Printer Friendly

Library of prefabricated locked nucleic acid hydrolysis probes facilitates rapid development of reverse-transcription quantitative real-time PCR assays for detection of novel influenza A/H1N1/09 virus.

In April 2009, a new influenza A H1N1 virus strain (H1N1/09) was identified (1). Despite preventive measures, this agent is continuing to spread. WHO consequently declared pandemic alert phase 6 in June 2009, indicating that a global pandemic is underway (2). Compared with seasonal influenza strains, the transmissibility of the new H1N1/09 virus is substantially higher (3). In the majority of cases, however, disease severity has been mild, with low case fatalities (4). Nevertheless, concerns still remain that the new virus will acquire virulence in a second wave of disease during the Northern Hemisphere winter season--a scenario observed in the severe 1918 influenza pandemic (5). The ongoing pandemic demonstrates the need for flexible laboratory tools for the rapid development of diagnostic tests. Among currently available laboratory methods, reverse-transcription quantitative real-time PCR (RT-qPCR) [4] assays have proven to be adequate for the laboratory-guided clinical diagnosis of influenza. RTq-PCR assays have largely replaced traditional virus culture and antigen-based methods (6). The development of novel RT-qPCR assays for the detection of viral pathogens still remains a fairly complex process, where delivery time of assay components has a large impact on the generation of results. To expedite this process, we designed a set of RT-qPCR assays based on the Universal ProbeLibrary (UPL)--a collection of 165 presynthesized, fluorescence-labeled DNA/locked nucleic acid (LNA) hybrid hydrolysis probes--to detect the new pandemic H1N1/09 virus strain. We evaluated candidate primer/UPL-probe pairs with 28 known positive samples of European and Mexican origin.

On the basis of multiple alignments of published influenza A sequences (see Supplemental Fig. S1, which accompanies the online version of this article at www. clinchem.org/content/vol55/issue12), we chose target regions for PCR primers in the hemagglutinin (HA) and neuraminidase (NA) genes. We designed PCR primer pairs using the Assay Design Center Web service (https://qpcr.probefinder.com/roche3.html) and evaluated 14 PCR primer pairs and LNA probes (Table 1) in the present study.

We performed nucleic acid extraction with a MagNA Pure LC instrument and the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche). Specimens comprised cell culture medium, native nasopharyngeal swabs, and nasal and throat washes. Nucleic acids were extracted from 200-[micro]L aliquots and eluted in 100 [micro]L elution buffer. Samples collected by swabs were resuspended in 1 mL of 0.9% NaCl solution before extraction.

To reverse-transcribe viral RNA, we used the Transcriptor First Strand cDNA Synthesis Kit (Roche) in a 20-[micro]L reaction volume including 10 [micro]L nucleic acid extract. A 25-[micro]L qPCR reaction contained 10 [micro]L cDNA, 400 nmol/L forward and reverse primers (0.5 [micro]L, 20 [micro]mol/L each), 200 nmol/L UPL probe (0.5 [micro]L, 10 [micro]mol/L), 12.5 [micro]L LightCycler 480 Probes Master (Roche), and 1.5 [micro]L nuclease-free water. Thermal cycling was on a LightCycler 480 instrument (Roche Diagnostics) under the following conditions: 95 [degrees]C for 10 min and 45 cycles at 95 [degrees]C for 10 s and 60 [degrees]C for 20 s.

For the construction of in vitro transcribed RNA standards, we amplified partial HA and NA gene fragments from cDNA obtained from the German H1N1/09 index patient (7). Online Supplemental Table S1 lists the respective primer sequences, positions, and amplicon sizes. PCR products were ligated into pCRII-TOPO plasmid vectors (Invitrogen) and cloned into E. coli. We confirmed recombinant plasmids by sequencing on a model 3730xl sequencer (Applied Biosystems). RNA was transcribed in vitro (RiboMAX kit; Promega), purified, and subjected to DNase digestion (RNeasy mini kit; Qiagen). After spectrophotometric quantification, we generated a 10fold dilution series of each transcript ([10.sup.8]-[10.sup.0] copies per reaction).

For the estimation of the linear range, amplification efficiency, and analytical sensitivity of the 4 best-performing assays, we tested different concentrations of NA and HA transcripts. Triplicates were processed for [10.sup.8],[10.sup.6],[10.sup.4], and [10.sup.2] copies per reaction and 6 replicates for [10.sup.1] and [10.sup.0] copies. To assess diagnostic specificity, we used influenza samples of human and animal origin (see online Supplemental Table S2). We analyzed 10 respiratory samples collected in June 2009 from Mexican patients with confirmed H1N1/09 infection. cDNA was diluted by a factor of 4 and processed as described above. Ten confirmed (8) H1N1/ 09-positive and 18 negative respiratory samples were collected in our diagnostic laboratory between May and August 2009. Eight positive nasal swab samples from the German Reference Center for Influenza (Robert-Koch-Institute, Berlin, Germany) were also available for analysis.

We initially carried out all 14 UPL probe-based RT-qPCR assays with a diluted nucleic acid preparation ([10.sup.1]-[10.sup.2] copies per reaction) known to be positive for H1N1/09. Twelve of 14 assays detected H1N1/09 without the need for further optimization (Table 1). We reviewed RT-qPCR quality characteristics (e.g., by comparison of quantification cycles, sigmoidal shape of the amplification curves, total level of the fluorescence signal, reproducibility of the results in replicates, stability of the baseline fluorescence level; data not shown) and chose assays 5, 8, 10, and 13 for further evaluation. The detailed results of these assays performed with 10-fold serial dilutions of each RNA control are provided in online Supplemental Fig. S2. The linear range of the assays was defined by the viral RNA concentration range over which the relationship between the log of RNA copies per RT-qPCR reaction and the quantification cycle was linear. As shown in Fig. 1, a linear relationship existed from 1.0 x [10.sup.1] up to at least 1.0 x [10.sup.8] RNA copies per PCR reaction for all 4 assays. Within the linear range, we calculated the best-fitting curve. Based on the slope of the curves, PCR efficiencies were 2.02 (102%, assay 5), 1.94 (94%, assay 8), 1.92 (92%, assay 10), and 2.03 (103%, assay 13). We analyzed 6 replicates of RNA standards containing 101 and 100 copies per reaction to estimate the analytical sensitivity of each assay. The detailed results of these experiments are provided in online Supplemental Table S3. In brief, all 4 assays reliably detected all replicates containing 101 copies per PCR reaction. Assay 5 was most sensitive, followed by assay 13. Based on the shape of the amplification curves, calculated PCR efficiencies, and analytical sensitivity, all further experiments were run with assays 5 and 13. We evaluated the diagnostic specificity of the assays using precharacterized seasonal influenza A and B and avian influenza virus culture samples (see online Supplemental Table S2) and observed no cross-reactivity. We tested 4 stored clinical samples positive for seasonal influenza A (2008/09 season), and all 4 samples were negative. No cross-reaction was observed with a set of other commonly encountered viral and bacterial pathogens (see online Supplemental Table S2).

We obtained data on the diagnostic performance of assays 5 and 13 with clinical specimens (see online Supplemental Table S4) by processing a total of 28 precharacterized positive and 18 negative samples. All 10 diluted positive cDNA samples of respiratory material from Mexico were detected by both assays. Among the set of precharacterized H1N1/09 samples from our diagnostic laboratory, all 10 H1N1/09-positive samples tested positive and all 18 negative samples tested negative. All 8 throat and nasal swab samples precharacterized as H1N1/09-positive by the German Reference Centre for Influenza were positive. Taken together, these data demonstrate 100% agreement of the results generated with assays 5 and 13 in comparison to the respective H1N1/09 reference assays.

[FIGURE 1 OMITTED]

The Universal ProbeLibrary (Roche Applied Science) comprises 165 presynthesized dual-labeled fluorogenic probes for use in PCR assays. Each probe is a DNA/LNA chimera, where some nucleotides are substituted by a locked nucleic acid, an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2'-oxygen and the 4'-carbon (9, 10). This conformation restriction increases thermal stability of duplexes (11). Chimeric DNA/LNA probes can therefore be designed as octamers or nonamers to be used under standard PCR conditions. The sequence composition of the presynthesized probes reflects the most frequently encountered octamers and nonamers in sequence data banks. Accordingly, PCR assays targeting most biologic sequences can be established by choosing appropriate and specific forward and reverse primers. Conventional assay design and optimization in RT-qPCR still remains fairly time-consuming. Dual-labeled probes usually have the longest order-to-delivery times among the necessary assay components. In contrast, unmodified PCR primers are available by overnight synthesis and next-day delivery. In this work, we demonstrated that a set of 165 presynthesized LNA-based probes can be used to efficiently develop RT-qPCR assays for the diagnosis of novel pathogens as soon as an appropriate diagnostic marker sequence of the corresponding target organism is available. After having completed in silico assay design on day 1 followed by overnight primer synthesis, we were able to perform the first experiments on day 2.

In the current influenza pandemic, availability of rapid and reliable diagnostic tools for the identification of infected individuals remains crucial for surveillance and to support clinicians in the decision whether to initiate antiviral therapy in high-risk patients (12). Antigen-based tests are incapable of meeting these demands because of their known suboptimal diagnostic sensitivity and specificity and inability to differentiate between influenza A strains (13). RT-qPCR assays are the method of choice for the laboratory diagnosis of novel H1N1/09 infection. Several protocols for the detection of the H1N1/09 virus have been published, but validation data on these assays are still limited (14-16).

We report on UPL RT-qPCR assays that reliably detect the H1N1/09 influenza virus and can be used in combination with established broad-range influenza A PCR assays (17). H1N1/09 served as a model to show the feasibility of the UPL approach for the expedited development of new diagnostic assays to detect emerging pathogens.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data, (b) drafting or revising the article for intellectual content, and (c) final approval of the published article.

Authors' Disclosures of Potential Conflicts of Interest: Upon manuscript submission, all authors completed the Disclosures of Potential Conflict of Interest form. Potential conflicts of interest:

Employment or Leadership: H. Walch, Roche Diagnostics GmbH.

Consultant or Advisory Role: None declared.

Stock Ownership: None declared.

Honoraria: None declared.

Research Funding: None declared.

Expert Testimony: None declared.

Role of sponsor: The funding organizations played no role in the design of study, choice of enrolled patients, review and interpretation of data, or preparation or approval of manuscript.

Acknowledgments: We thank S. Forster for expert technical assistance. We also thank M. Eickmann (Institute of Virology, Philipps-University, Marburg, Germany), A. Baillot, M. Monazahian (Niedersachsisches Landesgesundheitsamt, Hannover, Germany), B. Schweiger, and B. Biere (Robert Koch Institut, Berlin, Germany) for kindly providing influenza virus samples for specificity testing. Roche Applied Science (Penzberg, Germany) kindly provided the Universal ProbeLibrary hydrolysis probes.

References

(1.) Update: swine influenza A (H1N1) infections: California and Texas, April 2009. MMWR Morb Mortal Wkly Rep 2009;58:435-7.

(2.) WHO. World now at the start of 2009 influenza pandemic. 2009. http://www.who.int/mediacentre/ news/statements/2009/h1n1_pandemic_phase6_ 20090611/en/index.html (Accessed August 2009).

(3.) Neumann G, Noda T, Kawaoka Y. Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 2009;459:931-9.

(4.) Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ, et al. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med 2009;360:2605-15.

(5.) Taubenberger JK, Morens DM. 1918 Influenza: the mother of all pandemics. Emerg Infect Dis 2006;12:15-22.

(6.) Petric M, Comanor L, Petti CA. Role of the laboratory in diagnosis of influenza during seasonal epidemics and potential pandemics. J Infect Dis 2006;194 Suppl 2:S98-110.

(7.) Melzl H, Wenzel JJ, Kochanowski B, Feierabend K, Kreuzpaintner B, Kreuzpaintner E, et al. First sequence-confirmed case of infection with the new influenza A(H1N1) strain in Germany. Euro Surveill 2009;14(18):3-4; erratum 2009;14(19). Erratum available online.

(8.) Panning M, Eickmann M, Landt O, Monazahian M, Olschlager S, Baumgarte S, et al. Detection of influenza A(H1N1)v virus by real-time RT-PCR. Euro Surveill. 2009;14(36):7-12.

(9.) Braasch DA, Corey DR. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 2001;8:1-7.

(10.) Petersen M, Wengel J. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 2003;21:74-81.

(11.) Wahlestedt C, Salmi P, Good L, Kela J, Johnsson T, Hokfelt T, et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 2000;97:5633-8.

(12.) Update: novel influenza A (H1N1) virus infection: Mexico, March-May, 2009. MMWR Morb Mortal Wkly Rep 2009;58:585-9.

(13.) Chan KH, Lai ST, Poon LL, Guan Y, Yuen KY, Peiris JS. Analytical sensitivity of rapid influenza antigen detection tests for swine-origin influenza virus (H1N1). J Clin Virol 2009;45:205-7.

(14.) Carr MJ, Gunson R, Maclean A, Coughlan S, Fitzgerald M, Scully M, et al. Development of a real-time RT-PCR for the detection of swine-lineage influenza A (H1N1) virus infections. J Clin Virol 2009;45:196-9.

(15.) Lau SK, Chan KH, Yip CC, Ng TK, Tsang OT, Woo PC, Yuen KY. Confirmation of the first Hong Kong case of human infection by novel swine origin influenza A (H1N1) virus diagnosed using ultra-rapid, real-time reverse transcriptase PCR. J Clin Microbiol 2009;47:2344-6.

(16.) Poon LL, Chan KH, Smith GJ, Leung CS, Guan Y, Yuen KY, Peiris JS. Molecular detection of a novel human influenza (H1N1) of pandemic potential by conventional and real-time quantitative RTPCR assays. Clin Chem 2009;55:1555-8.

(17.) Ward CL, Dempsey MH, Ring CJ, Kempson RE, Zhang L, Gor D, et al. Design and performance testing of quantitative real time PCR assays for influenza A and B viral load measurement. J Clin Virol 2004;29:179-88.

Jurgen J. Wenzel, [1] * Heiko Walch, [2] Markus Bollwein, [1] Hans Helmut Niller, [1] Waltraud Ankenbauer, [2] Ralf Mauritz, [2] Hans-Joachim Holtke, [2] Hector Manuel Zepeda, [3] Hans Wolf, [1] Wolfgang Jilg, [1] and Udo Reischl [1]

[1] Institute of Medical Microbiology and Hygiene, University of Regensburg, Regensburg, Germany; [2] Roche Diagnostics GmbH, Penzberg, Germany; [3] Laboratorio Medicina de Conservation, Escuela Superior de Medicina, Instituto Politecnico Nacional, Colonia de Santo Tomas, Mexico; * address correspondence to this author at: Institute of Medical Microbiology and Hygiene, University of Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg, Germany. Fax +49-941-944-6402; e-mail juergen.wenzel@klinik.uni-regensburg.de.

[4] Nonstandard abbreviations: RT-qPCR, reverse-transcription quantitative real-time PCR; UPL, Universal ProbeLibrary; LNA, locked nucleic acid; HA, hemagglutinin; NA, neuraminidase.

Previously published online at DOI: 10.1373/clinchem.2009.136192
Table 1. Primer sequences and UPL probes used for the pandemic
H1N1/09 virus RT-qPCR assays. (a)

 Amplicon
 size, bp Target
Assay (b) gene Forward primer, 5'-3'

1 62 NA CCCAAAGAGAACACAATCTGG
2 62 NA CCCAAAGAGAACACAATCTGG
3 65 NA ACAATCCACGCCCTAATGAT
4 67 NA TGTTAACATCAGCAACACCAACT
5 69 NA TGAGTCAGTCGCTTGGTCAG
6 86 NA TGGCATCAATTGGCTAACAA
7 86 NA TGGCATCAATTGGCTAACAA
8 87 NA TCAAGAAACGGTTTTGAGATGA
9 76 NA TCAGGATATAGCGGGAGTTTTG
10 66 HA AACACCCAAGGGTGCTATAAAC
11 70 HA CCCAAAGTGAGGGATCAAGA
12 75 HA ATGGGACTTATGACTACCCAAAAT
13 75 HA GAGGAAGCAAAATTAAACAGAGAAG
14 97 HA GGTGTAACGGCAGCATGTC

 Position,
Assay nt (c) Reverse primer, 5'-3' Position, nt

1 1291-1311 TCACTGTTTACACCACAAAAGGA 1330-1352
2 1291-1311 TCACTGTTTACACCACAAAAGGA 1330-1352
3 971-990 TCCATTTGCTCCATTAGACGA 1015-1035
4 198-220 ATTGCCCGCTAATTTCACG 246-264
5 522-541 CCAGAAATTCCAATTGTTAGCC 569-590
6 558-577 TGTCTGTTATTATGCCGTTGTACTT 619-643
7 558-577 TGTCTGTTATTATGCCGTTGTACTT 619-643
8 1099-1120 TCCTACGATATCTTGCTTTATTGAGA 1160-1185
9 1198-1219 CAACCCAGAAGCAAGGTCTTA 1253-1273
10 891-912 TTTCCAATTGTGATCGGATG 937-956
11 703-722 TTATTTTGTCTCCCGGCTCTAC 751-772
12 1493-1516 CCAGCTTTACCCCATCTATTTC 1546-1567
13 1522-1546 CGCCAAAATCTGGTAAATCC 1577-1596
14 442-460 TGCTGAGCTTTGGGTATGAA 519-538

 UPL Probe binding H1N1/09
Assay probe sequenced Position, nt detection

1 32 CTGCTCCC 1318-1325 +
2 132 TGCTGCTC 1320-1327 +
3 96 CTGCCTGT 994-1001 +
4 120 CTGCTGGA 224-231 +
5 148 TTGATGCC 559-566 + (e,f)
6 43 CTGCCCCA 600-607 -
7 76 TGGCTGTG 608-615 -
8 123 CTGTCCCA 1143-1150 + (e)
9 89 CAGCATCC 1222-1229 +
10 75 CAGCCTCC 915-922 + (e)
11 130 CTGGACAC 741-748 +
12 6 TTCCTCTG 1520-1527 +
13 151 ATTCCAGC 1563-1570 + (e,f)
14 67 TGCTGGAG 465-472 +

(a) H1N1/09 detection was assessed by testing a diluted positive
patient sample ([10.sup.1]-[10.sup.2] copies per reaction).

(b) bp, base pair; nt, nucleotide; +, positive result; -,
negative result.

(c) Reference sequence accession numbers (GenBank): FJ966084 (NA),
FJ966082 (HA).

(d) Probes 5'-labeled with FAM and 3'-labeled with a dark quencher
dye; strand direction and LNA bases not disclosed by the
manufacturer.

(e) Assays chosen for further evaluation.

(f) Assays chosen for detailed evaluation based on test quality
characteristics.
COPYRIGHT 2009 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Brief Communications
Author:Wenzel, Jurgen J.; Walch, Heiko; Bollwein, Markus; Niller, Hans Helmut; Ankenbauer, Waltraud; Maurit
Publication:Clinical Chemistry
Date:Dec 1, 2009
Words:2789
Previous Article:Amniotic fluid digestive enzyme analysis is useful for identifying CFTR gene mutations of unclear significance.
Next Article:Simultaneous liquid-chromatographic determination of plasma catecholamines and metabolites.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |