Printer Friendly

Livestock-associated Methicillin-Resistant Staphylococcus aureus sequence type 398 in humans, Canada.

High prevalence of colonization with livestock-associated (LA) methicillin-resistant Staphylococcus aureus (MRSA) sequence type (ST) 398 among pigs and pig farmers was first reported in the Netherlands (1) and has since been identified in Canada (2) and the United States (3). In Canada, this LA-MRSA strain was identified in pigs and pig farmers in southwestern Ontario, where prevalence of MRSA colonization was 24.9% (71/285) and 20% (5/25), respectively (2). In the United States, nasal samples from 20 production system workers and 299 swine from 2 farms in Illinois and Iowa showed that 45% (9/20) and 49% (147/299), respectively, were colonized with LA-MRSA (3). Despite such high prevalence of MRSA colonization on these tested farms, to our knowledge, no human or animal infections resulting from LA-MRSA strains have been reported in North America.

To determine whether LA-MRSA has recently emerged in the general population of Canada, we identified human infections and colonizations associated with the LA-MRSA strain in Canada and molecularly characterized the isolates. We also identified a novel staphylococcal cassette chromosome (SCC) mecV subtype harboring clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (cas).

Materials and Methods

A convenience sample, totaling 2,358 MRSA isolates from human specimens, was submitted to the National Microbiology Laboratory (NML) for spa typing, as described (4,5). During January 2007-October 2008, the Saskatchewan Disease Control Laboratory submitted 2,008 specimens; during October 2007-August 2008, the Cadham Provincial Laboratory in Manitoba submitted 350 specimens. An additional 1,329 isolates from human specimens were spa typed by the Saskatchewan Disease Control Laboratory.

Given the client base of the Cadham Provincial Laboratory, most of these isolates would have originated from colonized and infected persons living in the community or in personal-care homes or from persons hospitalized in smaller community hospitals, whereas, for surveillance purposes, the Saskatchewan Disease Control Laboratory receives isolates from all colonized and infected persons across the province. Detailed information regarding why cultures were taken (e.g., screening admissions, outbreak investigations) and other clinical and epidemiologic data were limited. Isolates typed in this study represented [approximately equal to] 17% of all MRSA isolates from persons in Manitoba and [approximately equal to] 66% of all MRSA isolates from persons in Saskatchewan within the study period. An additional isolate was sent to the NML from Sunnybrook Health Sciences Centre in Ontario for reference purposes.

Isolates with spa types associated with ST398 were confirmed by multilocus sequence typing; tested for Panton-Valentine leukocidin toxin, mecA, and nuc genes; and typed for SCCmec as described (6-9). Pulsed-field gel electrophoresis (PFGE) of Smal- or Qr91-digested genomic DNA was conducted as described (10). Antimicrobial drug susceptibility testing was conducted by using standard broth microdilution panels according to Clinical and Laboratory Standards Institute guidelines (11). Breakpoints for fusidic acid and mupirocin resistance, which were not provided in the guidelines, were as described (12,13).

A fosmid library was constructed by cloning sheared genomic DNA from S. aureus isolate 08 BA 02176 into the pCC2FOS vector. The fosmid clones were screened by PCR to identify specific genes orfX, mecA, and the chromosomal region located downstream of SCCmec. Fosmid clone 1G1 was identified and contained the entire SCCmec region of the 08 BA 02176 isolate. Colonies were prepared by using the CopyControl Fosmid Library Production Kit (Epicenter Biotechnologies, Madison, WI, USA) according to the manufacturer's instructions. Fosmid DNA was column purified by using a QIAGEN Plasmid Mini Kit (QIAGEN, Valencia, CA, USA).

DNA sequencing was performed on the ABI3730xl genetic analyzer (Applied Biosystems, Foster City, CA, USA). Staden (Pregap4) software was used to prepare trace data for sequence assembly (14). Sequencing reads were assembled by using the Staden Gap4 program. Gap closure was achieved by primer walking and long-range PCR. Specific primers were designed near the ends of neighboring contigs (contiguous sequence of DNA created by overlapping sequenced fragments of a chromosome), and PCRs were performed with chromosomal template DNA. Regions containing putative frameshifts and point mutations were resequenced to verify the fidelity of the sequence.

Annotation and data mining of the S. aureus 08 BA 02176 1G1 fosmid clone sequence were performed by using the GenDB version 2.2 annotation tool (15). Putative protein coding sequences were determined according to coding sequence predictions of Glimmer, which is integrated into the GenDB package. Similarity searches were performed by using BLASTN and BLAST2P (www.ncbi. nlm.nih.gov/blast/Blast.cgi) against the nonredundant nucleotide and protein databases, respectively. Additionally, a BLAST2P search was performed against the databases nr (ftp://ftp.ncbi.nlm.nih.gov/blast/db/), SWISS-PROT (www.expasy.ch/sprot/), and KEGG-Genes (ftp://ftp.genome.jp/pub/kegg/genes/); the protein family databases Pfam (http://pfam.sanger.ac.uk/) and TIGRFAM (www. jcvi.org/cms/research/projects/tigrfams/overview/); and predictive signal peptide (Signal P [www.cbs.dtu.dk/ services/SignalP/]) and transmembrane helix analysis (TMHMM [www.cbs.dtu.dk/services/TMHMM/]), the nonredundant database on protein level. An automatic functional annotation was followed by a manual annotation of each predicted gene.

Results

LA-MRSA Characterization

A total of 3,687 MRSA isolates were examined; 5 contained ST398-associated spa types (4 t034 and 1 t1250). The additional isolate submitted to NML by Sunnybrook Health Sciences Centre in Ontario, isolate T40929, also contained a t034 spa type. Further molecular characterization of these 6 isolates determined that they were all ST398, SCCmecV, and negative for the Panton-Valentine leukocidin-encoding genes (Table 1). Of the 6 isolates, 5 were resistant to tetracycline, but all were susceptible to the other 12 antimicrobial drugs tested (Table 2).

From the surveillance in Manitoba and Saskatchewan, patient information was limited and showed no geographic links (all 5 persons resided in different health regions but were all within the southeastern portion of Saskatchewan) (Figure 1). Of the 5 isolates, 4 were obtained from infected persons (average age 67.8 years, range 51-79 years) (Table 1). The earliest identified LA-MRSA isolate (08 BA 2176) associated with an infection was obtained from a postoperative surgical site. Further follow-up was not possible because of the patient's health problems. This patient is unlikely to have had any recent direct contact with livestock because she had been confined to her home with limited mobility for several years before her hospitalization. Additional nasal swabs from this patient remained positive for this strain for at least 7 months. Additional clinical and epidemiologic information for the remaining 3 patients with skin and soft tissue or wound infections were limited (Table 1).

The isolate submitted to the NML by Sunnybrook Health Sciences Centre, outside the surveillance program, was from a 59-year-old man from Ontario. He had been hospitalized in December 2007 for treatment of metastatic squamous cell carcinoma of the larynx. In the previous year, he had undergone a total laryngectomy, neck node dissection, and tracheostomy. A MRSA isolate was recovered from screening specimens from his nose and the tracheostomy site that had no indication of infection. He was unaware of any animal contact and had no history of exposure to pigs or pig farms. A review of the medical records and standard epidemiologic investigations determined that this was not a nosocomial or healthcare-associated isolate.

The 6 LA-MRSA isolates were nontypeable by PFGE using SmaI. However, PFGE using the neoschizomer Cfr91 showed that the 6 LA-MRSA isolates were closely related (Figure 2, panel A). Control MRSA strains digested individually with either Cfr91 or SmaI showed no differences in fingerprint banding patterns when the 2 enzymes were compared (data not shown), which enabled comparisons of the PFGE patterns obtained for the LA-MRSA isolates with those of other epidemic MRSA strains from hospitals and communities in Canada. No close relatedness was found ([greater than or equal to] 7 bands difference; <80% similarity) between the LA-MRSA isolates and any other epidemic MRSA strain circulating in Canada (Figure 2, panel B).

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

SCCmec Characterization

DNA sequencing of the entire SCCmec element from isolate 08 BA 02176 showed a 32,369-bp element integrated at the 3' end of orfX containing 30 putative open reading frames (ORFs) (Figure 3; Table 3). This element carried a class C2 mec complex, which putatively contained a nonfunctional IS431 transposase and a type 5 ccr gene complex (ccrC2). Other than mecA, no additional antimicrobial drug resistance genes were identified within this element.

The first unique feature of this SCCmecV element included 3 ORFs in the J3 region sharing high sequence identity with ORFs from S. epidermidis RP62A (GenBank accession no. CP000029), which included an ADP-ribosylglycohydrolase, a permease for cytosine/purines, and a ribokinase (Table 3). A second unique feature was a CRISPR array, identified by using CRISPRFinder (16), in the J1 region, which appears to have replaced the type 1 restriction modification system (hsdR, hsdS, hsdM) through recombination. The CRISPR array (1,107 bp) contained a 36-bp direct repeat consensus and 15 spacers of variable sequence and length (33-38 bp) (Figure 3). Downstream of this CRISPR array was a combination of putative CRISPR-associated (cas) genes, sharing sequence identity with those previously identified in S. epidermidis RP62A. This array was followed by a second questionable CRISPR array (183 bp) containing a 38-bp direct repeat consensus and 2 spacers of variable sequence (Figure 3; Table 3).

Design of primers spanning the entire SCCmec element was based on the DNA sequence obtained from 08 BA 02176 (Figure 3; Table 4). PCR of these select regions produced amplicons of expected size for 3 additional LA-MRSA isolates (07 BA 06477, 08 BA 13895, 08 BA 22334) but were negative for some of the J1 and J3 regions in 08 BA 08100 and T40929 (Table 4).

Discussion

The high prevalence of LA-MRSA colonization of pigs and pig farmers in Canada (2) and the United States (3) and this report of human infections suggest that this LA-MRSA strain from Canada poses potential public and occupational health concern in North America. This strain has been associated with various types of infections in pigs (17,18) and humans (19,20) and is transmissible from animal patients to veterinary workers (21), healthcare workers (22), and family members (1). Evidence also suggests that this strain might be spreading from animals to the environment, which may facilitate the colonization or infection of persons who are not involved in animal husbandry (23). Whereas in 2006 in the Netherlands LA-MRSA accounted for >20% of all MRSA isolated (24), carriage of this strain in the general population of 2 provinces in Canada (Manitoba and Saskatchewan) appears rare (0.14%). This difference could be attributed to the substantially higher density of pigs in the Netherlands (1,244 pigs/[km.sup.2]) than in Manitoba (55 pigs/[km.sup.2]), Saskatchewan (6 pigs/[km.sup.2]), and Ontario (91 pigs/[km.sup.2]) (www.agriculture.gov.sk.ca/ Pig_Densities). It is also plausible that the much lower proportions of LA-MRSA in Canada, relative to a country with low MRSA endemicity such as the Netherlands, is attributable to competition with other highly successful human epidemic MRSA clones circulating in Canada, including CMRSA2 (USA200/800), CMRSA7 (USA400), and CMRSA10 (USA300) (25,26).

The tested LA-MRSA isolates were highly susceptible to most classes of antimicrobial drugs, except [beta]-lactams and tetracyclines, the latter of which has been attributed to its high usage in animal husbandry (27). The complete sequence of the SCCmec region showed a novel SCCmecV subtype sharing sequence identity in its J1 and J3 regions with chromosomal genes in the S. epidermidis RP62A chromosome (GenBank accession no. CP000029), including a CRISPR system. CRISPRs and associated cas genes are present in many other bacterial ([approximately equal to]40%) and archaeal ([approximately equals] 90%) genomes (28,29) and have been shown to be involved in sequence-directed immunity against phages (30,31) and plasmids (32). The resistance to plasmids and phages encoded by this system could explain why many of these ST398-MRSA-V strains contain fewer antimicrobial drug resistance genes and phage-encoded virulence factors than do other epidemic MRSA strains (33,34). The origin of this CRISPR system is unknown, but the propagation of CRISPR loci throughout prokaryote genomes has been proposed to occur through horizontal gene transfer by conjugation of megaplasmids [greater than or equal to] 40 kb (35). Because the CRISPR system identified in this study is encoded within a putative mobile genetic element, we propose that an additional mechanism of mobilization to other methicillin-susceptible Staphylococcus spp. is plausible.

This novel subtype of SCCmecV was found in only 4 of the 6 LA-MRSA isolates identified in this study. One isolate not containing this novel SCCmec subtype (08 BA 08100) could also be distinguished by a different but closely related spa type (t1250) (Table 1) and variant PFGE fingerprint (Figure 2) when compared with the other LA-MRSA isolates, which suggests that at least 2 epidemiologically different strains of LA-MRSA circulate in Saskatchewan. The other LA-MRSA isolate that did not contain this novel SCCmec element was obtained in Ontario. However, this isolate was the same spa type (t034) and was closely related, according to PFGE, to the LA-MRSA isolates identified in Saskatchewan. Therefore, in addition to PFGE and spa typing, SCCmec subtyping could provide a useful epidemiologic tool for surveillance, outbreak investigations, or traceability studies of this emerging strain. For detection of this SCCmecV subtype (tentatively designated V.2.1.2; Vb), we propose using primer set 1 (spanning orfX into Sk02 in the J3 region) and primer set 7 (spanning Sk20 into cas1 in the J1 region) (Table 4).

Visual comparison of PFGE fingerprints from this study with those reported from patients from the Dominican Republic and the United States (northern Manhattan, New York, NY) (36), showed substantial variations in fingerprint patterns, as well as related but different spa types. These variations suggest further molecular and geographic diversity of these LA-MRSA strains on a global scale.

Because cases of LA-MRSA infections have only recently been identified in Canada, additional surveillance efforts are required to monitor the emergence and clinical relevance of this MRSA strain in Canada, including communities, the environment, livestock, farmers, and production facility workers. Whether these strains pose a major threat to human health in light of the low livestock density and continued spread of epidemic hospital and community strains of MRSA in Canada remains unknown.

DOI: 10.3201/eid1604.091435

Acknowledgments

We thank Jennifer Campbell and Dave Spreitzer for performing PFGE; Brynn Kaplen, Claude Ouellette, and Erika Landry for performing amplicon cleanup and DNA sequencing; and Philip Mabon, Kunyan Zhang, and Lisa Louie for helping with analysis of the SCCmec element.

Funding was provided by the Federal Genomics Research and Development Initiative.

References

(1.) Voss A, Loeffen F, Bakker J, Klaassen C, Wulf M. Methicillin-resistant Staphylococcus aureus in pig farming. Emerg Infect Dis. 2005;11:1965-6.

(2.) Khanna T, Friendship R, Dewey C, Weese JS. Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet Microbiol. 2008;128:298-303. DOI: 10.1016/j.vetmic.2007.10.006

(3.) Smith TC, Male MJ, Harper AL, Kroeger JS, Tinkler GP, Moritz ED, et al. Methicillin-resistant Staphylococcus aureus (MRSA) strain ST398 is present in midwestern U.S. swine and swine workers. PLoS One. 2009;4:e4258. DOI: 10.1371/journal.pone.0004258

(4.) Golding GR, Campbell JL, Spreitzer DJ, Veyhl J, Surynicz K, Simor A, et al.; Canadian Nosocomial Infection Surveillance Program. A preliminary guideline for the assignment of methicillin-resistant Staphylococcus aureus to a Canadian pulsed-field gel electrophoresis epidemic type using spa typing. Can J Infect Dis Med Microbiol. 2008;19:273-81.

(5.) Harmsen D, Claus H, Witte W, Rothganger J, Claus H, Turnwald D, et al. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J Clin Microbiol. 2003;41:5442-8. DOI: 10.1128/JCM.41.12.5442-5448.2003

(6.) Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008-15.

(7.) McDonald RR, Antonishyn NA, Hansen T, Snook LA, Nagle E, Mulvey MR, et al. Development of a triplex real-time PCR assay for detection of Panton-Valentine leukocidin toxin genes in clinical isolates of methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43:6147-9. DOI: 10.1128/JCM.43.12.6147-6149.2005

(8.) Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43:502633. DOI: 10.1128/JCM.43.10.5026-5033.2005

(9.) Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J, et al. Combination of multiplex PCRs for SCCmec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob Agents Chemother. 2007;51:264-74. DOI: 10.1128/AAC.00165-06

(10.) Mulvey MR, Chui L, Ismail J, Louie L, Murphy C, Chang N, et al.; Canadian Committee for the Standardization of Molecular Methods. Development of a Canadian standardized protocol for subtyping methicillin-resistant Staphylococcus aureus using pulsed-field gel electrophoresis. J Clin Microbiol. 2001;39:3481-5. DOI: 10.1128/ JCM.39.10.3481-3485.2001

(11.) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 17th informational supplement. Document M100-S17. Wayne (PA): The Institute; 2007.

(12.) Skov R, Frimodt-Moller N, Espersen F. Correlation of MIC methods and tentative interpretive criteria for disk diffusion susceptibility testing using NCCLS methodology for fusidic acid. Diagn Microbiol Infect Dis. 2001;40:111-6. DOI: 10.1016/S0732-8893(01)00262-0

(13.) Walker ES, Levy F, Shorman M, David G, Abdalla J, Sarubbi FA. A decline in mupirocin resistance in methicillin-resistant Staphylococcus aureus accompanied administrative control of prescriptions. J Clin Microbiol. 2004;42:2792-5.

(14.) Staden R, Beal KF, Bonfield JK. The Staden package. In: Misener S, Krawetz SA, editors. Computer methods in molecular biology, bioinformatics methods and protocols. Vol. 132. Totowa (NJ): The Humana Press Inc.; 1998. p. 115-130.

(15.) Meyer F, Goesmann A, McHardy AC, Bartels D, Bekel T, Clausen J, et al. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 2003;31:2187-95. DOI: 10.1093/nar/gkg312

(16.) Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007 Jul;35(Web Server issue):W52-7.

(17.) Schwarz S, Kalec K, Strommenger B. Methicillin-resistant Staphylococcus aureus and Staphylococcus pseudintermedius detected in the Bft-GermVet monitoring programme 2004-2006 in Germany. J Antimicrob Chemother. 2008;61:282-5. DOI: 10.1093/jac/dkm487

(18.) van Duijkeren E, Jansen MD, Flemming SC, de Neeling H, Wagenaar JA, Schoormans AH, et al. Methicillin-resistant Staphylococcus aureus in pigs with exudative epidermitis. Emerg Infect Dis. 2007;13:1408-10.

(19.) Witte W, Strommenger B, Stanek C, Cuny C. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, Central Europe. Emerg Infect Dis. 2007;13:255-8. DOI: 10.3201/ eid1302.060924

(20.) Krziwanek K, Metz-Gercek S, Mittermayer H. Methicillin-resistant Staphylococcus aureus ST398 from human patients, upper Austria. Emerg Infect Dis. 2009;15:766-9. DOI: 10.3201/eid1505.080326

(21.) Wulf MW, Serum M, van Nes A, Skov R, Melchers WJ, Klaassen CH, et al. Prevalence of methicillin-resistant Staphylococcus aureus among veterinarians: an international study. Clin Microbiol Infect. 2008;14:29-34. DOI: 10.1111/j.1469-0691.2007.01873.x

(22.) van Rijen MM, Van Keulen PH, Kluytmans JA. Increase in a Dutch hospital of methicillin-resistant Staphylococcus aureus related to animal farming. Clin Infect Dis. 2008;46:261-3. DOI: 10.1086/524672

(23.) Gibbs SG, Green CF, Tarwater PM, Mota LC, Mena KD, Scarpino PV. Isolation of antibiotic-resistant bacteria from the air plume downwind of a swine confined or concentrated animal feeding operation. Environ Health Perspect. 2006;114:1032-7.

(24.) van Loo I, Huijsdens X, Tiemersma E, de Neeling A, van de SandeBruinsma N, Beaujean D, et al. Emergence of methicillin-resistant Staphylococcus aureus of animal origin in humans. Emerg Infect Dis. 2007;13:1834-9.

(25.) Simor AE, Ofner-Agostini M, Bryce E, McGeer A, Paton S, Mulvey MR; Canadian Hospital Epidemiology Committee and Canadian Nosocomial Infection Surveillance Program. Laboratory characterization of methicillin-resistant Staphylococcus aureus in Canadian hospitals: results of 5 years of national surveillance, 1995-1999. J Infect Dis. 2002;186:652-60. DOI: 10.1086/342292

(26.) Christianson S, Golding GR, Campbell J; Canadian Nosocomial Infection Surveillance Program, Mulvey MR. Comparative genomics of Canadian epidemic lineages of methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2007;45:1904-11.

(27.) de Neeling AJ, van den Broek MJ, Spalburg EC, van Santen-Verheuvel MG, Dam-Deisz WDC, Boshuizen HC, et al. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol. 2007;122:366-72. DOI: 10.1016/j.vetmic.2007.01.027

(28.) Kunin V, Sorek R, Hugenholtz P. Evolutionary conservation of sequence and secondary structures in CRISPR repeats. Genome Biol. 2007;8:R61 10.1186/gb-2007-8-4-r61. DOI: 10.1186/gb-2007-8-4r61

(29.) Grissa I, Vergnaud G, Pourcel C. The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics. 2007;8:172 DOI: 10.1186/1471-21058-172

(30.) Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ, Snijders AP, et al. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science. 2008;321:960-4. DOI: 10.1126/science.1159689

(31.) Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007;315:1709-12. DOI: 10.1126/ science.1138140

(32.) Marraffini LA, Sontheimer EJ. CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science. 2008;322:1843-5. DOI: 10.1126/science.1165771

(33.) Monecke S, Jatzwauk L, Weber S, Slickers P, Ehricht R. DNA microarray-based genotyping of methicillin-resistant Staphylococcus aureus strains from eastern Saxony. Clin Microbiol Infect. 2008;14:534-45. DOI: 10.1111/j.1469-0691.2008.01986.x

(34.) Walther B, Monecke S, Ruscher C, Friedrich AW, Ehricht R, Slickers P, et al. Comparative molecular analysis substantiates zoonotic potential of equine methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2009;47:704-10. DOI: 10.1128/JCM.01626-08

(35.) Godde JS, Bickerton A. The repetitive DNA elements called CRISPRs and their associated genes: evidence of horizontal transfer among prokaryotes. J Mol Evol. 2006;62:718-29. DOI: 10.1007/ s00239-005-0223-z

(36.) Bhat M, Dumortier C, Taylor BS, Miller M, Vasquez G, Yunen J, et al. Staphylococcus aureus ST398, New York City and Dominican Republic. Emerg Infect Dis. 2009;15:285-7. DOI: 10.3201/ eid1502.080609

Author affiliations: National Microbiology Laboratory, Winnipeg, Manitoba, Canada (G.R. Golding, L. Bryden, M.R. Graham, S. Tyler, G. Van Domselaar, M.R. Mulvey); Saskatchewan Disease Control Laboratory, Regina, Saskatchewan, Canada (P.N. Levett, R.R. McDonald); Royal University Hospital, Saskatoon, Saskatchewan, Canada (A. Wong); Cadham Provincial Laboratories, Winnipeg (J. Wylie); Sunnybrook Health Sciences Centre, Toronto, Ontario, Canada (A.E. Simor); and Public Health Agency of Canada, Ottawa, Ontario, Canada (D. Gravel)

Dr Golding is a research scientist at the National Microbiology Laboratory, Winnipeg. His primary research interest focuses on antimicrobial drug resistance mechanisms, genomics, typing, and surveillance of S. aureus.

Address for correspondence: Michael R. Mulvey, National Microbiology Laboratory, 1015 Arlington Ave, Winnipeg, Manitoba R3E 3R2, Canada; email: michael_mulvey@phac-aspc.gc.ca
Table 1. Characteristics of methicillin-resistant Staphylococcus
aureus sequence type 398 novel staphylococcal cassette chromosome
mecV subtype isolates, Canada *

Isolate Collection Patient age, Region and province
 date y/sex

07 BA 06477 2007 Feb 27 26/F Saskatoon, SK
08 BA 02176 2008 Jan 15 71/F Sunrise, SK
08 BA 08100 2008 Mar 4 51/M Five Hills, SK
08 BA 13895 2008 Apr 25 79/M Kelsey Trail, SK
08 BA 22334 2008 Jul 9 70/M Prince Albert Parkland, SK
T40929 2007 Dec 11 59/M Durham, ON

Isolate Specimen collection site spa type

07 BA 06477 Nasal screen t034
08 BA 02176 Leg swab t034
08 BA 08100 Left shin open abrasion t1250
08 BA 13895 Left hip swab T034
08 BA 22334 Right leg swab T034
T40929 Nasal and tracheostomy T034
 screen

* All isolates were Panton-Valentine leukocidin negative.
SK, Saskatchewan; ON, Ontario.

Table 2. Antimicrobial drug susceptibility of the clinical isolates of
methicillin-resistant Staphylococcus aureus sequence type 398, Canada,
2008 *

 Susceptibility, [micro]g/mL

Drug 07 BA 06477 08 BA 02176

Clindamycin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Vancomycin 0.5 0.5
Erythromycin 0.5 0.5
SXT [less than or equal [less than or equal
 to] 0.25 to] 0.25
Synercid 0.5 1

Nitrofurantoin [less than or equal [less than or equal
 to] 32 to] 32
Tetracycline >16 >16

Ciprofloxacin 0.5 0.25
Rifampin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Fusidic acid 0.25 0.12
Linezolid 2 2
Gentamicin 1 1

Mupirocin 0.5 0.25

 Susceptibility, [micro]g/mL

Drug 08 BA 08100 08 BA 13895

Clindamycin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Vancomycin 0.5 0.5
Erythromycin 0.5 0.5
SXT [less than or equal [less than or equal
 to] 0.25 to] 0.25
Synercid [less than or equal [less than or equal
 to] 0.25 to] 0.25
Nitrofurantoin [less than or equal [less than or equal
 to] 32 to] 32
Tetracycline >16 [less than or equal
 to] 2
Ciprofloxacin 0.5 0.25
Rifampin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Fusidic acid 0.25 0.12
Linezolid 2 1
Gentamicin 1 1

Mupirocin [less than or equal [less than or equal
 to] 0.12 to] 0.12

 Susceptibility, [micro]g/mL

Drug 08 BA 22334 T40929

Clindamycin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Vancomycin 0.5 0.5
Erythromycin 0.5 0.5
SXT [less than or equal [less than or equal
 to] 0.25 to] 0.25
Synercid [less than or equal [less than or equal
 to] 0.25 to] 0.25
Nitrofurantoin [less than or equal [less than or equal
 to] 32 to] 32
Tetracycline >16 >16

Ciprofloxacin 0.5 0.5
Rifampin [less than or equal [less than or equal
 to] 0.25 to] 0.25
Fusidic acid 0.12 0.12
Linezolid 0.5 0.5
Gentamicin [less than or equal 1
 to] 0.5
Mupirocin 0.25 [less than or equal
 to] 0.12

* SXT, sulfamethoxazole/trimethoprim.

Table 3. Open reading frames of the novel staphylococcal cassette
chromosome mecV subtype in methicillin-resistant Staphylococcus aureus
isolate 08 BA 02176, from woman in Canada, 2008 *

 Predicted
ORF Location, bp ([dagger]) gene size, bp Gene ([double dagger])

Sk01 1-480 480 orfX
Sk02 609-1595 987 None
Sk03 1614-2948 1335 None
Sk04 2999-3883 885 None
Sk05 (4013-4687) 675 tnp
Sk06 4945-5112 168 None
Sk07 6029-6772 744 ugpQ
Sk08 6869-7297 429 maoC
Sk09 (7343-9349) 2007 mecA
Sk10 9449-9559 Unknown [psi]mecR1
Sk11 9597-9740 144 [psi]tnp
Sk12 (10331-10759) 429 None
Sk13 10840-11769 930 None
Sk14 11931-13919 1989 None
Sk15 14114-15223 1110 None
Sk16 15584-17200 1617 None
Sk17 17425-19104 1680 ccrC
Sk18 19193-19531 339 None
Sk19 19625-19936 312 None
Sk20 19951-20454 504 None
Sk21 20469-20690 222 None
Sk22 (20853-21256) 403 [psi]hsdR
Sk23 22888-23793 906 cas1
Sk24 23793-24098 306 cas2
Sk25 24112-26385 2274 csm1
Sk26 26388-26813 426 csm2
Sk27 26815-27459 645 csm3
Sk28 27530-28378 849 csm4
Sk29 28381-29403 1023 csm5
Sk30 29403-30671 1269 csm6
Sk31 30668-31402 735 cas6

ORF Product description

Sk01 Conserved hypothetical protein
Sk02 ADP-ribosylglycohydrolase
Sk03 Permease for cytosine/purines; uracil;
 thiamine; allantoin
Sk04 Ribokinase
Sk05 Transposase for IS431
Sk06 HMG-CoA synthase truncation
Sk07 Glycerophosphoryl diester
 phosphodiesterase
Sk08 Hypothetical protein
Sk09 Penicillin-binding protein 2'
Sk10 Truncated signal transducer protein MecR1
Sk11 Partial transposase for insertion sequence-
 like element IS431mec
Sk12 Hypothetical protein
Sk13 Hypothetical protein
Sk14 Hypothetical protein
Sk15 Hypothetical protein
Sk16 Hypothetical protein
Sk17 Cassette chromosome recombinase C
Sk18 Hypothetical protein
Sk19 Hypothetical protein
Sk20 Hypothetical protein
Sk21 Hypothetical protein
Sk22 Truncated hsdR
Sk23 CRISPR-associated Cas1 family protein
Sk24 CRISPR-associated protein Cas2
Sk25 CRISPR-associated protein; Csm1 family
Sk26 CRISPR-system related protein
Sk27 CRISPR-associated RAMP protein
Sk28 CRISPR-associated RAMP protein
Sk29 CRISPR-associated Csm5 family protein
Sk30 CRISPR-associated protein (Cas_Csm6)
Sk31 CRISPR-associated protein C

 Amino acid GenBank
ORF identity, % ([section]) accession no.

Sk01 100 gb[absolute value of ACC96139.1]
Sk02 99 gb[absolute value of AAW53059.1]
Sk03 98 gb[absolute value of AAW53058.1]
Sk04 98 gb[absolute value of AAW53057.1]
Sk05 100 dbj[absolute value of BAD24823.1]
Sk06 100 ref[absolute value of YP_184940.1]
Sk07 100 ref[absolute value of NP_370563.1]
Sk08 100 ref[absolute value of YP_184943.1]
Sk09 100 dbj[absolute value of BAG06200.1]
Sk10 100 ref[absolute value of YP_252007.1]
Sk11 100 dbj[absolute value of BAH57698.1]
Sk12 100 dbj[absolute value of BAD24829.1]
Sk13 100 gb[absolute value of ACL99839.1]
Sk14 100 gb[absolute value of ACL99840.1]
Sk15 100 gb[absolute value of ACL99841.1]
Sk16 100 gb[absolute value of ACL99843.1]
Sk17 100 gb[absolute value of ACL99844.1]
Sk18 100 gb[absolute value of ACL99845.1]
Sk19 100 gb[absolute value of ACL99846.1]
Sk20 100 gb[absolute value of ACL99847.1]
Sk21 100 gb[absolute value of ACL99848.1]
Sk22 92 dbj[absolute value of BAG71456.1]
Sk23 91 gb[absolute value of AAW53332.1]
Sk24 87 gb[absolute value of AAW53331.1]
Sk25 92 gb[absolute value of AAW53330.1]
Sk26 94 gb[absolute value of AAW53329.1]
Sk27 96 gb[absolute value of AAW53328.1]
Sk28 91 gb[absolute value of AAW53327.1]
Sk29 92 gb[absolute value of AAW53326.1]
Sk30 73 gb[absolute value of AAW53325.1]
Sk31 86 gb[absolute value of AAW53324.1]

* ORF, open reading frame; CRISPR, clustered regularly interspaced
short palindromic repeats.

([dagger]) Parentheses indicate complement sequences.

[double dagger]) None indicates no name given.

([section]) Comparisons of translated query versus protein databases
was determined by using BLASTX 2.2.21
(www.ncbi.nlm.nih.gov/blast/Blast.cgi).

Table 4. Primers used for coverage of the novel SCCmecV subtype in
methicillin-resistant Staphylococcus aureus isolates, Canada,
2007-2008 *

 Expected
Primer Primer Primer amplicon Reference
set name 5' [right arrow] 3' size, bp position

1 OrfX CATTTAAGATTATGCGTGGAG 347 443-789
 Adpr1 CATCTGTAAACTGTCCTTTGG
2 RibB2 TTGTATATGGGGAAACGAAG 3623 3793-7415
 MecaA1 TGCCAAAATCTCAGGTAAAG
3 MecB1 CTTCACCATTATCGCTTTTAG 1842 9172-11013
 HypA1 ACCATTTTTCCCTGGATTAC
4 Hyp3A1 CTTCCACGTATTGGTCTAGC 2671 11636-14306
 Hyp1B1 AAGTGAACGCGAAAGATATAG
5 Hyp3B1 GCTAGACCAATACGTGGAAG 3301 14287-17587
 CcrCA2 TTTTACCTGAAATGCCTGAG
6 CcrCB1 ATGAAATGGATAGCGAAATG 1330 18695-20024
 Hyp6A1 TTGAGTAAGTAGCGGTGTTG
7 Hyp6B1 TGAGCAAGTGATGGAAATG 2835 20331-23165
 Crspr1A1 CTTTGAATCCTTTGAAGACG
8 Crspr1B1 AAAAAGTGGTGAGGTTACTTG 711 23675-24385
 Crspr3A1 CTCGTCTATCAATACCACTCG
9 Crspr3B1 AACAGATGAACACGGAAAAG 2417 26166-28582
 Crspr7A1 TTGGTGGGTATCTCAAAAAG
10 Crspr7B1 GCCTTCTAACGTACCAGTTG 1511 29289-30820
 Hyp11A1 TTGCTTCAATGGACTATAAGC
11 Hyp11B1 TTAGGCATGGGGAAATATAG 1622 31373-
 Hyp12A1 GTCGCAATGTTTTGAAGTG

 SCCmecV found in isolate

Primer Primer 08 BA T 07 BA 08 BA 08 BA 08 BA
set name 02176 49209 06477 13895 08100 22334

1 OrfX + - + + - +
 Adpr1
2 RibB2 + - + + - +
 MecaA1
3 MecB1 + + + + + +
 HypA1
4 Hyp3A1 + + + + + +
 Hyp1B1
5 Hyp3B1 + + + + + +
 CcrCA2
6 CcrCB1 + + + + + +
 Hyp6A1
7 Hyp6B1 + - + + - +
 Crspr1A1
8 Crspr1B1 + - + + - +
 Crspr3A1
9 Crspr3B1 + - + + - +
 Crspr7A1
10 Crspr7B1 + - + + - +
 Hyp11A1
11 Hyp11B1 + - + + - +
 Hyp12A1

* SCCmec, staphylococcal cassette chromosome mecV subtype; +,
positive; -, negative. Testing by PCR.
COPYRIGHT 2010 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Golding, George R.; Bryden, Louis; Levett, Paul N.; McDonald, Ryan R.; Wong, Alice; Wylie, John; Gra
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:Apr 1, 2010
Words:5158
Previous Article:Upcoming infectious disease activities.
Next Article:Influenza a strain-dependent pathogenesis in fatal H1N1 and H5N1 subtype infections of mice.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters