in breast, lungs and ovarian carcinomas investigated (Marchetti et al., 1995; Mckenzie et al., 1997). The two most common polymorphism, serine to arginine at codon 31 of exon2 and a single nucleotide polymorphism in the 3' UTR of exon 3 have been reported in different human carcinoma (Shiohara et al., 1994). The p21 codon 31 polymorphism is linked with an increased risk of lung carcinoma (Sjalander et al., 1996), cervical carcinoma (Roh et al., 2009), mammary gland carcinoma (Brenda et al., 2002) and oral squamous cell carcinoma (Lei et al., 2009).

However, non-significant correlation was observed between polymorphisms and expression level of p21mRNA in gastric tissues (Akama et al., 1996) as well as between the polymorphism and the expression level of p21 protein in breast cancer (Lukas et al., 1997). In the present study, Sanger's sequencing was performed to obtain exon 2 and 3 sequences of the p21 gene. No polymorphism was detected in the tumors and normal control tissues samples. Different applications of gene expression in the field of molecular biology are in vogue for pet animals (dog and cat).

In human higher expression of p21 gene has been studied in different cancers especially, head and neck carcinoma (Kapranos et al., 2001), skin malignancies (Stoyanova et al., 2012), gastric carcinoma (Xiaowen et al., 2014), non-small cell lung cancer (Groeger et al., 2000), hepatocellular carcinomas (Zhang et al., 2009) and lower expression was reported in colorectal carcinomas (Al-Maghrabi et al., 2012) and epithelial ovarian cancer (Yan et al., 2004). In this study, 69% tumor samples showed the up regulation of p21 gene in canine specie. Seventy five percent mammary adenocarcinomas showed moderate to high expression as compared to normal mammary tissues (Fig 1). Over expression of p21 gene was detected in the canine tumor samples from the German shepherd breed with age 3 to 11years. These findings nearly correlate with the Klopfleisch and Gruber (2009) study, where the canine mammary adenocarcinomas showed the overexpression of p21 genes when compared to adenoma and carcinomas.

Chang and colleagues (2015) reported the overexpression of p21 gene at both mRNA and protein level in breast cancer tissues when compared with noncancerous tissues. Overexpression of p21 is significantly associated with larger tumor sizes, a poorly differentiated grade and lymph node metastasis. Similarly, in the case of mast cell tumor, 60% of samples showed over expression of p21 gene with 7.3 highest fold change (Fig 2). Moderate to markedly high expression of p21 protein in canine cutaneous mast cell tumor was reported by Wu et al., (2004) and in canine hair follicle and epidermal neoplasm by Inoue and coworkers (2006). In the studied tumors, the incident of p21 gene expression increased gradually from lower grade to higher grade and altered expression of p21 gene may be involved in malignant progression of studied tumors. These results indicated that p21 could be used as an important predictive and prognostic marker in canine tumors to improve therapy and prognosis.

Conclusion: This is first study from this part of world in which we have observed the altered expression of p21 gene but absence of polymorphism in coding region of target gene in tumor samples. Altered expression of p21 gene may be involved in malignant progression of canine tumors. However, due to limited quantity of canine tumors samples, there is a dire need to study the polymorphism in non-coding region that might be associated with altered expression of gene and larger number of canine tumors is also needed to further verify our results.

Acknowledgements: Authors are thankful to Higher Education Commission of Pakistan, staff of Molecular Biology and Biotechnology Lab. Quality Operation Lab, Asim pet clinic and Pet Center of UVAS for facilitating this study.

REFERENCES

Abbas, T and A.Dutta (2009). p21 in cancer: intricate networks and multiple activities. Nature reviews. Cancer. 9(6): 400.

Akama, Y., W. Yasui, H. Kuniyasu, H. Yokozaki, M. Akagi, H. Tahara, T. Ishikawa and E. Tahara (1996). No point mutations but a codon 31 polymorphism and decreased expression of the p21 (sdi1/waf1/cip1/mda6) gene in human gastric carcinomas. Mol. Cell. Diff. 4:187-198.

Al-Maghrabi,J., M.Al-Ahwal, A.Buhmeida, K.Syrjanen, A.Sibyani, E.Emam, A.Ghanim and M.Al-Qahtani (2012). Expression of cell cycle regulators p21 and p27 as predictors of disease outcome in colorectal carcinoma. J.G.I.T. Cancer. 43(2): 279-287.

Bonnett, B.N., A. Egenvall, A. Hedhammarand P. Olson (2005). Mortality in over 350000 insured Swedish dogs from 1995-2000: Breed, gender, age and cause specific rates. Acta. Vet. Scand. 46:105-120.

Boom, S.C., M. Salimans, C. Jansen, P. W. Dillen and J.V. Noordaa (1990).Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28(3):495-503.

Bostock, D.E (1973). The prognosis following surgical removal of mastocytomas in dogs. J. Small. Ani.Pract. 14(1):27-41.

Brenda, P.L., I.L.V. Staveren, P.Roosken, F.Grieu, E.M.J.J.Berns and B. Iacopetta (2002).Associations between common polymorphisms in Tp53 and P21waf1/Cip1 and phenotypic features of breast cancer.Carcinogenesis.23(2):311-315.

Chang,Y.W., Q.Tan, X.Zhu, Q.H.Qin, F.B.Zhu, Q.G. Mo and W.P.Yang (2015). Expression of CDKN1A/p21 and TGFBR2 in breast cancer and their prognostic significance.Int.J.Clin.Exp.Pathol. 8(11): 14619-14629.

El-Deiry,W.S.,T.Tokino, T.Waldman, J.D. Oliner, V.E.Velculescu, M.Burrell, D.E.Hill, E.Healy, J.L.Rees and S.R.Hamilton(1995). Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues. Cancer.Res. 55(13): 2910-2919.

Frye, F.L., C.R. Dorn. D.O.N. Taylor, H.H. Hibbard and M.R. Klauber (1967).Characteristics of canine mammary gland tumor cases. Ani. Hospital. 3:1-12.

Groeger, A.M., M.Caput, V.Esposito, A.Baldi,R.Rossiello, D.Santini, A.Mancini, H.E.Kaiser and F.Baldi (2000). Expression of p21 in non small cell lung cancer relationship with PCNA. Anticancer.Res. 20(5A): 3301-3305.

Hummon, A.B., S.R. Lim, M.J. Difilippantonio and T. Ried (2007). Isolation and solubilization of proteins after TRIzol extraction of RNA and DNA from patient material following prolonged storage.Biotechniques.42:467.

Ikeguchi, M., H.Saito, A. Kondo, S.Tsujitani, M.Maeta and N.Kaibara (1999).Mutated p53 proteinexpression and proliferative activity in advanced gastric cancer.Hepatogastroenterology.46: 2648-2653.

Inoue, M., H.Wu and S.Une (2006). Immunohistochemical detection of p27 and p21 proteins in canine hair follicle and epidermal neoplasms. J. Vet. Med.Sci. 68(8): 779-782.

Kapranos, N., G.P. Stathopoulos, L. Manolopoulos, E. Kokka, C. Papadimitriou and A.Bibas (2001). p53, p21 and p27 protein expression in head and neck cancer and their prognostic value.Anticancer.Res. 21(1B): 521-528

Kirkness, E.F., V. Bafna, A.L. Halpern, S.Levy, K. Remington, D.B.Rusch, A.L.Delcher, M.Pop, W. Wang, C.M. Frase, and J.C. Venter (2003). The dog genome: survey sequencing and comparative analysis. Science. 301: 1898-1903.

Klopfleisch, R and A.D.Gruber (2009).Differential expression of cell cycle regulators p21, p27and p53 in metastasizing canine mammary adenocarcinoma versus normal mammary glands.Res.Vet.Sci. 87: 91-96.

Lei, D., E.M.Sturgis, Z.Liu, M.E. Zafereo, Q.Wei and G.Li (2009). Genetic polymorphisms of p21 and risk of second primary malignancy in patients with index squamous cell carcinoma of the head and neck. Carcinogenesis. 31(2): 222-227.

Livak, K.J and T.D.Schmittgen (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods.25: 402-408.

Lukas,J., S.Groshen, B.Saffari, N.Niu, A.Reles, W.H.Wen, J.Felix, L.A.Jones, F.L.Hall and M.F.Press (1997). WAF1/Cip1 gene polymorphism and expression in carcinomas of the breast, ovary, and endometrium. American.J.Pathol. 150(1): 167.

Marchetti,A., F.Buttitta, S.Pellegrini, G.Bertacca, A.Lori, and G.Bevilacqua (1995). Absence of somatic mutations in the coding region of the Waf1/Cip1 gene in human breast, lung and ovarian carcinomas-a polymorphism at codon-31. Int. J. Oncology. 6(1): 187-189.

Mckenzie, K.E., A. Siva, S. Maier, I.B. Runnebaum, R. Seshadri and S. Sukumar (1997). Altered WAF1 genes do not play a role in abnormal cell cycle regulation in breast cancers lacking p53 mutations. Clin.Cancer.Res.3(9):1669-1673.

Mcniel, E.A., A.Prink and T.D. Obrien (2004).Biologic behavior of mast cell tumors in pug dogs. In: proceedings of the veterinary cancer society annual conference, Kansas City, Missouri.

Misdorp, W(2002). Tumors of the mammary gland. In: Meuten DJ (Ed.): Tumours in Domestic Animals. 4th Ed. Iowa State Press; Iowa.575-606.

Murphy, S., A.H.Sparkes, K. Smith, A.S. Blunden and M.J. Brearley (2004).Relationships between the histological grade of cutaneous mast cell tumors in dogs, their survival and the efficacy of surgical resection. Vet. Record. 154: 743-746.

Peters, J.A(1969). Canine mastocytoma: excess risk as related to ancestry. J.N.Cancer.Insti. 42: 435-443.

Priester, W.A(1967). Canine lymphoma: relative risk in the Boxer breed. J.N.Cancer.Insti 39: 833-845.

Priester, W.A and N.Mantel(1971). Occurrence of tumors in domestic animals: data from United States and Canadian colleges of veterinary medicine. J.N.Cancer.Insti. 47:1333-1344.

Richards, H.G., P.E.Mcneil, H.Thompson, and S.W. Reid (2001).An epidemiological analysis of a canine biopsies database compiled by a diagnostic histopathology service.Preventive.Vet.Med. 51: 125-136.

Roh, J.W., B.K. Kim, C.H. Lee, J. Kim, H.H. Chung, J.W. Kim, N.H. Park, Y.S. Song, S.Y.Park, and S.B. Kang (2009). P53 codon 72 and p21 codon 31 polymorphisms and susceptibility to cervical adenocarcinoma in Korean women. Onco. Res. Featuring Preclinical and Clinical Cancer Therapeutics. 18(9): 453-459.

Sharpless, N.E(2005). INK4a/ARF: a multifunctional tumor suppressor locus. Mutation Res/Fundamental and Mol. Mechanisms of Mutagenesis. 576(1): 22-38.

Shiohara,M., W.S. Eldeiry, M.Wada, T.Nakamaki, S.Takeuchi, R.Yang, D.L.Chen, B. Vogelstein and H.P.Koeffler (1994). Absence of WAF1 mutations in a variety of human malignancies.Blood. 84:3781-3784.

Sjalander, A., R.Birgander, A.Rannug, A.K. Alexandrie, G.Tornling and G.Beckman (1996). Association between the p21 codon 31 A1 (arg) allele and lung cancer. Human heredity. 46(4): 221-225.

Sorenmo, K (2003): Canine mammary gland tumors. Veterinary Clinics of North America: Small.Ani.Practice. 33: 573-596.

Stoyanova, T., N.Roy, S.Bhattacharjee, D.Kopanja, T.Valli, S.Bagchi and P.Raychaudhuri (2012). p21 cooperates with DDB2 protein in suppression of ultraviolet ray-induced skin malignancies. J. Bio. Chem. 287(5): 3019-3028.

Strefezzi, R.F., S.R.Kleeb,J.G.Xavier and J.L.Catao-Dias (2009). Prognostic indicators for mast cell tumors. Braz. J. Vet. Pathol. 2(2): 110-121.

Vidal, A. and A.Koff (2000). Cell-cycle inhibitors: three families united by a common cause. Gene. 247(1):1-15

Wu, H., T.Hayashi, and M.Inoue(2004).Immunohistochemical expression of p27 and p21 in canine cutaneous mast cell tumors and histiocytomas. Vet. Pathology. 41: 296-299.

Xiaowen,L., H.Yu, H.Cai and Y.Wang(2014).Expression of Cd24, P21, P53, and C-Myc in Alpha-Fetoprotein-Producing Gastric Cancer: Correlation with Clinicopathologic Characteristics and Survival. J. Surgical. Onco. 109(8): 859-864.

Xing, Y., G.Hannon, H. Zhang, R.Kobayashi and D.Beach (1993). p21 is a universal inhibitor of cyclin kinase. Nature. 366: 701-704.

Yan. X., L.Liang, D.Li, J.Li, C.Zhang and S.Yuan (2004). Expression of p21 (WAF1) and its relationship with p53 and PCNA protein in epithelial ovarian cancer. Chinese. J. Cancer. 23(1): 74-80.

Zhang, M.F., Z.Y.Zhang, J.Fu,Y.F.Yang and J.P.Yun (2009).Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma. J. Translational.Medicine. 7(1): 110.
COPYRIGHT 2019 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Date:Aug 27, 2019
Words:4752
Previous Article:LABORATORY SIMULATION STUDIES OF LEACHING OF THE PRIORITY PESTICIDES AND THEIR TRANSFORMATION PRODUCTS IN SOILS.
Next Article:EFFICIENT IN VITRO BULBLET PRODUCTION OF ENDANGERED HYACINTHELLA Micrantha (BOISS.) CHOUARD.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |